ID: 936641221

View in Genome Browser
Species Human (GRCh38)
Location 2:114314661-114314683
Sequence AGTTATCTGGACAAGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936641221_936641226 15 Left 936641221 2:114314661-114314683 CCTCCCATCTTGTCCAGATAACT No data
Right 936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
936641221_936641228 22 Left 936641221 2:114314661-114314683 CCTCCCATCTTGTCCAGATAACT No data
Right 936641228 2:114314706-114314728 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
936641221_936641227 16 Left 936641221 2:114314661-114314683 CCTCCCATCTTGTCCAGATAACT No data
Right 936641227 2:114314700-114314722 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
936641221_936641225 4 Left 936641221 2:114314661-114314683 CCTCCCATCTTGTCCAGATAACT No data
Right 936641225 2:114314688-114314710 TCTTTTTGAGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936641221 Original CRISPR AGTTATCTGGACAAGATGGG AGG (reversed) Intergenic
No off target data available for this crispr