ID: 936642315

View in Genome Browser
Species Human (GRCh38)
Location 2:114328501-114328523
Sequence ATCTAATAACTGATTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936642315_936642317 -8 Left 936642315 2:114328501-114328523 CCCTCTTCAATCAGTTATTAGAT No data
Right 936642317 2:114328516-114328538 TATTAGATACAAGACAGCTCAGG No data
936642315_936642319 9 Left 936642315 2:114328501-114328523 CCCTCTTCAATCAGTTATTAGAT No data
Right 936642319 2:114328533-114328555 CTCAGGAAGACCGTGGCATTAGG No data
936642315_936642318 2 Left 936642315 2:114328501-114328523 CCCTCTTCAATCAGTTATTAGAT No data
Right 936642318 2:114328526-114328548 AAGACAGCTCAGGAAGACCGTGG No data
936642315_936642320 14 Left 936642315 2:114328501-114328523 CCCTCTTCAATCAGTTATTAGAT No data
Right 936642320 2:114328538-114328560 GAAGACCGTGGCATTAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936642315 Original CRISPR ATCTAATAACTGATTGAAGA GGG (reversed) Intergenic
No off target data available for this crispr