ID: 936644184

View in Genome Browser
Species Human (GRCh38)
Location 2:114349732-114349754
Sequence TGGAATTATGCCCATGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936644184_936644187 5 Left 936644184 2:114349732-114349754 CCTAGGACATGGGCATAATTCCA No data
Right 936644187 2:114349760-114349782 TTCTTTGCAATTCTATAACAAGG No data
936644184_936644188 9 Left 936644184 2:114349732-114349754 CCTAGGACATGGGCATAATTCCA No data
Right 936644188 2:114349764-114349786 TTGCAATTCTATAACAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936644184 Original CRISPR TGGAATTATGCCCATGTCCT AGG (reversed) Intergenic
No off target data available for this crispr