ID: 936647159

View in Genome Browser
Species Human (GRCh38)
Location 2:114385082-114385104
Sequence CTACTTTAGTAGAAGGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936647155_936647159 14 Left 936647155 2:114385045-114385067 CCTTATTCTCAGTTGGGCTGAAT No data
Right 936647159 2:114385082-114385104 CTACTTTAGTAGAAGGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936647159 Original CRISPR CTACTTTAGTAGAAGGCAGT TGG Intergenic
No off target data available for this crispr