ID: 936650757

View in Genome Browser
Species Human (GRCh38)
Location 2:114423408-114423430
Sequence AATCCCTCTCTAATTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936650757_936650763 10 Left 936650757 2:114423408-114423430 CCTGCAGCAATTAGAGAGGGATT No data
Right 936650763 2:114423441-114423463 GGGAGGAACTGAGAAGAACTAGG No data
936650757_936650760 -7 Left 936650757 2:114423408-114423430 CCTGCAGCAATTAGAGAGGGATT No data
Right 936650760 2:114423424-114423446 AGGGATTAACCCACACAGGGAGG No data
936650757_936650764 23 Left 936650757 2:114423408-114423430 CCTGCAGCAATTAGAGAGGGATT No data
Right 936650764 2:114423454-114423476 AAGAACTAGGTCATGTATTCTGG No data
936650757_936650759 -10 Left 936650757 2:114423408-114423430 CCTGCAGCAATTAGAGAGGGATT No data
Right 936650759 2:114423421-114423443 GAGAGGGATTAACCCACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936650757 Original CRISPR AATCCCTCTCTAATTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr