ID: 936652759

View in Genome Browser
Species Human (GRCh38)
Location 2:114448432-114448454
Sequence ATGGGTCTACAAATGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936652759 Original CRISPR ATGGGTCTACAAATGAAGCA TGG Intronic
901680364 1:10909555-10909577 ATGGGTCAGGAAATGAAGGAAGG - Intergenic
908849300 1:68358571-68358593 CTGGTTCTAAAAATGAACCATGG + Intergenic
912171777 1:107108876-107108898 ATTGGTCTTTAAATGGAGCAAGG - Intergenic
912631362 1:111249145-111249167 AAGGCTCTACCAATGAAGCACGG - Intergenic
913116211 1:115699756-115699778 ATGTGTCTAAAAATAAGGCAAGG + Intergenic
915960388 1:160262044-160262066 ATGGGTCACCCAACGAAGCAAGG + Intronic
918498667 1:185169232-185169254 ATGGTTCAAAAAATGTAGCAAGG - Intronic
919382318 1:196874466-196874488 ATGGGTAGACAAATGCAGCCAGG + Intronic
922724695 1:227917440-227917462 ATGGGTCTGGAAAGGAAGCCTGG + Intergenic
1071768459 10:88697202-88697224 AAGGATGTACAAATGAATCATGG + Intergenic
1078650244 11:13184588-13184610 ATTGGTCTACATATGAGGCAGGG + Intergenic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1086867104 11:91993010-91993032 CTGGGTCTAGGAGTGAAGCAAGG + Intergenic
1088088913 11:106014083-106014105 ATATGTTTGCAAATGAAGCAAGG - Intronic
1089931767 11:122320001-122320023 ATTTGTCTAAAAATGAAACAAGG + Intergenic
1090370144 11:126244948-126244970 ATTGGTCTACAGATTAAGCATGG + Intronic
1095580572 12:43792451-43792473 ATAGTTCTACAAATGATTCATGG - Intergenic
1096775789 12:53963275-53963297 CTGGGTCTACACAAGTAGCAGGG + Intergenic
1097283366 12:57859667-57859689 AGGGGTCTAAAACTGAGGCAAGG - Intergenic
1099203408 12:79701355-79701377 AAAGGTCTACAAATCAAGTAAGG + Intergenic
1101674148 12:106902491-106902513 CTAGGTCTACAGATGAAACAAGG - Intergenic
1102946020 12:116988848-116988870 ATGGGTGTACGAAGGAAGCAAGG + Exonic
1105645240 13:22311299-22311321 ATGTGTCTACAAGCCAAGCAAGG + Intergenic
1111255916 13:85668746-85668768 ATGGGTTCAGAAAAGAAGCAAGG + Intergenic
1117792894 14:59359380-59359402 ATGTTTCTACAATTGAAGAAGGG - Exonic
1117950372 14:61076837-61076859 ATGGGTCTTCAAGTAGAGCAGGG + Intronic
1118808624 14:69258365-69258387 AAGGGTCTACACAAGTAGCAGGG - Intergenic
1119665485 14:76482274-76482296 ATGTGGCTCCAAATGAAGCATGG + Intronic
1120019362 14:79510897-79510919 ATGGGAATACAGATGAGGCAGGG - Intronic
1133204620 16:4225898-4225920 ATGGGGTTACAGGTGAAGCAGGG - Intronic
1134739674 16:16531437-16531459 ATTGGTGTGGAAATGAAGCAGGG - Intergenic
1134927825 16:18180715-18180737 ATTGGTGTGGAAATGAAGCAGGG + Intergenic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1139747732 16:69088003-69088025 AGGGGTGAACAAACGAAGCAAGG - Intergenic
1140762146 16:78119333-78119355 CTGTGTCTAAAAACGAAGCAGGG - Intronic
1153372190 18:4331661-4331683 ATGGGCTTACAGAGGAAGCAGGG - Intronic
1153665767 18:7366822-7366844 ATGGGGATACAAATGACACATGG - Intergenic
1155767529 18:29653598-29653620 ATGGGTCTGCAAATGCCACAGGG + Intergenic
1156127521 18:33924865-33924887 ATGGGTCTACAAATAAACATAGG + Intronic
1157001991 18:43537919-43537941 AAGGGTCCACAAAAGAGGCAGGG + Intergenic
1161567083 19:5009219-5009241 ATGGCTCAATAAAGGAAGCAGGG - Intronic
1164201507 19:23022811-23022833 ATGGGTCTATAAAAGCAGAAAGG - Intergenic
928108246 2:28486715-28486737 ATGGGGCTACAAATGAGTCAGGG + Intronic
929096217 2:38265496-38265518 ATGGTTCTGAAAATGAAGCTAGG - Intergenic
935494330 2:103760068-103760090 ATGTGACTACAAGTGAAGGAAGG - Intergenic
935898119 2:107759703-107759725 ATGGGTCTAGAAGTAAAGAAGGG + Intergenic
936380647 2:111982825-111982847 ATGGGGCTACAAAAGAAAAAAGG - Exonic
936652759 2:114448432-114448454 ATGGGTCTACAAATGAAGCATGG + Intronic
941482284 2:166031154-166031176 ATTGGTCTCCAAAAGAAGAAAGG - Intronic
941884390 2:170513395-170513417 ATGGGTCTACAAACCAAGGAAGG - Intronic
942210897 2:173668970-173668992 ATGGATCTACAAATTTGGCAAGG + Intergenic
945566210 2:211403361-211403383 ATGAGTCTTCAAAAGAAGAAGGG - Intronic
1170964579 20:21054919-21054941 GCGGGTCTCCAAATGAACCAAGG + Intergenic
1171227117 20:23451190-23451212 ATGGATGAAGAAATGAAGCAAGG - Intronic
1172791337 20:37507488-37507510 TTGGGTCTTCAATTGCAGCAGGG - Intronic
1173556604 20:43970722-43970744 ATGGGGCTATAAATTAGGCAGGG - Intronic
1173653698 20:44684341-44684363 ATGGGTAGAGAAATGAAGGAAGG + Intergenic
1178340502 21:31782104-31782126 ATGAGTCTGCAAATGTAGGAAGG - Intergenic
1178638139 21:34323004-34323026 ATGGTTCTAGGAAAGAAGCAAGG - Intergenic
1183603039 22:38851061-38851083 AAGGGACTACACATGAAGCCAGG + Intergenic
1183607600 22:38875095-38875117 ATTGGCCTACAAGTGAAGAATGG + Intergenic
1184306487 22:43606416-43606438 CTGGGTGAACAAATGAAGAAAGG + Intronic
949952107 3:9237908-9237930 ATGGGACAAGAAAAGAAGCAGGG + Intronic
950956221 3:17056046-17056068 ATGGGTTTACGAAGGAAGGAGGG - Intronic
952474366 3:33691303-33691325 ATGTGTCTATAAATAAACCAGGG - Intronic
952651046 3:35727078-35727100 ATGGGGCTACGAATAAGGCATGG - Intronic
953879510 3:46684293-46684315 AGTGGTCTACAAATGAAGCTGGG + Intronic
957913098 3:86648433-86648455 ATGGGTCTACAAATAGTTCAGGG - Intergenic
959470195 3:106740749-106740771 AAGGGTCTACAAATAAACCATGG + Intergenic
963382356 3:144547653-144547675 ATGGGTCTACAAATAAAGATAGG - Intergenic
967278238 3:187797493-187797515 ATGGGTCTTCAACATAAGCACGG - Intergenic
967778396 3:193408356-193408378 ATGGGACTACATATAAAGCATGG + Intronic
968091584 3:195901377-195901399 CTGTGTCTGCCAATGAAGCAGGG - Intronic
972074298 4:35065335-35065357 ATCGCTCACCAAATGAAGCATGG + Intergenic
974338655 4:60585608-60585630 ATGACTCAACAAAAGAAGCAGGG + Intergenic
975977411 4:80115381-80115403 ATGTGTCTACAACTTAGGCAAGG + Intronic
976241766 4:82965519-82965541 ATAGGTCTGCAGGTGAAGCAGGG + Intronic
976275155 4:83268770-83268792 ATGATACTACAAATGTAGCAGGG + Intronic
978395797 4:108278500-108278522 AAGAATCTACAAGTGAAGCAGGG - Intergenic
983242587 4:165250253-165250275 GTGTGGCTACGAATGAAGCATGG - Intronic
983391633 4:167139129-167139151 ATGGGCTTACAGATGAAACATGG - Intronic
984213904 4:176884089-176884111 ATGTGTCTACATTTGAAGAATGG + Intergenic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
993460449 5:88175435-88175457 ATTAGTCAACAAATGAACCAGGG - Intergenic
993508304 5:88738674-88738696 ATGGGGATACAAATGAAGAGAGG + Intronic
995264996 5:110149210-110149232 ATGGGAATACAAAACAAGCAGGG - Intergenic
996827563 5:127702772-127702794 CTGGGTCTACAAATGCATCCAGG + Intergenic
997074754 5:130659740-130659762 ATGAGTCTACGAATGTATCAAGG - Intergenic
998177469 5:139910863-139910885 GAGGGTCTGAAAATGAAGCAGGG - Intronic
1000860597 5:166451707-166451729 ATGGATCTTTAAATAAAGCAAGG - Intergenic
1004969741 6:20896643-20896665 ATGAGTTTACAAATCAAACATGG - Intronic
1005925952 6:30445875-30445897 ATGGATTTACAAATGTAGGAAGG - Intergenic
1007948287 6:45845789-45845811 ACGAGACTACATATGAAGCAGGG + Intergenic
1010706636 6:79120886-79120908 ATGGGTCAAAAAATAAATCACGG + Intergenic
1014290133 6:119548503-119548525 ATGGGTCTTGACATGAAACAAGG - Intergenic
1016273416 6:142318686-142318708 ATGGATCTAGAAATGGAGAAGGG + Intronic
1018346872 6:162908823-162908845 ATGGATCTCCACAGGAAGCATGG + Intronic
1020768745 7:12359610-12359632 TTGGGTCTACAAATCAAACAAGG + Exonic
1023585206 7:41722694-41722716 ATGAGTTTAAAAATGAAGCCTGG - Intergenic
1024233312 7:47379095-47379117 ATGGGGTTAACAATGAAGCAAGG + Intronic
1025771262 7:64509682-64509704 GTGGGTCTAGAAATCCAGCAGGG + Intergenic
1027813077 7:82930827-82930849 ATGGGTCTAGAAAGGTAGGAAGG + Intronic
1028520691 7:91727154-91727176 ATGGGTATACAAATGATAGAAGG + Intronic
1034380318 7:150686616-150686638 ATGAGTAGACAAATGAAACATGG + Intronic
1034500432 7:151447339-151447361 ATGGCCCTTCAAGTGAAGCAGGG + Intergenic
1035771170 8:2148099-2148121 ATGGGTCTAGGACTGGAGCAGGG - Intronic
1036083663 8:5588855-5588877 GTTGGTCAAGAAATGAAGCAAGG - Intergenic
1039316896 8:36383601-36383623 ATGTCTCTACATAGGAAGCATGG + Intergenic
1041452906 8:58026100-58026122 ATGGGTCAACCCATGTAGCAGGG - Intronic
1042364057 8:67916372-67916394 ATGAGTCTACAACAGATGCAGGG - Intergenic
1042459143 8:69042118-69042140 ATTGGTCTACAAATGAAGGTAGG - Intergenic
1047852221 8:128869537-128869559 ATGGATCAAGAAATAAAGCAAGG - Intergenic
1048494632 8:134925029-134925051 ATGGGTGTACAAAAGAAGAAAGG - Intergenic
1050744755 9:8862437-8862459 ATGGGTCAAAAAATTTAGCATGG - Intronic
1054717791 9:68574285-68574307 ATGGGAAAACAAATGAACCAAGG + Intergenic
1056883941 9:90421702-90421724 ATGGGTCTCAAAGTGCAGCAGGG + Intergenic
1186855157 X:13619333-13619355 GGGGGTTTACGAATGAAGCAGGG - Intronic
1189144312 X:38640069-38640091 ATGGGTTTTGAAATGGAGCAAGG + Intronic
1193395244 X:80976491-80976513 ATGCTTCAACAAATGAAGCTGGG - Intergenic
1197816933 X:130507307-130507329 ATGGGGCAACAAAAGAAGGATGG - Intergenic
1197849058 X:130837562-130837584 ATGGGTGTTCTTATGAAGCAAGG - Intronic
1198698212 X:139366666-139366688 ATGGTTATAAAAATTAAGCAAGG + Intergenic
1198915745 X:141669649-141669671 AGGACTCTTCAAATGAAGCAAGG - Intronic