ID: 936652902

View in Genome Browser
Species Human (GRCh38)
Location 2:114450034-114450056
Sequence CCATTTTGGTAGCACAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936652902_936652909 13 Left 936652902 2:114450034-114450056 CCAGTGCTGTGCTACCAAAATGG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 936652909 2:114450070-114450092 AGCTGCATTGATGGTACATATGG 0: 1
1: 0
2: 1
3: 7
4: 106
936652902_936652911 27 Left 936652902 2:114450034-114450056 CCAGTGCTGTGCTACCAAAATGG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 936652911 2:114450084-114450106 TACATATGGTTGCATTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 111
936652902_936652910 24 Left 936652902 2:114450034-114450056 CCAGTGCTGTGCTACCAAAATGG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 936652910 2:114450081-114450103 TGGTACATATGGTTGCATTGAGG 0: 1
1: 0
2: 2
3: 17
4: 141
936652902_936652907 4 Left 936652902 2:114450034-114450056 CCAGTGCTGTGCTACCAAAATGG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 936652907 2:114450061-114450083 TACCTGGGTAGCTGCATTGATGG 0: 1
1: 0
2: 0
3: 7
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936652902 Original CRISPR CCATTTTGGTAGCACAGCAC TGG (reversed) Intronic
902858059 1:19223627-19223649 CCAGGTTGGTCTCACAGCACAGG - Intronic
902966905 1:20011838-20011860 CCATCTTGGTAGCAGAGACCAGG - Intergenic
903144108 1:21358855-21358877 CCATGTTTGTACCACTGCACTGG + Intergenic
904478307 1:30778298-30778320 CCATTCTGGTTCCAGAGCACAGG - Intergenic
906476545 1:46173086-46173108 CCATGTTGGGAGCACAGCCTAGG + Intronic
911689058 1:100810528-100810550 CCATTGTGCTAGCACAGGAGTGG + Intergenic
912101704 1:106215681-106215703 CGATTTTGGTATCAGAGCAACGG - Intergenic
913617035 1:120571373-120571395 CCATTTTGGTTGGAAAGCATTGG - Intergenic
914573241 1:148939542-148939564 CCATTTTGGTTGGAAAGCATTGG + Intronic
917601892 1:176583683-176583705 ACATTTTGGTAGGACAAGACAGG - Intronic
924818300 1:247462428-247462450 CCATTCTGGTAGCTCTGCATGGG - Intergenic
1063534242 10:6867248-6867270 CAATTTCGGTAGCAGAGGACAGG + Intergenic
1065772170 10:29087636-29087658 CCATTTTGGAAGCAGGGAACAGG + Intergenic
1067838554 10:49657199-49657221 CCATCTTGGAAGCACAGAGCAGG - Intronic
1068423421 10:56823935-56823957 CCACCTTGGCAGCAGAGCACAGG + Intergenic
1072240462 10:93490735-93490757 CCATTTTGTTAGGGCAGTACAGG - Intergenic
1073068960 10:100781467-100781489 CAATTTTAGTAGCAAAGCCCAGG + Intronic
1074092742 10:110277552-110277574 GCATTTGGGTAGTACAGCAGGGG + Intronic
1076322491 10:129593735-129593757 CCTCTTTGGAAGCACAGCCCTGG - Intronic
1077089608 11:772465-772487 CCTCGTTGGTGGCACAGCACAGG + Exonic
1078007802 11:7545718-7545740 CCAGTTTGCTAGCACAGAAAAGG + Intronic
1080352834 11:31404973-31404995 CCTTTTTGGTAGTACAGAATTGG + Intronic
1082902250 11:58267582-58267604 CCATCTGGGTGGCACAGCCCAGG + Exonic
1085438377 11:76532520-76532542 CCATTTAGGAAGAAAAGCACAGG - Intronic
1086078989 11:82882985-82883007 CCATATTGGTAGTACAATACTGG + Intronic
1089773938 11:120823055-120823077 CCATTTTGGCAGGACTGAACTGG + Intronic
1090253860 11:125269474-125269496 CCATTTTGTAATCATAGCACAGG + Intronic
1090458948 11:126872723-126872745 CCATTCTGGCAGCACAGAGCAGG - Intronic
1091339474 11:134799247-134799269 GCATTCTGGGAGGACAGCACAGG + Intergenic
1094744240 12:33326261-33326283 CCATTTTGGTAGGAGTGCAGTGG - Intergenic
1098041057 12:66354376-66354398 CCATATTGTAAGCACAGCATGGG + Intronic
1099666056 12:85630892-85630914 CCAATTTGCTAGCACACCACTGG - Intergenic
1100004761 12:89881454-89881476 CCATTTTGGAAGCAGAGACCAGG + Intergenic
1103558229 12:121778703-121778725 CCACTGTGGTAGGACAGGACTGG - Exonic
1109199880 13:59418541-59418563 ACAGTCTGATAGCACAGCACTGG - Intergenic
1110215889 13:73024398-73024420 CCATTTTGGTAGCTCTACGCTGG - Intergenic
1113291969 13:108917225-108917247 CCATCTTGGTGGCTCAGCCCAGG + Intronic
1116923022 14:50601413-50601435 ACATTTTGCCAGCACACCACTGG - Intronic
1118380267 14:65212337-65212359 CCATCTTGGCAGCACAGAATGGG + Intergenic
1120672278 14:87376358-87376380 CCATTTTAGTAGCACTCAACTGG - Intergenic
1128792452 15:70443096-70443118 ACATTTTCATTGCACAGCACAGG + Intergenic
1129915219 15:79264095-79264117 CCTTCTTGGCAGGACAGCACAGG - Intergenic
1133532975 16:6672993-6673015 CCATATTGTTAGCATTGCACTGG - Intronic
1133931652 16:10237647-10237669 CCATTTGGACAGCACAGCCCTGG - Intergenic
1134050783 16:11135778-11135800 CCATGCCGGCAGCACAGCACAGG + Intronic
1139028694 16:62852408-62852430 CCAGTTTATTAGCACACCACTGG - Intergenic
1140204828 16:72925181-72925203 CGATTTCGATAGCACAGCAATGG - Intronic
1140784006 16:78322777-78322799 CCACTTTGTCACCACAGCACAGG + Intronic
1147233471 17:39037779-39037801 CCTTATTGGAAGCACAACACAGG + Intergenic
1148972237 17:51493649-51493671 CCATTGTTGAAGCACAGAACAGG - Intergenic
1151081913 17:71339217-71339239 ACACTTTGGTAGCCCAACACAGG - Intergenic
1156708498 18:39912929-39912951 ACATTTTGGGAGGACAGCAGTGG + Intergenic
1158297891 18:56019311-56019333 CCATTTTGGCAGAACAACTCTGG + Intergenic
1159380833 18:67656672-67656694 TCATTTTTGTAGCACAGCCCAGG + Intergenic
1159636243 18:70808662-70808684 CAATCTTCATAGCACAGCACAGG + Intergenic
1160669270 19:349284-349306 CCATTTTGGGAGCAGAGACCAGG - Intergenic
1162797883 19:13095971-13095993 ACAATTTGGTAACACACCACAGG + Exonic
1163271436 19:16256592-16256614 CCCTTTTAGTATCAGAGCACAGG + Intergenic
1167078762 19:47265040-47265062 CCTTTTTTGTGCCACAGCACAGG + Intronic
929872252 2:45769022-45769044 CCATTTTGGCAGCAGAGCTGTGG + Intronic
933420236 2:82036121-82036143 CCAGTTTGGGACCTCAGCACTGG + Intergenic
935715731 2:105937487-105937509 CCCATCTGGTAGCACAGCACAGG - Intergenic
935920813 2:108011510-108011532 CCATCTTTGTAGAAGAGCACTGG + Exonic
936652902 2:114450034-114450056 CCATTTTGGTAGCACAGCACTGG - Intronic
936830902 2:116645132-116645154 CCTTTTTCTTAGCACAGCAATGG + Intergenic
938713842 2:134000669-134000691 GCACTTTGGGAGGACAGCACAGG + Intergenic
943427692 2:187757356-187757378 CAATTTTTGTAGGACAGAACAGG + Intergenic
944202456 2:197122046-197122068 GCATTTTAGTAGCAGAGCAGTGG + Intronic
945956726 2:216093256-216093278 CCACTTTGGTAGAAGAGCCCTGG + Intronic
1169088727 20:2843834-2843856 CCTTTCTGGCAGTACAGCACAGG - Intronic
1169736802 20:8846396-8846418 GGGTTTTGGTAGCACAACACTGG + Intronic
1173428124 20:42960316-42960338 CCATCTTGGAAGCAGAGAACAGG - Intronic
1175914155 20:62418033-62418055 CCACTTTAGTGCCACAGCACAGG + Intronic
1179570571 21:42276216-42276238 CCCGTTTGCTAACACAGCACTGG - Intronic
1180913883 22:19471979-19472001 GCAACTTGGTAACACAGCACTGG + Intronic
1182741815 22:32573143-32573165 CCAGTTTGCCAGCACACCACTGG + Intronic
1182868661 22:33627083-33627105 CCATTTGGGAAGCCCAGCTCTGG - Intronic
1184767742 22:46580385-46580407 GCCTTTTGGTGGCACAGCAATGG + Intronic
949249884 3:1971437-1971459 CACTTTTCGTAGCACAGCACTGG - Intergenic
949408684 3:3741092-3741114 CCTTGTGGGGAGCACAGCACTGG - Intronic
951680898 3:25293776-25293798 TCATTTTGGTGGCAGAGAACAGG - Intronic
951703671 3:25522701-25522723 TCATTCTGGAAGCACAGCCCCGG + Intronic
953772130 3:45785841-45785863 CCATGTTGGTACCAGAGCCCAGG + Intronic
954314021 3:49791447-49791469 GCATTTTGATGGCAGAGCACAGG - Exonic
958002679 3:87771585-87771607 CCATCTTGGAAGCAGAGCACAGG - Intergenic
965250919 3:166342909-166342931 CCATGATGTTAGCACAGCAGTGG - Intergenic
965561080 3:170062907-170062929 CCTTTGTGGTAGAAAAGCACCGG + Intronic
968218460 3:196914969-196914991 CCATTGTGATATGACAGCACTGG - Intronic
969680584 4:8641229-8641251 CCATGTTGGTAAAACACCACGGG - Intergenic
970363105 4:15329911-15329933 CCATGTTCGTACCACTGCACGGG + Intergenic
970568921 4:17360413-17360435 CCATATTGGAAGCACAGAGCAGG - Intergenic
971110314 4:23577811-23577833 TCATTTCATTAGCACAGCACAGG - Intergenic
971424944 4:26506911-26506933 CCAAATTGTTAGCACAGCAGGGG + Intergenic
977113182 4:92986541-92986563 CTACTTTGGTAGCACACCACTGG + Intronic
980220119 4:129902868-129902890 CCAGTTTGGGAGCACAGCAATGG + Intergenic
981407467 4:144387689-144387711 CCATTTTGGAAGCAGAGACCAGG - Intergenic
981709544 4:147695566-147695588 CCATCTTGGTAGCAGAGCCTGGG - Intergenic
984844344 4:184097331-184097353 CCGTTTTGGATGAACAGCACCGG - Exonic
985713450 5:1442917-1442939 CCATTTTTGTAGCACAGGTAGGG + Exonic
988673305 5:33405503-33405525 CCATCTTGGAAGCAGAGAACAGG + Intergenic
992456766 5:76923500-76923522 CCATTGGGGTGGCATAGCACTGG - Intergenic
992600532 5:78394467-78394489 CCATTTTGGGAGGACAACACAGG - Intronic
997580230 5:135012391-135012413 CCAGCAGGGTAGCACAGCACAGG + Intergenic
998197317 5:140085570-140085592 CCATTTTGCTTGAACAGGACTGG - Intergenic
1000650558 5:163813188-163813210 CCATTTTGGAGGCACATCAAAGG - Intergenic
1002912045 6:1497966-1497988 AGAATTTGGTAGCACAACACAGG - Intergenic
1007954027 6:45900288-45900310 GCATTTTGGTGGCACAGAAAGGG - Exonic
1008290153 6:49705348-49705370 CCATTGAGGGAGCACAGCAGGGG - Intronic
1011182630 6:84637975-84637997 CCATTATGGTAGCACATCGTAGG + Intergenic
1012658930 6:101861466-101861488 TCATTTAGGTAGGAAAGCACTGG - Intronic
1020505453 7:8981217-8981239 CCATGTGGGTAGGACTGCACAGG + Intergenic
1021387114 7:20044919-20044941 CCATTTTGGTAGCATATAAAAGG + Intergenic
1021539634 7:21742942-21742964 CCATTTTGGAAGCAGAGACCAGG - Intronic
1024054922 7:45653836-45653858 CCATTTTGGTAGGCCAGAACTGG - Intronic
1024130910 7:46352530-46352552 TCACTTTGGTAGAACAACACTGG + Intergenic
1024537207 7:50447113-50447135 ACAGTTTGGTAGCACAGACCTGG + Exonic
1026497237 7:70913829-70913851 GCATTTTGGAAGGCCAGCACAGG - Intergenic
1030157990 7:106476375-106476397 CCATATTGGGAGTTCAGCACTGG - Intergenic
1031960890 7:127988824-127988846 CCATTTGGGCAGGACAGGACTGG - Intronic
1033686783 7:143647423-143647445 CCATCTTGGGAGCACAGAGCAGG + Intronic
1033688951 7:143719884-143719906 CCATCTTGGGAGCACAGAGCAGG - Exonic
1033697826 7:143810191-143810213 CCATCTTGGGAGCACAGAGCAGG - Intergenic
1040820640 8:51552952-51552974 GCATTTTGGAAGCACATAACTGG - Intronic
1042218205 8:66448496-66448518 CCAGTTTACTAGCACACCACTGG - Intronic
1044547765 8:93478482-93478504 TCATGTTGGGATCACAGCACCGG - Intergenic
1047691054 8:127355077-127355099 CCAGTTTGGCAGAACAGAACAGG - Intergenic
1048507650 8:135035315-135035337 CCATTTTGGTAGAAGAGAAAAGG + Intergenic
1048838401 8:138543561-138543583 CCATCTTGGGAGCTGAGCACTGG - Intergenic
1049665926 8:143842569-143842591 CCATATTGTTAGCACAGACCAGG - Intergenic
1049698131 8:143993625-143993647 CCATTGGGGTACCCCAGCACAGG - Intronic
1050067443 9:1775103-1775125 TCATTTTGGAAGCACAGTAATGG - Intergenic
1054882621 9:70160809-70160831 GTATTTTGGTAACTCAGCACAGG - Intronic
1055818190 9:80231914-80231936 CCATTTTGTCTGCACAGCAAGGG + Intergenic
1056638363 9:88349662-88349684 CCATTTTCAAAGCACAGGACAGG + Intergenic
1056780122 9:89542989-89543011 CCATTTTGGTTGCTGAGGACAGG - Intergenic
1061150108 9:128823530-128823552 CCAGTCTGGGAGCACAGGACGGG + Intronic
1062046648 9:134427511-134427533 TCATTTTGGTTGCACAGCCTGGG + Intronic
1186654948 X:11602467-11602489 CCATGATAGTAGCACTGCACAGG - Intronic
1187642896 X:21314176-21314198 CCATGTTGGGAGCTCAGCATTGG - Intergenic
1187820755 X:23285400-23285422 CCATTCTGGAGACACAGCACTGG - Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1198841123 X:140859148-140859170 TCATATTGCTATCACAGCACTGG - Intergenic