ID: 936653615

View in Genome Browser
Species Human (GRCh38)
Location 2:114458156-114458178
Sequence CAGAATAGCACAGGATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 7, 3: 173, 4: 425}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936653615_936653617 -5 Left 936653615 2:114458156-114458178 CCAGGCTATCCTGTGCTATTCTG 0: 1
1: 0
2: 7
3: 173
4: 425
Right 936653617 2:114458174-114458196 TTCTGCCAGAGTTTCTTTCCTGG 0: 1
1: 0
2: 2
3: 13
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936653615 Original CRISPR CAGAATAGCACAGGATAGCC TGG (reversed) Intronic
900449086 1:2696603-2696625 CAGACGAGCATAGGACAGCCTGG + Intronic
900452553 1:2757554-2757576 CAGACGAGCATAGGACAGCCTGG + Intronic
900872035 1:5311160-5311182 CAGAATGGGCCAGGATAGGCGGG - Intergenic
904427468 1:30438243-30438265 GAGAATAGCACAGGAAAGACTGG - Intergenic
904571902 1:31472627-31472649 GAGAACAGCACAGGAAAGACCGG + Intergenic
904572223 1:31474847-31474869 GAGAATAGCACGGGAAAGACTGG + Intergenic
905959028 1:42027853-42027875 GAGAATAGCACAGGAAAGACTGG + Intronic
906020926 1:42628595-42628617 GAGAATAGCACAGGAAAGACTGG - Intronic
906852822 1:49270215-49270237 CAGAATAGCACAGAAAAACAAGG - Intronic
906891559 1:49721448-49721470 CACAATAAGACAGGATGGCCAGG + Intronic
907453164 1:54560191-54560213 CAGCACAGCACAGCACAGCCAGG + Intronic
907624991 1:56021463-56021485 GAGAATAGCACAGGAAAGACTGG + Intergenic
908029204 1:59982030-59982052 CAGAACAACACAGAACAGCCAGG - Intergenic
909274265 1:73665152-73665174 GAGAATAGCACAGGAAAGACTGG - Intergenic
910022584 1:82610358-82610380 GAGAATAGCACGGGAAAGACCGG - Intergenic
910684236 1:89900075-89900097 CAGAAATGCACAGGATACTCTGG + Intronic
911258701 1:95662019-95662041 GAGAATAGCACGGGAAAGACCGG - Intergenic
911612044 1:99968563-99968585 GAGAATAGCACAGGAAAGACTGG + Intergenic
913032117 1:114918450-114918472 CAGAATAGCCCAAGATATTCTGG - Intronic
913059983 1:115195820-115195842 CAGAAGAGCATATGATAGCCAGG + Intergenic
913081715 1:115394661-115394683 GAGAATAGCACGGGAAAGACCGG + Intergenic
913435677 1:118845131-118845153 CAGAAAAGCACAGGAAAAGCTGG + Intergenic
913489330 1:119364312-119364334 GAGAATAGCACAGGAAAGACTGG + Intergenic
913559208 1:120000992-120001014 GAGAATAGCACAGGAAAGACTGG - Intronic
913638657 1:120789550-120789572 GAGAATAGCACAGGAAAGACTGG + Intergenic
914253219 1:145939189-145939211 TAAAATAGCACAGTACAGCCTGG - Intronic
914279802 1:146160435-146160457 GAGAATAGCACAGGAAAGACTGG - Intronic
914540840 1:148611353-148611375 GAGAATAGCACAGGAAAGACTGG - Intronic
914625800 1:149459893-149459915 GAGAATAGCACAGGAAAGACTGG + Intergenic
915996794 1:160571880-160571902 CAGAACAGCACAAGATACACAGG + Intronic
916849418 1:168687997-168688019 CAGGAGAGCACAGAATATCCTGG + Intergenic
916861393 1:168809535-168809557 GAGAATATGACAGGATACCCAGG - Intergenic
917505839 1:175625995-175626017 GAGAATAGCACAGGAAAGACAGG - Intronic
918049057 1:180958749-180958771 AAGAATAGCACTGGAAAGACTGG + Intergenic
918674475 1:187265509-187265531 CAGAATATTACAGTAGAGCCTGG + Intergenic
919900049 1:202037503-202037525 GAAAATAGCACAGGAAAGACGGG - Intergenic
920046161 1:203133889-203133911 AAGAAAAGCCCAGGCTAGCCAGG - Intronic
920357282 1:205383388-205383410 CAGAATAGCACATGTTGGCTGGG - Intronic
920835513 1:209507339-209507361 GAGGATAGCACAGGCTATCCTGG - Intergenic
921059132 1:211567768-211567790 CACTATAGCACAAGGTAGCCAGG - Intergenic
921445258 1:215238925-215238947 CAAGATAGAACAGGATAACCTGG + Intergenic
921756044 1:218856754-218856776 CAGAATACCACAGAATAACAGGG - Intergenic
922152484 1:223017837-223017859 GAGAATAGCACGGGAAAGACCGG + Intergenic
922655072 1:227374910-227374932 CACAAAACCACAGGAAAGCCTGG - Intergenic
923851077 1:237795764-237795786 AAGAATAGCACATAATGGCCGGG + Intronic
924430316 1:243990850-243990872 GAGAATAGCACAGGAAAGACTGG + Intergenic
924785836 1:247198499-247198521 GAGAATAGCACGGGAAAGACTGG - Intergenic
1063545039 10:6972582-6972604 CAGAAAAGCACAGTAATGCCTGG - Intergenic
1063910024 10:10820021-10820043 AAGAATAGCACAGGAAAGACAGG - Intergenic
1064119038 10:12603545-12603567 TCGAATAGCACAGGATGGACTGG - Intronic
1064133751 10:12732625-12732647 GAGAATAGCACAGGAAAGATGGG + Intronic
1064336891 10:14451585-14451607 GAGAATAGCACAGGAAAGGCCGG - Intronic
1065225936 10:23544106-23544128 AAGAATAGCACAGGAAAGCCTGG - Intergenic
1066473082 10:35718312-35718334 GAGAATAGCACAGGAAAGACAGG + Intergenic
1068552810 10:58425648-58425670 TAGAATAGCACGGGAAAGACTGG + Intergenic
1068673017 10:59743023-59743045 CAGAAAAGCACATGAAGGCCAGG - Intergenic
1069175610 10:65285596-65285618 GAGAATTGCACAGGAAAGACCGG + Intergenic
1069374820 10:67783152-67783174 CAGAATAACACAGGAGAGGAGGG - Intergenic
1069803999 10:71106274-71106296 AAGAATAGCACAGGAAAGGCTGG - Intergenic
1071443012 10:85719604-85719626 GAGAATAGCACAGGAAAGACAGG + Intronic
1072487880 10:95873919-95873941 GAGAATAGCACAGAAAAGACTGG + Exonic
1073787522 10:106906591-106906613 CAGAATAGCACAGGAAAGACTGG + Intronic
1074041260 10:109792481-109792503 AAGAATAGCACAGGAAAGACTGG + Intergenic
1074178473 10:111034286-111034308 GAGAATAGCACGGGAAAGACTGG + Intergenic
1074338866 10:112606318-112606340 CAGAATAGCACGCAATGGCCGGG - Intronic
1074619744 10:115106607-115106629 GAGAATAGCACGGGAAAGACTGG - Intronic
1074836652 10:117302744-117302766 GAGAATAGCACAGGAAAGACTGG - Intronic
1075349618 10:121712033-121712055 AAAAATAGCACAGGATTGTCGGG - Intergenic
1075509134 10:123055353-123055375 GAGAATAGCACAGGAAAGACTGG + Exonic
1075509267 10:123056401-123056423 GAGAATAGCACAGGAAAGACTGG + Exonic
1076022176 10:127082884-127082906 CAGCAAAGCACAGCATGGCCAGG - Intronic
1076464966 10:130672983-130673005 GAGAATAGCACAGGAAAGACTGG + Intergenic
1077547352 11:3180304-3180326 GAGAATAGCACCGGAAAGACCGG + Intergenic
1078408156 11:11089242-11089264 GAGAATAGCACAGGAAAGACTGG - Intergenic
1080153502 11:29079563-29079585 AAGAATAGCACAGGAAAGACAGG - Intergenic
1080882846 11:36338921-36338943 GAGAATAGCACGGGAAAGACGGG - Intronic
1081077884 11:38697968-38697990 GAGAATAGCACAGGAAAGACTGG + Intergenic
1081437419 11:43042062-43042084 GAGAATAGCACAGGAAAGACTGG + Intergenic
1082766039 11:57168870-57168892 GAGAATAGCACGGGAAAGACCGG + Intergenic
1083262671 11:61531595-61531617 AAGAAAACCACAGGATAGACCGG + Intronic
1083489821 11:63008076-63008098 CAGCATAGCCCAGCATAGGCTGG + Intronic
1083955297 11:65979461-65979483 CAGGGTGGCACAGGACAGCCAGG - Exonic
1084589938 11:70084721-70084743 CAGATAAGCACAGGCTAGTCGGG - Intronic
1085194185 11:74658266-74658288 AAAAATAGCACAGGAAAGACTGG + Intronic
1085194472 11:74660196-74660218 GAGAATAGCACAGGAAAGACTGG + Intronic
1085754895 11:79194044-79194066 GAAAATAGCACAGGAAAGACCGG - Intronic
1086121288 11:83306844-83306866 GAGCATAGAACAGGATAGGCAGG - Intergenic
1086192708 11:84098332-84098354 ATGAAGAGCACAGGATGGCCTGG - Intronic
1086231573 11:84577001-84577023 CAGAATAGCATGGGAAAGACTGG - Intronic
1086595448 11:88565511-88565533 CAGAATCTCCCAGGAAAGCCTGG - Intronic
1086721708 11:90128991-90129013 CAGAATAGCATGGGAAAGACTGG + Intergenic
1086840482 11:91677462-91677484 GAGAATAACACAGGAAAGACTGG - Intergenic
1087287468 11:96280679-96280701 CAGACTACCACACAATAGCCAGG + Intronic
1087997086 11:104822469-104822491 AAGAATAGCACAGAAGAGGCTGG - Intergenic
1089043475 11:115477075-115477097 CAGGATAGCATAGGGTAGACAGG + Intronic
1089178564 11:116565378-116565400 CAGAGTTGCACAGGATGGACTGG - Intergenic
1089343120 11:117773067-117773089 CAGGATAGCCAGGGATAGCCGGG + Intronic
1089988302 11:122834295-122834317 GAGTATACCACAGGATAGCAAGG - Intergenic
1091065830 11:132510542-132510564 AATAATAGCACAGGAAAGACTGG - Intronic
1091269659 11:134298576-134298598 GAGAATAGCACGGGAAAGACTGG - Intronic
1091617130 12:2058024-2058046 CAGAAAAGCTCAGGAGACCCAGG + Intronic
1091878643 12:3958711-3958733 GAGAATAGCACAGGAAAGACCGG + Intergenic
1092184240 12:6466935-6466957 CAGAATAGCACCGGAAAGATGGG - Intronic
1092326421 12:7535579-7535601 AAGAATAGCACAGGAAAGACTGG - Intergenic
1093014172 12:14139540-14139562 AGGGATAGCATAGGATAGCCTGG + Intergenic
1093124947 12:15316781-15316803 CAAAATAGCACAGAAAAGGCTGG + Intronic
1093225155 12:16474021-16474043 CAGTATAGCATAGAATACCCTGG - Intronic
1094544844 12:31394906-31394928 GAAAAGAGCACAGGATAGGCCGG - Intronic
1095039573 12:37426373-37426395 GAGAATAGCACAGGAAAGACTGG - Intergenic
1097570673 12:61327210-61327232 GAGAATAGCACAGGAAAGACTGG + Intergenic
1097999246 12:65922818-65922840 GAGAATAGCACAGGAAAGACCGG - Intronic
1098832635 12:75381144-75381166 GAGAATAGCACAGGAAAGACTGG - Intronic
1099490632 12:83283964-83283986 AAGAATAGTACAGGAAAGACTGG - Intergenic
1099779947 12:87182051-87182073 GAGAATAGCACGGGAAAGACTGG - Intergenic
1100678315 12:96892387-96892409 GAGAATAGCACGGGAAAGACCGG - Intergenic
1100714173 12:97288744-97288766 GAGAATAGCACGGGAAAGACCGG + Intergenic
1101231146 12:102742766-102742788 GAGAATAGCACGGGAAAGACCGG - Intergenic
1101869126 12:108547938-108547960 CAGCATGGCCCAGGATGGCCTGG - Exonic
1102133068 12:110548721-110548743 CAGGGTAGCAAAGGATAGCCTGG - Intronic
1102211912 12:111133518-111133540 GAGAACAGCACAGGAAAGACTGG + Intronic
1102758900 12:115367881-115367903 GAGAGTAGCACAGGAAAGACTGG - Intergenic
1103009437 12:117446967-117446989 GAGAACAGCACAGGAAAGGCTGG - Intronic
1103222418 12:119256864-119256886 AAGAACAGCACAGGAAAGACAGG - Intergenic
1103678199 12:122673171-122673193 CAAAATGGAACAGGATAGACTGG - Intergenic
1104364235 12:128162550-128162572 GAGAATAGCACAGGAAAGACTGG - Intergenic
1104399368 12:128463104-128463126 CAGAAAAGCAAAAGCTAGCCTGG + Intronic
1104493224 12:129212805-129212827 TAGAATAGCAGAGAATAGGCTGG + Intronic
1104571085 12:129926662-129926684 CAGATTTGCACAGGACGGCCTGG - Intergenic
1104742623 12:131189543-131189565 GAGAATAGCACAGGAAAGACTGG + Intergenic
1104749121 12:131227365-131227387 GAGAATAGCACAGGAAAGACTGG - Intergenic
1105993301 13:25645287-25645309 CAGAATAGCACAGGAAAGACTGG + Intronic
1106116927 13:26825805-26825827 GAGAACAGCACAGGAAAGACTGG + Intergenic
1106975306 13:35204485-35204507 GAGAATAACACAGGAAAGACCGG + Intronic
1107885582 13:44872091-44872113 CTGAAGAGCACAGGGAAGCCTGG + Intergenic
1108933836 13:55863400-55863422 AAGAATAGCACAGGAAAGACTGG - Intergenic
1109221858 13:59647755-59647777 GAGAATAGCACAGGAAAGACTGG - Intergenic
1109286146 13:60409994-60410016 GAGACTAGCACAGGAAAGACTGG - Intronic
1109482586 13:62974945-62974967 AAGAATAGCACAGGAAAGACTGG + Intergenic
1109522380 13:63531026-63531048 GAGAATAGCACAGGAAAGACCGG - Intergenic
1109824029 13:67693480-67693502 GCGAATAGCACAGGAAAGACTGG + Intergenic
1110453129 13:75659596-75659618 AAGAATAGCACGGGAAAGACCGG + Intronic
1110960216 13:81612246-81612268 AAGAACAGCACAGGAAAGACTGG + Intergenic
1111441753 13:88290853-88290875 AAGAATAGCACTGGAAAGACTGG + Intergenic
1111687092 13:91516000-91516022 GAGAATAGCACAGGAAAGACTGG + Intronic
1111687364 13:91517897-91517919 GAGAATAGCACAGGAAAGACTGG + Intronic
1111715875 13:91877897-91877919 GAGAAAAGCACAGGAAAGACCGG - Intronic
1112101733 13:96197330-96197352 GAGAATAGCACAGGAAAGACAGG + Intronic
1112197035 13:97236287-97236309 CAGAAGAGCACAGGCTGTCCTGG + Intronic
1113046684 13:106163661-106163683 CAGAAAGGAACAGGATGGCCTGG + Intergenic
1113222046 13:108116063-108116085 GAGATTAGCAAAGGATAGACAGG + Intergenic
1114217341 14:20666849-20666871 AAGAATAGCACAGGAAAGACTGG + Intergenic
1114723862 14:24912706-24912728 CAGAACAGCACCAGATAGCATGG - Intronic
1115115750 14:29879318-29879340 AAGAATAGCACGGGAGAGACCGG - Intronic
1115929892 14:38478887-38478909 GAGAATAGCACAGGACAGACCGG - Intergenic
1115931705 14:38504094-38504116 AAGAATAGCACGGGAAAGACTGG + Intergenic
1116147804 14:41098559-41098581 GAGAATAGCACAGGAAAGACTGG - Intergenic
1117198363 14:53363423-53363445 GAGAATAGCATAGGAAAGACTGG + Intergenic
1117338905 14:54777456-54777478 CAGAATACCACAGCATGGCCCGG + Intronic
1117434219 14:55700759-55700781 GAGAATAGCACAGGAAAGACCGG - Intronic
1118933299 14:70263152-70263174 GAGAATAGCACAGGAAAGACTGG - Intergenic
1118935785 14:70286880-70286902 CAGAATAGCATGGGAAAGACTGG - Intergenic
1120753729 14:88222208-88222230 GAGAATAGCACAGGAAAGACTGG + Intronic
1120845675 14:89122825-89122847 CAGAGGAGGACAGGAAAGCCAGG + Intergenic
1120895752 14:89530433-89530455 CAGAACAGCACAGGAAAGACTGG + Intronic
1122167371 14:99838094-99838116 TAGAAAAGCACAGTGTAGCCGGG - Intronic
1122229288 14:100297556-100297578 CAGAGCAGCCCAGGACAGCCTGG - Intronic
1123046265 14:105517707-105517729 GAGAATAGCACGGGAAAGACTGG - Intergenic
1123189337 14:106553307-106553329 GAGAATAGCACGGGAAAGACAGG + Intergenic
1202846018 14_GL000009v2_random:176332-176354 CTGAATATCACAGCTTAGCCTGG + Intergenic
1202915477 14_GL000194v1_random:166928-166950 CTGAATATCACAGCTTAGCCTGG + Intergenic
1202877262 14_KI270722v1_random:16117-16139 CTGAATATCACAGCTTAGCCTGG - Intergenic
1123892591 15:24796145-24796167 AAGAATAGCACAGGAAAGACCGG - Intergenic
1124139885 15:27067781-27067803 GAGATTAGTACAGGATAGCTGGG - Intronic
1124794333 15:32762450-32762472 GAGAATAGCACGGGAAAGACCGG + Intergenic
1125304353 15:38292640-38292662 GAGAATAGCACAGGAAAGACCGG + Intronic
1126167306 15:45664577-45664599 CAGAACAGCCCAGAATAGCGTGG + Intronic
1126697816 15:51341029-51341051 CAGAAAAGCCCAGGACTGCCTGG - Intergenic
1126787815 15:52192571-52192593 CAGAATAGCACTGGATCCACAGG + Exonic
1127576118 15:60294417-60294439 AAGAATAGCACTGGAAAGACTGG + Intergenic
1127576412 15:60296346-60296368 GAGAATAGCACTGGAAAGACTGG + Intergenic
1127670336 15:61188522-61188544 CACAACAGCACAGGCTAACCCGG + Intronic
1128230162 15:66029225-66029247 CAGAACACCACAGGGTAGCATGG - Intronic
1128393895 15:67203628-67203650 TCTAATAGCACAGGATAACCTGG + Intronic
1129345025 15:74911997-74912019 CAGAATAGGTCAGGATAAACTGG + Intergenic
1131427918 15:92362081-92362103 CAGAATATTACAGCATGGCCAGG - Intergenic
1132388034 15:101415733-101415755 AAAAATAGCACAGGAAAGACTGG - Intronic
1134911655 16:18032515-18032537 GAGAATAGCACAGGAGAGACTGG + Intergenic
1138055916 16:53833072-53833094 GAGAATAGCACGGGAAAGACCGG - Intronic
1138818601 16:60231356-60231378 CAGAGAAGCACAGGACAGCGAGG + Intergenic
1139091042 16:63648019-63648041 AAGAATAGCACAGGAAAGACCGG + Intergenic
1140587447 16:76309765-76309787 GAGAATAGCACGGGAAAGCCCGG - Intronic
1142056957 16:88004012-88004034 CTGGATAGCACAGGACAGCTGGG - Intronic
1142274271 16:89108104-89108126 GAGAATAGCACAGGAAAGACCGG + Intronic
1142840468 17:2624601-2624623 AACAATAGCACAGGAAAGACTGG + Intronic
1144028849 17:11302065-11302087 GAGAATAGCACAGGAAAGACCGG + Intronic
1144492551 17:15726901-15726923 TAGAATTACAAAGGATAGCCAGG - Intergenic
1144907702 17:18649760-18649782 TAGAATTACAAAGGATAGCCAGG + Intronic
1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG + Intergenic
1145378300 17:22372076-22372098 GAGACTAGCACAGGAAAGACTGG + Intergenic
1149110090 17:53018549-53018571 AGGAATAGCACAGGAAAGACTGG + Intergenic
1149110356 17:53020476-53020498 GAGAATAGCACAGGAAAGACTGG + Intergenic
1152879617 17:82807708-82807730 CTGAATCGCACAGGAGAGGCCGG - Intronic
1153011806 18:546514-546536 GAGAATAGCACAGGAAAGACAGG + Intergenic
1153449580 18:5212151-5212173 GAAAATAGCACAGGAAAGACGGG + Intergenic
1155631994 18:27905365-27905387 GAGAATAGCACGGGAAAGACTGG + Intergenic
1155880407 18:31140918-31140940 GAGAATAGCACAGGAAAGACTGG - Intronic
1156401472 18:36743963-36743985 GAGAATAGCACAGGATGGTTAGG - Intronic
1157665184 18:49480029-49480051 CAAAATATAACAGTATAGCCAGG + Intronic
1159072810 18:63645083-63645105 GAGAATAGCACAAGAAAGACCGG - Intronic
1159074255 18:63662720-63662742 GAGAATAGCACAAGAAAGACCGG - Intronic
1159083572 18:63761650-63761672 GAGAATAGCACAGGAAAGACTGG - Intronic
1159962564 18:74567066-74567088 GAGAATAGCACAGGAAAGACTGG + Intronic
1160284340 18:77526232-77526254 GAGAATAGCACGGGAAAGACTGG - Intergenic
1160601795 18:80019394-80019416 GAGAACAGCACAGGAAAGACTGG + Intronic
1161933836 19:7358637-7358659 CAACACAGCAGAGGATAGCCTGG + Intronic
1164274471 19:23704481-23704503 AAGAATAGCACAGGAAAGACTGG - Intergenic
1164494938 19:28751190-28751212 AAGAATAGCATGGGAAAGCCCGG + Intergenic
1164589422 19:29498195-29498217 CATTATAGCACAGGACAGCTGGG - Intergenic
1165599952 19:37046042-37046064 GAGAATAGCACAGGAAAGACTGG + Intronic
1165974907 19:39667189-39667211 GAGAATAGCACAGGAAAGACTGG + Intergenic
1202673419 1_KI270710v1_random:16825-16847 CTGAATATCACAGCTTAGCCTGG + Intergenic
925443683 2:3909582-3909604 TGGAATAGCACAGGAAAGACTGG + Intergenic
925827035 2:7859470-7859492 TAGAAAAGCAAAGGATAGGCTGG - Intergenic
926245275 2:11118548-11118570 AAGAATAGCACGGGAAAGACTGG + Intergenic
926468116 2:13216208-13216230 GAGAACAGCACAGGAAAGCCTGG + Intergenic
926686614 2:15703243-15703265 TAGAATAGCACAGGAAAGACTGG + Intronic
926830684 2:16958872-16958894 CAGAAAAGCATAGCATAGCTAGG - Intergenic
927402022 2:22722411-22722433 CAGAATAGCACGGCAAAGACTGG + Intergenic
927415846 2:22879658-22879680 AAGCATAGGTCAGGATAGCCCGG + Intergenic
927612768 2:24558529-24558551 GAGAATAGCACAGGAAAGACTGG + Intronic
927640947 2:24844924-24844946 AAGAATAGCACAGAAAAGACCGG - Intronic
927641279 2:24847162-24847184 GAGAATAGCACATGAAAGTCTGG - Intronic
927749354 2:25653236-25653258 GAGAATAGCACGGGAAAGACCGG - Intronic
928465439 2:31518661-31518683 GAGAATAGCACGGGAAAGACTGG - Intergenic
928853701 2:35780252-35780274 GAGAATAGCACAGGAAGGACTGG - Intergenic
929528957 2:42733357-42733379 GAGAATAGCACAGGAAAGACTGG + Intronic
929851198 2:45592023-45592045 AAGAATAGCACAGGAGAGACTGG - Intronic
930006641 2:46903111-46903133 GAGAATAGCACGGGAAAGACTGG - Exonic
930309826 2:49726506-49726528 AAGAATAGCACGGGAAAGACTGG + Intergenic
931734433 2:65181133-65181155 AAGAATAGCACAGGAAAGACCGG - Intergenic
931963187 2:67504215-67504237 AAGAATAGCACAGAAAAGACTGG - Intergenic
932889209 2:75576549-75576571 CAGAATTGCGTAGAATAGCCGGG - Intergenic
932904264 2:75733049-75733071 GAGAATAGAACAGGAAAGACTGG + Intergenic
932976312 2:76603493-76603515 GAGAATAGCACAGGGAAGACTGG + Intergenic
933293900 2:80468709-80468731 AAAAATAGCACATGATGGCCGGG - Intronic
933981699 2:87555964-87555986 GAGAATAACACAGGAAAGACTGG + Intergenic
936312137 2:111394853-111394875 GAGAATAACACAGGAAAGACTGG - Intergenic
936653615 2:114458156-114458178 CAGAATAGCACAGGATAGCCTGG - Intronic
937267529 2:120625916-120625938 CAGAAAAGCAATGCATAGCCAGG - Intergenic
938246005 2:129778553-129778575 CACACTTGCACAGAATAGCCAGG - Intergenic
938560391 2:132467504-132467526 CAGTATCACACAGTATAGCCAGG + Intronic
938646486 2:133336143-133336165 CAGAAAAGCAGAGGAAAGACAGG + Intronic
938850160 2:135251560-135251582 AAGAATAGCGCAGGAAAGACTGG - Intronic
939030411 2:137068052-137068074 CAACATAGCAGAGGAAAGCCAGG - Intronic
939079045 2:137638283-137638305 AAGAATAGCACGGGAAAGACCGG - Intronic
939079324 2:137640179-137640201 AAGAATAGCACGGGAAAGACTGG - Intronic
939287565 2:140153427-140153449 GAGAATAGCATAGGACAGACTGG + Intergenic
940408921 2:153336893-153336915 AAGAATAGCACGGGAAAGTCTGG - Intergenic
941076170 2:161008827-161008849 CAGACTAGCACAGGAAAGACCGG - Intergenic
941477719 2:165968933-165968955 GAGAATAGCACAGGAAACACTGG - Intergenic
941803739 2:169689124-169689146 AAGAATAGCACGGGAAAGACTGG + Intronic
942387954 2:175461633-175461655 GAGAATAGCACTGGAAAGACTGG - Intergenic
943072048 2:183153115-183153137 GAGAATAGCACAGGAAAGACTGG + Intronic
943205169 2:184885785-184885807 AAGAACAGCACAGGAAAGACCGG + Intronic
943205441 2:184887710-184887732 AAGAACAGCACAGGAAAGACTGG + Intronic
943251400 2:185524672-185524694 GAGAAGAGCACAGGAAAGACTGG - Intergenic
943871560 2:193007444-193007466 AAGAATAGCACAGGGAAGGCCGG + Intergenic
943871837 2:193009371-193009393 TAAAATAGCACAGGAAAGACCGG + Intergenic
945433925 2:209796610-209796632 GAGAATAGTACAGGAAAGACTGG - Intronic
945878324 2:215301398-215301420 CACACTAGCAAAGGATAGCATGG - Intergenic
946437032 2:219664068-219664090 GAGAATAGCACGGGAAAGACAGG + Intergenic
946574146 2:221056517-221056539 GAGAATAGCACAGGAAAGACTGG + Intergenic
946699657 2:222399256-222399278 CAGAATAGCTCACGATAACAGGG - Intergenic
946757696 2:222963704-222963726 GAGAATAGCACAGGAAAGACCGG - Intergenic
947149574 2:227101102-227101124 AAGAATAGCACAGGAAAGGCTGG - Intronic
947457876 2:230272444-230272466 GAGAATAGCACAGGAAAAACCGG - Intronic
1169999103 20:11595690-11595712 AAGAATAGCACAGGAAAGACTGG + Intergenic
1170365081 20:15589204-15589226 GAGAATAGCATAGGAAAGACTGG + Intronic
1170395741 20:15923379-15923401 GAGAATAGCACAAGAAAGACCGG + Intronic
1171524978 20:25801931-25801953 GAGAATAGCACAGGGAAGACTGG - Intronic
1171534161 20:25871594-25871616 GAGAATAGCACAGGGAAGACTGG - Intergenic
1171551849 20:26053952-26053974 GAGAATAGCACAGGAAAGACTGG + Intergenic
1171571340 20:26254479-26254501 GAGAATAGCACAGGAAAGACTGG - Intergenic
1171792961 20:29545255-29545277 GAGAATAGTACAGGAAAGACTGG + Intergenic
1172594705 20:36142734-36142756 CAGCACAGCACAGCACAGCCCGG - Intronic
1173023676 20:39288251-39288273 GAGAATAGCACAGGAAAGACTGG - Intergenic
1173263744 20:41459563-41459585 TAGAATAGCACTGGAAAGACTGG - Intronic
1174212145 20:48888249-48888271 GAGAATAGCACGGGAAAGACTGG + Intergenic
1174950893 20:55040620-55040642 AAGAATAGCACAGGAAAGACGGG - Intergenic
1175184010 20:57167594-57167616 CAGGATAGTAGAGGCTAGCCTGG - Intergenic
1175793164 20:61755137-61755159 GAGAATAGCACGGGAAAGACTGG + Intronic
1176634828 21:9181572-9181594 CTGAATATCACAGCTTAGCCTGG + Intergenic
1176638538 21:9273552-9273574 CTGAATATCACAGCTTAGCCTGG - Intergenic
1176649240 21:9530412-9530434 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1176971505 21:15271240-15271262 GAGAATAGCACAGGAAAGACCGG - Intergenic
1177059559 21:16353824-16353846 GAGAATAGCACGGGAAAGACCGG - Intergenic
1177504168 21:21999904-21999926 GAGAATAGCACGGGAAAGACTGG + Intergenic
1177704397 21:24682609-24682631 GAGAATAGCACGGGAAAGACAGG + Intergenic
1178491590 21:33055968-33055990 CAGGACAGCACAGGAGAGGCTGG + Intergenic
1178663886 21:34529858-34529880 GAGAATAGCACAGGAAAGACTGG - Intronic
1179134201 21:38665492-38665514 GAGAATAGCACGGGAAAGACCGG - Intergenic
1180102184 21:45593567-45593589 GAGAATAGCACAGGAAAGACCGG - Intergenic
1180370433 22:12029858-12029880 CTGAATATCACAGCTTAGCCTGG + Intergenic
1180371842 22:12046396-12046418 CTGAATATCACAGCTTAGCCTGG - Intergenic
1180422580 22:12881056-12881078 CTGAATATCACAGCTTAGCCTGG - Intergenic
1180573525 22:16751484-16751506 GAGAATAGCACAGGAAAGACTGG - Intergenic
1182330031 22:29545209-29545231 GAGAATAGCACGGGAAAGACTGG + Intronic
1183481745 22:38069103-38069125 CACCATTGCACAGGATGGCCCGG - Exonic
949363275 3:3254218-3254240 CAGAACAGCACAGGAAAGACTGG + Intergenic
949934534 3:9106588-9106610 GAGAATAGCACGGGAAAGACTGG - Intronic
950175848 3:10873610-10873632 CAGGATAGGATAGGATAGCATGG - Intronic
950175879 3:10873743-10873765 CAGGACAGGACAGGATAGCATGG - Intronic
950696075 3:14702270-14702292 GAGAATAGCACGGGAAAGACCGG + Intronic
950953236 3:17023447-17023469 AAGAATAGCACAGGAAAGACTGG - Intronic
951184683 3:19699476-19699498 CAGAAAGGCAGAGGATAGACTGG - Intergenic
951358812 3:21701381-21701403 GAGAATAGCACGGGAAAGACTGG + Intronic
951802524 3:26611993-26612015 AAGAATAGCACAGGAAAGACTGG - Intergenic
952019185 3:28996661-28996683 CAGAATCACACAGTATACCCAGG + Intergenic
952195584 3:31072477-31072499 GATAATAGCACAGGAAAGACTGG - Intergenic
952585728 3:34889915-34889937 CACAAGGGCTCAGGATAGCCTGG + Intergenic
952715233 3:36473184-36473206 AAGAATAGCACAGGAAAGACCGG + Intronic
952724043 3:36563288-36563310 GAGAATGGAACAGGAAAGCCAGG + Intergenic
953215939 3:40918572-40918594 CAGAAAAGCTAAGGATAACCCGG + Intergenic
954101872 3:48379912-48379934 CAGCATAGCACACTATGGCCTGG - Intronic
954732482 3:52676367-52676389 GAGAATAGCACGGGAAAGACTGG - Intronic
954960620 3:54561722-54561744 CAGAAGAGCAAATGATTGCCTGG + Intronic
955949111 3:64224390-64224412 CAGAATATGACTGCATAGCCTGG - Intronic
956412266 3:68991969-68991991 GAGAATAGCATAGGAAAGACTGG + Intronic
956412544 3:68993899-68993921 AAGAATAACACAGGAAAGACTGG + Intronic
956503401 3:69911078-69911100 GAGAATAGCACGGGAAAGACTGG - Intronic
956910173 3:73808499-73808521 GAGAATAGCATAGGAAAGACTGG - Intergenic
957630379 3:82710396-82710418 GAGAATAGCATAGGAAAGCCTGG + Intergenic
957762040 3:84571859-84571881 GAGAATAGCACAGAAAAGACTGG + Intergenic
957963274 3:87288607-87288629 CAGAATAGCATGGGAAAGACCGG - Intergenic
957988040 3:87596425-87596447 AAGAATAGCACAGGAAACACCGG + Intergenic
959349169 3:105239062-105239084 CAGAATAGTACAGGACTTCCAGG - Intergenic
960465410 3:117991900-117991922 TAGAAAAGCACAGTACAGCCTGG - Intergenic
960496878 3:118384954-118384976 GAGAATAGCACAGGAAAGACTGG - Intergenic
960665445 3:120104402-120104424 CAGAATAGCAAGGGAAAGACTGG - Intergenic
961623464 3:128243102-128243124 CAGACTAGCACTGGAAACCCGGG - Intronic
961783945 3:129338113-129338135 GAGAATAGCACAGGGAAGACTGG - Intergenic
962033747 3:131629167-131629189 GAGAATAGCACGGGAAAGACTGG + Intronic
962644581 3:137423797-137423819 GAGAATAGGACAGGAAAGACCGG - Intergenic
962769812 3:138601825-138601847 GAGAATAGCACAGCAAAGACTGG - Intergenic
963095627 3:141536323-141536345 GAGAATAGCACAGGAAAGACTGG + Intronic
963339904 3:144021230-144021252 AAGAATAGCACAGGAAAGACTGG + Intronic
963394435 3:144714552-144714574 GAGAATAGCACGGGAAAGACTGG + Intergenic
963609107 3:147442571-147442593 GAGAATAGCATAGGAAAGCAAGG - Intronic
964023779 3:152046517-152046539 CAGAATAGTACACTATAGCCTGG - Intergenic
964202561 3:154134492-154134514 GAGAACAGCACAGGAAAGACTGG + Intronic
964461167 3:156930727-156930749 ATGAATAGAACAAGATAGCCTGG + Intronic
964589330 3:158342357-158342379 GAGAATAGCACGGGAAAGACTGG - Intronic
964599509 3:158481304-158481326 CAGAACAGTACAGGGTAACCTGG - Intronic
964654419 3:159051042-159051064 AAGAATAGCACAGGGAAGACTGG - Intronic
965087051 3:164112943-164112965 GAGAATAGCACAGGAAAGACAGG + Intergenic
966299575 3:178462827-178462849 AAGAATAGCACGGGAAAGACTGG - Intronic
966838829 3:184071403-184071425 GAGAATAGCACAGGAAAGACTGG + Intergenic
967449882 3:189612304-189612326 GAGAATAGCACAGGAAAGACTGG - Intergenic
967450163 3:189614228-189614250 GAGAATAGCACAGGAAAGACTGG - Intergenic
1202748357 3_GL000221v1_random:131469-131491 CTGAATATCACAGCTTAGCCTGG + Intergenic
968709924 4:2107023-2107045 TAGAATAGCACAGAAAAGACAGG - Intronic
969658687 4:8513362-8513384 GAGAACAGCACAGGAAAGACTGG + Intergenic
969863455 4:10055759-10055781 TAGAGTAGCACAGGAAAGACTGG - Intergenic
970217911 4:13778890-13778912 GAGAATAGCACAGGAAAAACTGG + Intergenic
970361123 4:15309789-15309811 AAGAATAGCACAGGAAAGAATGG - Intergenic
970398932 4:15699731-15699753 CAGAATAGCATGGGAAAGACCGG + Intronic
970978900 4:22074269-22074291 GAGAATAGCACAGGAAAGACTGG - Intergenic
971940386 4:33207411-33207433 GAGAATAGCACAGGAAAGACTGG - Intergenic
973718289 4:53699587-53699609 GAGAATAGCACGGGAAAGACTGG + Intronic
974013175 4:56625559-56625581 GAGAATAGCACGGGAAAGACTGG - Intergenic
974388559 4:61234360-61234382 GAGAATAGCATAGGAAAGACCGG + Intronic
974592037 4:63964162-63964184 GAGAATAGCACAGGAAAGACTGG - Intergenic
975311867 4:72912581-72912603 GAGAATAGCACAGGAAAGACGGG - Intergenic
975312157 4:72914463-72914485 GAGAATAGCACAGGAAAGAATGG - Intergenic
975632123 4:76414648-76414670 AAGAATAGCACGGGAAAGACCGG - Intronic
976165139 4:82246624-82246646 CTGAATAGCTCAGCTTAGCCTGG + Intergenic
976494910 4:85716917-85716939 CAGAAGAGCACAAGAGAGACAGG - Intronic
976811922 4:89107802-89107824 GAGAATAGCACAGGAAAGACTGG - Intronic
977025951 4:91820146-91820168 AAGAATAGCACAGGAAAGACTGG + Intergenic
977669984 4:99684435-99684457 GAGAATAGCACAGAAAAGACTGG - Intergenic
978016668 4:103753500-103753522 AAGAATAGCACAAGAAAGACTGG - Intergenic
978107332 4:104919187-104919209 CACTATAGCACAGAATAACCAGG + Intergenic
978284348 4:107058017-107058039 GAGAATAGCACAGGAAAGACTGG + Intronic
979037713 4:115746607-115746629 CAGCATTGCACAATATAGCCAGG + Intergenic
979795214 4:124837979-124838001 GAGAATAGCACAGGAAAGACTGG + Intergenic
980071328 4:128245409-128245431 GAGAATAGCACAGGAAAGACTGG - Intergenic
980083464 4:128368395-128368417 GAGAATAGCACAGGAAAGACAGG + Intergenic
980627789 4:135396242-135396264 AAGAATAGCACGGGAAAGACTGG - Intergenic
981810114 4:148764468-148764490 CAAAAAAGCAGAGGAAAGCCAGG - Intergenic
981861638 4:149362478-149362500 GAGAATAGCACAAGAAAGACTGG - Intergenic
982086380 4:151840860-151840882 CAGAATGATACAGGACAGCCAGG - Intergenic
982482844 4:155933197-155933219 AAGAATAGCACTGGAAAGACTGG - Intronic
982679253 4:158409218-158409240 GAGAATAGCACGGGAGAGACTGG - Intronic
982948758 4:161663041-161663063 GAGAATAACACAGGAAAGACCGG + Intronic
982966224 4:161912413-161912435 GAGAATAGCACAGGAAAGACTGG - Intronic
983067991 4:163234905-163234927 GAGAATAACACAGGAAAGACTGG + Intergenic
983463050 4:168049828-168049850 GAGAATAGCACAGGAAAGACTGG - Intergenic
983816753 4:172138830-172138852 TAAAATAACACAGGGTAGCCAGG - Intronic
984900212 4:184579983-184580005 AAGAATAGCACAGGAAAGATTGG + Intergenic
1202753426 4_GL000008v2_random:31964-31986 CTGAATATCACAGCTTAGCCTGG - Intergenic
986298440 5:6458996-6459018 GAGAAGAGCACAGCAAAGCCAGG + Intronic
987332870 5:16872835-16872857 AAGAATAGTACAGGAAAGACTGG + Intronic
987457320 5:18163629-18163651 AAGAATAGCACAGAAAAGACTGG + Intergenic
988009068 5:25460692-25460714 GAGAATAGCACAGGAAAGACCGG - Intergenic
988009354 5:25462625-25462647 GAGTATAGCACAGGAAAGACTGG - Intergenic
988128975 5:27079077-27079099 AAGAGTAGCACAGGAAAGACTGG + Intronic
988635520 5:32979174-32979196 CAGTATAGGACAGGAGAACCTGG + Intergenic
989212366 5:38868473-38868495 GAGAATAGCACAGAAAAGACCGG - Intronic
989532695 5:42525749-42525771 GAGAACAGCACAGGAAAGACTGG - Intronic
989637263 5:43549410-43549432 AAGAATAGCACCGGAAAGACTGG - Intronic
989750798 5:44890727-44890749 GAGAACAGCACAGGAAAGACTGG - Intergenic
989777985 5:45232318-45232340 GAGAATAGCACAGGAAAGACTGG + Intergenic
989788630 5:45363688-45363710 AAGAATAGCACAGGAAAAACTGG - Intronic
989952381 5:50315076-50315098 CAGAATAGAAAAGCACAGCCTGG - Intergenic
990075575 5:51842886-51842908 AAGAATAACACAGGAAAGACAGG + Intergenic
990093270 5:52082374-52082396 AAGAATAGCACGGGAAAGACTGG + Intergenic
990268530 5:54107189-54107211 GAGAATAGCACAGGAAAGACTGG + Intronic
991006786 5:61835710-61835732 GAGAATAGCACAGGAAAGACTGG - Intergenic
991520382 5:67490728-67490750 GAGAATAGCACGGGAAAGACCGG + Intergenic
992118546 5:73565955-73565977 CAGATTAACACAGGAAGGCCGGG - Intronic
992955701 5:81906193-81906215 CAGAAATTCACAGGAAAGCCTGG + Intergenic
994615062 5:102093463-102093485 GAGAATAGCACAGGAAAGACTGG + Intergenic
995231208 5:109765900-109765922 CAGGAAAGTACATGATAGCCTGG - Intronic
995312547 5:110730700-110730722 GAGAATAGCACAGGAAAGACTGG + Intronic
995680548 5:114713682-114713704 GAGAACAGCACAGGAAAGACCGG + Intergenic
995833976 5:116382223-116382245 CAAAATAGCACAGCATTGCGTGG - Intronic
996238448 5:121164712-121164734 GAGAATAGCACAGGAAAGACTGG - Intergenic
996490233 5:124086144-124086166 GAGAATAGCACGGGAAAGACGGG - Intergenic
996617539 5:125458819-125458841 GAGAATAGCACAGGAAAGATGGG - Intergenic
997081565 5:130745938-130745960 GAGAATAGCACAGGAAAGACCGG - Intergenic
998723127 5:144976366-144976388 GAGAATAGCACAGGAAAGACTGG - Intergenic
998989843 5:147803347-147803369 GAGAATAGCACAGGAAATACTGG - Intergenic
1000750960 5:165096773-165096795 GAGAATAGCACAGGAAAGAGAGG + Intergenic
1000833374 5:166129668-166129690 CAGAAAAGCACATGGTAACCCGG + Intergenic
1002075162 5:176703979-176704001 CAGAATAGCACGGGGAAGACTGG - Intergenic
1003373142 6:5548144-5548166 GAGAATAGCACAGGAAAGACCGG + Intronic
1003421183 6:5959989-5960011 GAGAAGAGCACAAGAAAGCCAGG - Intergenic
1004141116 6:13018561-13018583 CAGAGCAGCACAGTATAGCAGGG - Intronic
1004192012 6:13472128-13472150 CAGAATAGCACAGGAAAGACCGG + Intronic
1004682824 6:17913186-17913208 CAGAATAGCAAAGGGCAGGCAGG + Intronic
1004699381 6:18065030-18065052 GAGAATAGCACAGGAAAGACTGG + Intergenic
1004785697 6:18965217-18965239 GAGAATAGCACAGGAAAGACCGG + Intergenic
1004899852 6:20183984-20184006 GAGAATAGCATAGGAAAGACTGG + Intronic
1005295740 6:24424991-24425013 CAGAATGGAACAGGACAGGCTGG + Exonic
1005402170 6:25446060-25446082 CACAATAGAACAAGAAAGCCTGG - Intronic
1006344015 6:33465369-33465391 GAGAATAGCACGGGAAAGACTGG - Intergenic
1006696999 6:35939687-35939709 GAGAATAGCACAGGAAAGACTGG - Intergenic
1008729820 6:54467834-54467856 GAGAATAGCACAGAAAAGACTGG - Intergenic
1009396758 6:63207687-63207709 AAGAATAGCACAGGAAAGACCGG - Intergenic
1009755267 6:67930984-67931006 AAGAATAGCACTGGAAAGACAGG + Intergenic
1010734522 6:79428795-79428817 CACCATAGCACAGGATACCAAGG - Intergenic
1010748033 6:79586675-79586697 CAGAAGGGCAGAGAATAGCCAGG - Intergenic
1011495996 6:87937139-87937161 GAGAATAGCACAGGAAAGACAGG + Intergenic
1012718831 6:102714277-102714299 CAGGATAGTACAGGAGAGCAGGG - Intergenic
1013208977 6:107969964-107969986 CAGAGTAGCAGAGAAGAGCCTGG + Intergenic
1013717982 6:112986608-112986630 TAGAAAATCAAAGGATAGCCTGG + Intergenic
1014576800 6:123083285-123083307 GAGAATAGCACGGGAAAGACTGG + Intergenic
1015648586 6:135425804-135425826 CAGAGTAGCCCAGGATAGTTAGG - Intronic
1015815541 6:137207563-137207585 GAAAATAGCACAGGAAAGACTGG - Intronic
1016335720 6:143002987-143003009 GATAATAGCACAGGAAAGACCGG + Intergenic
1016460245 6:144274204-144274226 GAGAATAGCACAGGAAAGACCGG + Intergenic
1016643624 6:146378837-146378859 AAGAACAGCACAGGAAAGACTGG - Intronic
1017575616 6:155798961-155798983 AAGAATAGCACGGGAAAGACTGG - Intergenic
1017885559 6:158596844-158596866 GAGAATAGCACGGGAAAGGCTGG + Intronic
1018509737 6:164512333-164512355 GAGAATAGCACGGGAAAGACTGG - Intergenic
1018872337 6:167792805-167792827 GAGAACAGCACAGGAAAGACCGG - Intronic
1018997710 6:168722877-168722899 GAGAATAGCACTGGAAAGACAGG - Intergenic
1019020695 6:168915241-168915263 CAGAATAAGACAGGACAGCTTGG + Intergenic
1019115394 6:169757061-169757083 GAGAATAGCACGGGAAAGACCGG + Intronic
1019381809 7:727742-727764 GAGGATGGCACAGGATAGGCAGG - Intronic
1019608572 7:1923423-1923445 CGGAAGAGCGCAGGATTGCCTGG - Intronic
1020345205 7:7154770-7154792 GAGAATAGCACGGGAAAGACTGG - Intergenic
1020547716 7:9554547-9554569 GAGAATAGCACATGAAAGACTGG - Intergenic
1021501626 7:21338242-21338264 GAGAATAGCACAGGAAATACAGG - Intergenic
1021823873 7:24527738-24527760 GAGAATAGCACAGGAAAGGCCGG + Intergenic
1022391125 7:29945332-29945354 GAGAATAGCACAGGAAAGACCGG - Intronic
1023784055 7:43687951-43687973 GAGAATAGCACAGCAAAGACTGG - Intronic
1024674945 7:51629992-51630014 AAGAATAGCACGGGAAAGACTGG + Intergenic
1025275778 7:57580467-57580489 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1025285638 7:57658516-57658538 GAGAATAGCACAGGAAACACTGG - Intergenic
1025300502 7:57816247-57816269 GAGAATAGCACAGGAAAGACTGG + Intergenic
1026120272 7:67530614-67530636 AAGAATGGCACAGGAAAGACTGG + Intergenic
1026422787 7:70257756-70257778 CAGAATAAAATAGGATAGGCAGG - Intronic
1026532718 7:71213166-71213188 GAGAATAGCACAGGAAAGACTGG - Intronic
1026711739 7:72747208-72747230 AAGAATAGTACAGGAAAGACCGG - Intronic
1027922718 7:84416208-84416230 GAGAATAGCACTGGAAAGACTGG - Intronic
1028011241 7:85647943-85647965 AAGAATAGCACAGGAAAGATTGG + Intergenic
1028514890 7:91666760-91666782 CAGAATAGAACAGAATAGAATGG + Intergenic
1029903716 7:104069811-104069833 AAGAATAGCACAGGAAAGACCGG + Intergenic
1030583523 7:111388748-111388770 GAGAATAGCACAGGAAAGACCGG + Intronic
1030806678 7:113928645-113928667 GAGAATAGCACTGGAAAGACTGG - Intronic
1031145867 7:117995968-117995990 GAGACTAGCACAGGAAAGACTGG - Intergenic
1031288833 7:119907440-119907462 GAGAACAGCACAGGAAAGACCGG + Intergenic
1031658232 7:124385482-124385504 GAGAATAGCACAGGAAAGACTGG - Intergenic
1032719768 7:134541267-134541289 CAGAATATCACAGAAAAGCATGG + Exonic
1033419865 7:141195934-141195956 AAGAATAGCACAGGAAAGACCGG + Intronic
1033456235 7:141506522-141506544 GAGAATAGCACAGGGAAGACCGG + Intergenic
1033456564 7:141508758-141508780 GAGAATCGCACAGGAAAGACTGG + Intergenic
1033580158 7:142725874-142725896 GAGAATAGCTCAGGAAAGACTGG + Intergenic
1033580446 7:142727775-142727797 AGGAATAGCACAGGAAAGACCGG + Intergenic
1033733458 7:144200000-144200022 CAGAATAGAAGAGGATAGGCTGG - Intergenic
1033749593 7:144350973-144350995 CAGAATAGAAGAGGATAGGCTGG + Intergenic
1034011095 7:147530582-147530604 AAAAATAGCACAGGAAAGACTGG + Intronic
1034623258 7:152472536-152472558 AAGAATAACACAGGAAAGACTGG - Intergenic
1035183177 7:157105584-157105606 GAGAATAGCACAGGAAAGACTGG - Intergenic
1036457565 8:8923477-8923499 AAGGATAGCACAGGAAAGACTGG + Intergenic
1036457913 8:8925720-8925742 CAGAATAGCATGGGAAAGACCGG + Intergenic
1037048629 8:14341702-14341724 AAGAATAGCACAGGAATGACTGG - Intronic
1037167245 8:15846065-15846087 AAGAATAGCACAGGAAAGACTGG + Intergenic
1037870798 8:22494364-22494386 AAGAATAGCACAGGAAAGACCGG + Intronic
1038752810 8:30312675-30312697 AAGAATAGCACAGGAAAGACTGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1041792968 8:61716363-61716385 GAGAATAGCACAGGAAAGACCGG + Intergenic
1041825236 8:62088071-62088093 CAAAATAGCTCAGGAAGGCCAGG - Intergenic
1041954095 8:63537976-63537998 CAAAGGAGTACAGGATAGCCAGG + Intergenic
1042073796 8:64966804-64966826 AAGAATAGCACTGGAAAGACTGG + Intergenic
1042137550 8:65645822-65645844 CAAAATAACCCAGGATAGCCGGG - Intronic
1042412378 8:68480181-68480203 GAGAATAGCACAGGAAAAGCTGG - Intronic
1042412660 8:68482103-68482125 GAGAATAGCACAGGATAATCTGG - Intronic
1042466223 8:69132611-69132633 GAGAATAGCACAGGAAAGACTGG + Intergenic
1042692318 8:71514673-71514695 AAGAATAGCACAGGAAAGATGGG + Intronic
1042992501 8:74656427-74656449 AAGAATAGTACAGGAAAGACTGG - Intronic
1043523459 8:81071805-81071827 CAGAAAAGAACAGGATAGTTTGG + Intronic
1043829863 8:84974671-84974693 CAGAATAGCAAAAGCTATCCTGG + Intergenic
1044429616 8:92093984-92094006 CAGAATGGAAAAGGACAGCCTGG - Intronic
1044664223 8:94619594-94619616 GAGAATAGCACAGGAAAGACTGG - Intergenic
1045672170 8:104567398-104567420 GAGAATAGCACGGGAAAGACTGG + Intronic
1046175356 8:110568885-110568907 AAGAATAGCACAGGAAAGACTGG + Intergenic
1046454402 8:114439895-114439917 GAGAATGGCACAGGAAAGACTGG - Intergenic
1047195062 8:122713500-122713522 TAGAATAGCACGGGAAAGACTGG - Intergenic
1047562738 8:126007373-126007395 GAGAATAGCACAGGAAAGATCGG + Intergenic
1047794794 8:128243561-128243583 GAGAATAGCACAGGAAAGGCTGG - Intergenic
1048009792 8:130446377-130446399 CTGAATAGCCCTGGATACCCTGG - Intergenic
1048091658 8:131247703-131247725 GAGAATAGCACAGGAAAGACTGG - Intergenic
1048604072 8:135949270-135949292 CAGAATATCATAGCTTAGCCTGG - Intergenic
1050726548 9:8656191-8656213 CAGAATGGCACAGTAAGGCCTGG + Intronic
1050904963 9:10992800-10992822 AAGAATAGCACAGGAAAGACTGG - Intergenic
1050929171 9:11302255-11302277 AAGAATAGCACAGGAAAGACTGG + Intergenic
1051429998 9:16972065-16972087 GAGACTAGCACAGGAAAGACTGG - Intergenic
1051771270 9:20582765-20582787 GAGAATAACACAGGAAAGACCGG + Intronic
1052351916 9:27466769-27466791 AAGAATAGCACGGGAAAGACCGG + Intronic
1052614646 9:30822042-30822064 GAGCATAGCACAGGAAAGACTGG - Intergenic
1052747991 9:32460051-32460073 AAGAATAGCACAGGAAAGACTGG - Intronic
1052782425 9:32795197-32795219 GACAATAGCACAGGAAAGACGGG + Intergenic
1053793324 9:41702440-41702462 GAGAATAGCACAGGAAAGACTGG - Intergenic
1054151854 9:61612390-61612412 GAGAATAGCACAGGAAAGACTGG + Intergenic
1054181731 9:61914455-61914477 GAGAATAGCACAGGAAAGACTGG - Intergenic
1054471625 9:65543529-65543551 GAGAATAGCACAGGAAAGACTGG + Intergenic
1054782558 9:69178571-69178593 CAGAATGGCCCAGAATAGCCAGG + Intronic
1055701200 9:78947647-78947669 AAGAATAGCACAGAAAAGACTGG - Intergenic
1056841198 9:89999361-89999383 CAGAACAGCTCAGCACAGCCTGG - Intergenic
1057316318 9:93971169-93971191 GAGAATAGCACAGGAAAGACTGG + Intergenic
1058181866 9:101808609-101808631 GAGAATAGCACAGGAAAGACCGG - Intergenic
1058387200 9:104451429-104451451 CAGAATAGCCCATGATATTCTGG - Intergenic
1058401669 9:104626112-104626134 GAGAATAGCACAGGAAAGACTGG - Intergenic
1058649196 9:107159273-107159295 AAGAATAGCACAGGGAAGACTGG - Intergenic
1059920700 9:119157131-119157153 GAGAATAGCACAGGACAGACTGG - Intronic
1060443837 9:123669389-123669411 CAGAATCTCAAAGGACAGCCTGG - Intronic
1060909665 9:127339478-127339500 GAGAATAGCACGGGAAAGACTGG + Intronic
1061341408 9:129984741-129984763 GAGAATAGCACGGGAAAGACCGG - Intronic
1203757606 Un_GL000218v1:148881-148903 CTGAATATCACAGCTTAGCCTGG + Intergenic
1203716996 Un_KI270742v1:161554-161576 CTGAATATCACAGCTTAGCCTGG + Intergenic
1203534216 Un_KI270743v1:16683-16705 CTGAATATCACAGCTTAGCCTGG - Intergenic
1203626979 Un_KI270750v1:33960-33982 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1203651224 Un_KI270751v1:125136-125158 CTGAATATCACAGCTTAGCCTGG + Intergenic
1185572303 X:1144452-1144474 TACAATATCACAGGATAGCTTGG + Intergenic
1185893504 X:3839727-3839749 CAGAATAGCACAGGAAAGACCGG - Intronic
1185898621 X:3878151-3878173 CAGAATAGCACAGGAAAGACCGG - Intergenic
1185903736 X:3916580-3916602 CAGAATAGCACAGGAAAGACCGG - Intergenic
1186298658 X:8175830-8175852 GAGATTAGCACAGGAAAGACCGG - Intergenic
1186840472 X:13479920-13479942 CAGAAAAGCAGAGGGTGGCCTGG - Intergenic
1187555043 X:20343515-20343537 AAGAATAGCACAGGGAAGACTGG - Intergenic
1188428174 X:30073719-30073741 GATAATAGCACAGGAAAGGCCGG + Intergenic
1188765146 X:34081500-34081522 GAGAATAGCACAGGAAAGACCGG + Intergenic
1189028978 X:37429975-37429997 AAGAATAGCACAGGAAAGACTGG + Intronic
1191678968 X:63822055-63822077 GAGAATAGCACGGGAAAGACTGG + Intergenic
1192436597 X:71147231-71147253 CAGAATAGCATGTGACAGCCAGG - Intronic
1192581707 X:72288401-72288423 GAGAATAGCACGGGAAAGACTGG - Intronic
1193797375 X:85892406-85892428 GAGAATAGCACAAGAAAGACCGG - Intronic
1194297530 X:92144412-92144434 GAGAATAGCACGGGAAAGACTGG - Intronic
1194566283 X:95493322-95493344 GAGAATAGCACAAGAAAGACCGG - Intergenic
1195210230 X:102647232-102647254 GAGAATAGCACTGGAAAGACTGG + Intergenic
1195519706 X:105816857-105816879 CAAAATAGGAAATGATAGCCAGG + Intergenic
1195563218 X:106310178-106310200 GAGAATAGCACGGGAAAGACTGG + Intergenic
1195745549 X:108113785-108113807 GAGAATAGCACGGGAAAGACTGG + Intronic
1196558508 X:117120218-117120240 TAGAATAGCACAGGAAAGACTGG + Intergenic
1196619708 X:117807664-117807686 CAGCATAGCACAGATTAACCAGG - Intergenic
1196645710 X:118116223-118116245 CAAAGAAGCACAGGAAAGCCGGG + Intronic
1196694190 X:118593671-118593693 AAGAATAGCACAGGAAAGAGCGG + Intronic
1196981670 X:121221256-121221278 CAGAAGAGCACATGAGAGCCTGG - Intergenic
1197336313 X:125213278-125213300 CAGAAAAGCACAGGAAAGACCGG + Intergenic
1197507727 X:127328866-127328888 CTTAGTAGCACAGGAAAGCCTGG - Intergenic
1197511268 X:127371963-127371985 GAGAATAGCACAGGAAAGACTGG + Intergenic
1197914414 X:131519970-131519992 GAGAATAGCACGGGAAAGACTGG - Intergenic
1198198166 X:134385992-134386014 AAGAATGGCACAGGAGAGCTGGG + Intronic
1198320307 X:135513382-135513404 CAGAGAAGCACAGGAAACCCGGG - Intergenic
1198734473 X:139771160-139771182 GAGAACAGCACAGGAAAGACCGG - Intronic
1199113420 X:143960543-143960565 GAGAATAGCGCAGGAAAGACTGG + Intergenic
1199208691 X:145180438-145180460 GAGAATAGCACAGGAAATACTGG - Intergenic
1199325624 X:146494503-146494525 GGGAATAGCACAGGAAAGACTGG - Intergenic
1199925538 X:152459462-152459484 GAGAATAGCACAGGAAAGACTGG - Intergenic
1200615102 Y:5369313-5369335 GAGAATAGCACGGGAAAGACTGG - Intronic
1201171180 Y:11266495-11266517 CAGAATATCACAGCTTAGCCTGG + Intergenic
1201437752 Y:13977764-13977786 AAGAAAAGCACAGGAAAGACCGG - Intergenic
1201439352 Y:13991716-13991738 GAGATTAGCACAGGAAAGACCGG - Intergenic
1201445221 Y:14050992-14051014 GAGATTAGCACAGGAAAGACCGG + Intergenic