ID: 936654050

View in Genome Browser
Species Human (GRCh38)
Location 2:114463806-114463828
Sequence GATTTGAAGGGGTTTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 406}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936654050 Original CRISPR GATTTGAAGGGGTTTGGGGA GGG (reversed) Intronic
900900734 1:5514030-5514052 GACTGGGAGGGGTTGGGGGAGGG - Intergenic
901427415 1:9191272-9191294 GATTTTAAGGGGTTTGGAGTGGG - Intergenic
901689497 1:10963529-10963551 GATTTGGATGGGAGTGGGGAGGG - Intronic
902120578 1:14161771-14161793 GATTTTGGGGGGTTTGGAGATGG - Intergenic
902425611 1:16319145-16319167 GATTTGGCGGGGGGTGGGGAAGG + Intronic
902562266 1:17284901-17284923 TTTCTGAAAGGGTTTGGGGAGGG + Intergenic
905011043 1:34747431-34747453 GACTCCAAGGGGTTTGGGGTGGG - Intronic
905018363 1:34792669-34792691 GATTTGAAGGGGTTGCAGTAAGG - Intronic
906047374 1:42842456-42842478 GGTCTTAAGGGATTTGGGGATGG - Intronic
906249053 1:44297266-44297288 GCTTTGTAGGGCTTTGGGAAGGG - Intronic
907439370 1:54469428-54469450 GATTTGGAGGGGCCTGGGGGCGG + Intergenic
907654380 1:56327416-56327438 GATGTGAATGGGAGTGGGGATGG + Intergenic
907844219 1:58189413-58189435 GAATTTAAGTGGTTTGTGGAAGG + Intronic
907952334 1:59195825-59195847 GATTTGTAGAGGGTTGGAGAGGG + Intergenic
908089046 1:60667265-60667287 GATCTGAAGCAGTTTGGGGTGGG - Intergenic
908468914 1:64423011-64423033 AATTTGATGGTGTTTGGAGATGG - Intergenic
909800683 1:79803857-79803879 GATTTGCTGGGATTTGGGGCAGG + Intergenic
910241991 1:85096869-85096891 GATTTGCAGGGCTTGGAGGATGG - Intronic
911120948 1:94295905-94295927 GATTTGAAAGGATGAGGGGAAGG + Intergenic
911440963 1:97925290-97925312 GTTTTGAATGGGTTGGGGGATGG - Intergenic
912940486 1:114040333-114040355 GATTTTGAGGGGTTTGGAGTGGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915278769 1:154808155-154808177 TATGAGAAGGGGTTGGGGGATGG - Intronic
915594903 1:156891191-156891213 GATTTCACAGGGTTTGGGGTGGG + Intergenic
915614893 1:157029972-157029994 GGTTTTCAGGGGTTAGGGGAAGG + Intronic
916080088 1:161226868-161226890 CATCTGAAGGGGGTAGGGGAAGG - Exonic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917208881 1:172610323-172610345 TATTTGAAGGGTTTGGGGGAGGG + Exonic
917288086 1:173442366-173442388 GTTTTGAAGGGGTTCTGGGGAGG - Intergenic
917468199 1:175303004-175303026 GATTTTCAGGGGTTGGAGGAAGG + Intergenic
917494392 1:175526862-175526884 GATTTGTAAGTGTGTGGGGAAGG + Intronic
917686050 1:177416949-177416971 GTTTTCAGGGGGTTTGGAGATGG + Intergenic
917686947 1:177426048-177426070 GACTGGAAGCAGTTTGGGGAGGG - Intergenic
918412767 1:184277433-184277455 GGTTTCCAGGGGTTGGGGGATGG + Intergenic
919598262 1:199591323-199591345 GATTTGAAGTGGAGTTGGGAAGG + Intergenic
920170534 1:204069727-204069749 GATTTTAAGGGGTTTGGAGTGGG - Intergenic
920227766 1:204450593-204450615 GCTTTGAAGCTGTTTGGGGGTGG - Intronic
922376938 1:224978497-224978519 GATGAGAAGGGTGTTGGGGAGGG + Intronic
923457696 1:234178911-234178933 AATTTCCAGGGGTTGGGGGAAGG - Intronic
923522245 1:234744339-234744361 GTTTTGTAGGGATGTGGGGAAGG + Intergenic
1065207829 10:23374080-23374102 GTTTTCAAGGGGTTTGGAGTGGG - Intergenic
1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG + Intronic
1066340550 10:34528779-34528801 GGTTTCAAGGGGTATGGAGAAGG + Intronic
1066635670 10:37496617-37496639 ACTTTGAGGGGGTTTGGGGAAGG + Intergenic
1067918853 10:50431789-50431811 GATTTGAAGGAATATGGGGAAGG + Intronic
1068590873 10:58851741-58851763 GATTAGAGGGGGTGAGGGGAAGG + Intergenic
1068665276 10:59668367-59668389 GGTTGGAAGGGGAGTGGGGATGG - Intronic
1068719768 10:60231779-60231801 GAATGGAATGGGTTGGGGGAAGG - Intronic
1068956192 10:62819934-62819956 GAGGTGGAGGGGTGTGGGGATGG + Intronic
1068993115 10:63171679-63171701 GATTTCAATGGGTCTGGGGAGGG - Intronic
1069602222 10:69715283-69715305 GATGGGATGGGGTTTGGGAATGG + Intergenic
1071104582 10:82079633-82079655 GATTGCCAGGGGTTTGGGGGTGG - Intronic
1071348419 10:84715440-84715462 GGGTTGGAGGGGTTTTGGGATGG + Intergenic
1071371897 10:84959927-84959949 GTTTTTAAGGGGTTTGGAGTGGG - Intergenic
1071722193 10:88158420-88158442 GATTTGAAGGGAAATGGTGAGGG - Intergenic
1071996904 10:91158420-91158442 GATTTGAAGGGGGAGGAGGAAGG + Intergenic
1073109048 10:101050041-101050063 GGGTGGAATGGGTTTGGGGATGG + Intergenic
1073210773 10:101800562-101800584 TATATGAAGTGGTTTGGTGAAGG - Intronic
1073534914 10:104268206-104268228 GATTTGAAGGGGTTAGAGACAGG - Intergenic
1073610688 10:104939740-104939762 GACTAGAAGGGATTTGGGCATGG + Intronic
1073640922 10:105251524-105251546 CATTTGGAGGTGTTTGGGGTGGG + Intronic
1074217297 10:111398113-111398135 GATATCAGAGGGTTTGGGGAAGG + Intergenic
1074418397 10:113287077-113287099 GATCTGAAGGGGGTTGGGGGAGG + Intergenic
1075279649 10:121128712-121128734 GGTTTGCAGGGGTCTCGGGAGGG - Intergenic
1075634111 10:124018757-124018779 GGTGAGAAGGGGTCTGGGGAGGG + Intronic
1075830932 10:125410209-125410231 TATTTGAAGGGGATTGAAGAGGG - Intergenic
1078710049 11:13782787-13782809 CATGTGAAGGGGTTGTGGGATGG - Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079932613 11:26583986-26584008 GATTAGAAGGGGTCAGGGAAAGG - Intronic
1080597652 11:33788880-33788902 GATTTCATGGGACTTGGGGAAGG - Intergenic
1080890614 11:36405953-36405975 AATTTGATGGGATTTGGAGATGG - Intronic
1080925099 11:36748067-36748089 GACTTGAAGGGGTTTGGAGTAGG + Intergenic
1081850904 11:46274651-46274673 CATCTGAAGGAGTTAGGGGATGG - Intergenic
1081869735 11:46377837-46377859 GATTCGAAGGGGATGGGGGTGGG - Intronic
1082547602 11:54352331-54352353 CATTTGGAGGGCTTTGGGGATGG + Intergenic
1082549091 11:54371779-54371801 CATTTGGAGGGCTTTGGGGATGG + Intergenic
1082549703 11:54379967-54379989 CATTTGGAGGGCTTTGGGGATGG + Intergenic
1082550458 11:54390203-54390225 CATTTGGAGGGCTTTGGGGATGG + Intergenic
1083724538 11:64621362-64621384 GATTTGGAGGGTATTGGGCATGG + Intronic
1083873855 11:65509517-65509539 GTTTTGGAGGGGTTGGGGAATGG - Intergenic
1084115651 11:67041609-67041631 GATCTGAAGGGGTGAGGGGAAGG + Intronic
1084833123 11:71785142-71785164 GATTGGAAGCGGATTGAGGAAGG - Intergenic
1085441705 11:76569989-76570011 GTTTGCCAGGGGTTTGGGGAAGG - Intergenic
1086064538 11:82732482-82732504 GATCCGACGGGGTTTGGGAAGGG - Exonic
1087081038 11:94171315-94171337 TATTTGAAAGTGCTTGGGGAAGG - Intronic
1087419737 11:97906748-97906770 GATTTGAAGGGGTCAGGGCTGGG + Intergenic
1089877100 11:121734732-121734754 GGTTTGCAGGGGTTAGTGGAGGG - Intergenic
1090195477 11:124812759-124812781 GATAGGAGTGGGTTTGGGGATGG - Intergenic
1090477866 11:127039908-127039930 AATTTCAAAGTGTTTGGGGATGG + Intergenic
1090906170 11:131076408-131076430 GAATGGAAGGGGTGTGGTGAGGG - Intergenic
1091504082 12:1049459-1049481 GATTTGATTGGGCTTGGGGGTGG + Intronic
1091541894 12:1469774-1469796 GATTTGAAAGCTCTTGGGGAAGG - Intronic
1092163695 12:6329815-6329837 CTTCTGAAGGGGGTTGGGGATGG + Exonic
1092203480 12:6601622-6601644 AAACAGAAGGGGTTTGGGGAAGG - Intronic
1092281733 12:7102538-7102560 GATGGGATGGGCTTTGGGGATGG - Intronic
1094438474 12:30448103-30448125 GATTGTCAGGGGTTTGGGGGAGG + Intergenic
1095637301 12:44449541-44449563 GATTTGAAGGAGTTTAGGAGAGG - Intergenic
1095770026 12:45943645-45943667 GATTTGAAGGGAACTGGGTATGG - Intronic
1096258909 12:50078868-50078890 GAATTCAAGGGGTCTGGTGATGG - Intronic
1096755649 12:53797284-53797306 GAGTAGAAGGGATTTGGGGCTGG + Intergenic
1096780924 12:53991680-53991702 GAAGGGAAGGGGGTTGGGGAAGG - Intronic
1097053831 12:56238697-56238719 GTTTGGCAGGGGTTTGGGAAGGG - Exonic
1097181602 12:57175051-57175073 GATTTGGAGGGGTTTGGGGTGGG - Intronic
1098021702 12:66162842-66162864 GTTTGGAGGGAGTTTGGGGAAGG - Intronic
1098549721 12:71749898-71749920 GATTTAATGGGGGTGGGGGATGG + Intergenic
1098905418 12:76156930-76156952 GATTTGAAGCTGTTCTGGGAAGG - Intergenic
1099562026 12:84191075-84191097 GGTTGGAAGGGATATGGGGAGGG - Intergenic
1100843107 12:98632976-98632998 GAGTGTAAGGGATTTGGGGAAGG - Intronic
1101527673 12:105546378-105546400 GATTTTGAGGGGTTTTGGGCAGG + Intergenic
1101701726 12:107180083-107180105 GAGTTTAAGGGGTTTGGAGTGGG - Intergenic
1102645646 12:114401974-114401996 GTTTTGGGGGAGTTTGGGGAAGG - Intronic
1102880650 12:116482213-116482235 GACTTGAAGGGTTTGGGGCAGGG + Intergenic
1102992437 12:117324791-117324813 AATACGAGGGGGTTTGGGGAAGG - Intronic
1106138222 13:26990393-26990415 GAATTGAAGCGATGTGGGGATGG - Intergenic
1106288782 13:28341724-28341746 AATTTGAAAGGGATTGGGGGAGG - Intronic
1106654737 13:31731189-31731211 GATCTGAAAGGGATTGAGGAAGG - Intergenic
1106663468 13:31826824-31826846 GTTTTTAAGGGTTTTGGGGTGGG - Intergenic
1107520564 13:41176391-41176413 GATGTGATGGGGTTTGGGTACGG - Intergenic
1108737032 13:53294914-53294936 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
1110193630 13:72760178-72760200 GATTTCAAGTGTGTTGGGGAAGG + Intronic
1110380250 13:74841932-74841954 GACTTGAGAAGGTTTGGGGAAGG + Intergenic
1113347994 13:109499304-109499326 GATTTGATGGGTATTTGGGATGG + Intergenic
1113770660 13:112906361-112906383 GATTTGCAGGTGAATGGGGAAGG + Intronic
1114829317 14:26120442-26120464 GGTTTGGAGGGGGTTGGAGATGG - Intergenic
1115276331 14:31613310-31613332 GAGTTGAGGGGATGTGGGGATGG + Intronic
1115595012 14:34901030-34901052 AATTAGAAGAGGTTTGGGAAAGG - Intergenic
1116015066 14:39396009-39396031 GATTTGAAAGGGTTGGGAGCTGG + Intergenic
1116267328 14:42710333-42710355 TATCTGCAGGGGTTTGGAGAAGG - Intergenic
1117071638 14:52062712-52062734 GAATTGAAGGGGATGGGGAAGGG + Intronic
1118541156 14:66826986-66827008 GATCTGAAGAGGTTTGGGCCTGG + Intronic
1118654901 14:67936262-67936284 GATTTCCAAGGGCTTGGGGAAGG - Intronic
1118693835 14:68364527-68364549 GAGTGGAAGGGGCTGGGGGAGGG - Intronic
1119416113 14:74470566-74470588 GAGTGGCACGGGTTTGGGGATGG + Intergenic
1119812627 14:77535385-77535407 GATGAGAAGGCCTTTGGGGAGGG + Intronic
1120009843 14:79401194-79401216 GATTTGAATGACTTTAGGGAAGG + Intronic
1120015177 14:79465263-79465285 GCTTTGAGGGTGTTTGTGGATGG + Intronic
1120241117 14:81950831-81950853 GAGTTGAAGGGCATTGGGAAGGG + Intergenic
1120580931 14:86247619-86247641 GATTGCCAGGGGTTAGGGGAAGG + Intergenic
1123185542 14:106513075-106513097 AGCTTGCAGGGGTTTGGGGAGGG + Intergenic
1124553586 15:30706196-30706218 GTTTTGCACGTGTTTGGGGAGGG - Intronic
1124677659 15:31699472-31699494 GTTTTGCACGTGTTTGGGGAGGG + Intronic
1125214178 15:37250764-37250786 GATTTGAAAAGGTTTTGAGATGG - Intergenic
1125220573 15:37328436-37328458 GATTGCCAGGGGCTTGGGGAAGG + Intergenic
1125418657 15:39479696-39479718 GAGTGGAAGGGGTGTGGGAATGG - Intergenic
1126129484 15:45326406-45326428 GATTTTAAGGGTTTTGGAGTGGG + Intergenic
1127930727 15:63595585-63595607 GGTTTGAGGAGGATTGGGGAGGG + Intergenic
1128391036 15:67182682-67182704 GATGTCTAGGGGGTTGGGGAGGG + Intronic
1128861711 15:71079796-71079818 GATTTGAGCAGGTTTGGTGAAGG - Intergenic
1129159616 15:73740080-73740102 GACTTGTAGGGGGCTGGGGAGGG + Exonic
1129266049 15:74393673-74393695 GCTGTGCAGGTGTTTGGGGAAGG - Intergenic
1129485588 15:75868304-75868326 AATTTGATGGGGTTTTAGGAAGG - Intronic
1129797831 15:78391540-78391562 GAGTTTAAGGGGGTTGGGGGTGG + Intergenic
1131301296 15:91201898-91201920 GATTTGATGGGGTTGGGGAGTGG - Intronic
1131740330 15:95383597-95383619 GATTGCAAGAGGTTTGGGGTGGG + Intergenic
1132070651 15:98774167-98774189 GATTTGAAGGGATTCAGGAAAGG - Intronic
1132099251 15:99011738-99011760 TATTTGAAGGGCATTGTGGATGG - Intergenic
1132728902 16:1351102-1351124 CGTTTGAGGGTGTTTGGGGATGG - Intronic
1133018716 16:2956505-2956527 GATTTGAAGGGGTTTTCCCATGG - Intergenic
1133691855 16:8223304-8223326 CATAAGAAGGGGTTGGGGGACGG - Intergenic
1134346139 16:13393521-13393543 TATTTGTAGGGATTTGGGGCAGG + Intergenic
1134529098 16:14968562-14968584 GATTGGAAGGGGTTAGGGAAGGG + Intergenic
1134798103 16:17060064-17060086 GGTTTCCAGGGGCTTGGGGAAGG + Intergenic
1135050742 16:19191006-19191028 GAGTTCATGTGGTTTGGGGAAGG + Intronic
1135790455 16:25389498-25389520 GATTTTAAGGAGTTTGGAGTAGG + Intergenic
1137530382 16:49275565-49275587 GAACTGACGGGGTGTGGGGAGGG + Intergenic
1137734475 16:50713705-50713727 GACTTGAAGGGGGAAGGGGAGGG + Intronic
1139638360 16:68273125-68273147 GACTTGAAGGGGTTTGGGACAGG + Intronic
1139819318 16:69708008-69708030 GATTTGAATGGGTTTGAGAATGG - Intronic
1139867267 16:70072413-70072435 GATTGGAAGGGGTTAGGGAAGGG - Intergenic
1140461960 16:75147110-75147132 GATTTCCAGGGGTTGTGGGATGG + Intergenic
1142482788 17:229089-229111 GATTTGAATGGGTTCCTGGAGGG - Intronic
1142500542 17:330434-330456 GATTTAAAGTTGTTTGAGGACGG - Intronic
1143242854 17:5458629-5458651 GAGATAAAGGGGGTTGGGGAGGG + Intronic
1144526363 17:15993913-15993935 GTTTTAGTGGGGTTTGGGGAAGG - Intronic
1144785979 17:17831852-17831874 CATGTGAATGGATTTGGGGATGG - Intronic
1144964573 17:19068300-19068322 GGTTAGCAGGGGTTGGGGGAGGG + Intergenic
1144983394 17:19183873-19183895 GGTTAGCAGGGGTTGGGGGAGGG - Intergenic
1144984831 17:19194366-19194388 GGTTAGCAGGGGTTGGGGGAGGG + Intergenic
1147249955 17:39147341-39147363 GGTTTTATGGGGTTTGGGGTGGG - Intronic
1148079627 17:44960505-44960527 GATTGGAAGGGGGCGGGGGAGGG - Intronic
1148337771 17:46852596-46852618 GAATTGCAGGGATTTGGTGAGGG + Intronic
1148494202 17:48042855-48042877 CTGTTGAAGGAGTTTGGGGAGGG - Intergenic
1148552390 17:48558299-48558321 GAGTTGAGGAGGCTTGGGGAAGG - Intronic
1148798699 17:50210034-50210056 GGTTTGAGGAGGTTTGAGGAGGG - Intergenic
1149702863 17:58669870-58669892 GTATTGAAGGGCTTTGGGCAAGG - Intronic
1149730657 17:58942674-58942696 GATTTGTGGGGGTAGGGGGAGGG + Intronic
1149899776 17:60464422-60464444 GAGTTTAAGGGGTTGGAGGAAGG - Intronic
1150292121 17:63988108-63988130 GATTTTAGGGGGCTTGGGGAAGG - Intergenic
1150845459 17:68653155-68653177 GACTTGAAGGGGTCTGGATAAGG - Intergenic
1151617306 17:75221901-75221923 GAGTTGATGGGGTTTGCTGATGG + Intronic
1151848498 17:76674807-76674829 GATCTGAAGGGATGTGGGGCGGG + Exonic
1151974627 17:77477312-77477334 GATTTCCAGGGGCTGGGGGAGGG - Intronic
1152643059 17:81457198-81457220 GATTTGTATGGGTGTGGGGAGGG - Intronic
1153260225 18:3216600-3216622 GATTGGCAGGGGTTCTGGGATGG + Intronic
1153376400 18:4385375-4385397 GATTTCAGGGGGTCTGAGGAGGG - Intronic
1153891675 18:9522313-9522335 GATTTGAAGAGGCTTGTGGGAGG + Exonic
1154057701 18:11027158-11027180 GAATTCAAGGGGCTTGGGGATGG + Intronic
1154313034 18:13282224-13282246 GATTTGGAGGGGTCAGGGGCAGG - Intronic
1155105111 18:22656239-22656261 CATTTGATGGTATTTGGGGAAGG + Intergenic
1156525237 18:37761062-37761084 CATTTGCAGGGGTTTAGAGAAGG + Intergenic
1156581368 18:38380487-38380509 AATTTTAAGGAGTTTGGAGAGGG - Intergenic
1158166353 18:54545574-54545596 GATTTGATGGGGTAGGGGGAGGG + Intergenic
1159669016 18:71200165-71200187 CATGGGAAGGGGTTGGGGGAGGG - Intergenic
1160965472 19:1745357-1745379 GAAGAGAAGGGGATTGGGGAGGG - Intergenic
1161524877 19:4748088-4748110 AATTTGAAGGGGTGTGGAGGTGG - Intergenic
1162468635 19:10858650-10858672 GAGGTAAAGGGGTGTGGGGAAGG - Intronic
1166663315 19:44661564-44661586 GAATTGAAGGGGCGTGGGGCAGG - Intronic
1167612375 19:50513724-50513746 TTTAGGAAGGGGTTTGGGGAAGG + Intronic
1167706560 19:51084532-51084554 GAATTTAAGGGGCTAGGGGAGGG - Intergenic
1167792426 19:51690290-51690312 GTTTTGAAGGAGTTAGGGGCTGG - Intergenic
1168069508 19:53941923-53941945 GATAGGAAGGGGCTTGGGGTGGG + Intronic
1168289067 19:55348150-55348172 GTTTTGAAGGGATGTGAGGAGGG + Intergenic
926581935 2:14640274-14640296 GATTTGATGGAGTTTGGTCATGG + Intronic
926582745 2:14649184-14649206 CATGTGTAGGGGTTGGGGGAGGG + Intronic
927076830 2:19586907-19586929 GGGTTGAGGGGGTTAGGGGAGGG + Intergenic
927180230 2:20440690-20440712 GAGTTGGAGAGCTTTGGGGAGGG + Intergenic
927487349 2:23497588-23497610 GTTTTGTAGGGATTTAGGGAAGG + Intronic
927750053 2:25660406-25660428 GGTTTCCAGGGGTTTGTGGAGGG + Intronic
927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
927968881 2:27291512-27291534 GATTGGAGGTGGTATGGGGATGG - Intronic
928690852 2:33797240-33797262 GAATTGAAGGGCTGTGGGCAGGG - Intergenic
928797995 2:35047795-35047817 GATTATGAGGGGTTGGGGGAGGG + Intergenic
930716990 2:54602601-54602623 GACTTGGTGGGGTTTGGGGGAGG - Intronic
932187534 2:69711796-69711818 GACTTGAAGGGTGTGGGGGATGG + Intronic
932399150 2:71467602-71467624 GCCTTGGAGGGGTTGGGGGAGGG - Intronic
932480802 2:72037964-72037986 GAGTTGGTGGGGTTGGGGGAGGG - Intergenic
932481008 2:72039325-72039347 CATTTGGAGGGGTTTGGGGAGGG - Intergenic
932692579 2:73925886-73925908 GATTGCAAGGGGGCTGGGGAGGG - Intergenic
933164689 2:79063258-79063280 TATATGAAGGTGTGTGGGGAGGG + Intergenic
933405356 2:81851283-81851305 GATTGGCAGGAGTTTGGGTAAGG + Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
934893340 2:98089385-98089407 GTTGTGAAGGGGTTTCGGGGAGG + Intronic
935807554 2:106763905-106763927 GGTAGGAAGGGGTTTGGAGAAGG - Intergenic
936654050 2:114463806-114463828 GATTTGAAGGGGTTTGGGGAGGG - Intronic
937013379 2:118581761-118581783 GACTTGAAGTGGTTTGGGGCGGG - Intergenic
937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG + Intergenic
940692925 2:156941834-156941856 GATGAGAAGGAGTTTGAGGAGGG + Intergenic
940901929 2:159133597-159133619 GACTTGTGGGGGTTTGGGGGTGG - Intronic
941782902 2:169464302-169464324 ATTTTGAGGGGGTTGGGGGAAGG - Intergenic
942407894 2:175675337-175675359 CATGTGAAGGGGTTGGGGGTGGG - Intergenic
943029362 2:182668230-182668252 GATTTGTAGGGGTTCTGAGAAGG + Intergenic
943679429 2:190752466-190752488 GATTTAAGGGGGATGGGGGAAGG - Intergenic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
945139360 2:206667379-206667401 GACTTGAAGGAGGTTGGGGAGGG - Intronic
945273441 2:207964313-207964335 GATTTCAACAGGTCTGGGGAAGG + Intronic
946291016 2:218745661-218745683 GAATGCAAGGGGTGTGGGGATGG - Intronic
946384410 2:219373813-219373835 GATGGGAAGGGATTTTGGGAGGG + Exonic
946578870 2:221104904-221104926 TGTTTGAGGGGGTTTGGGAAAGG - Intergenic
946741874 2:222810444-222810466 GGTTTCCAGGGGTTGGGGGAAGG + Intergenic
947767002 2:232644263-232644285 GAATAAAAGAGGTTTGGGGAGGG - Intronic
947774797 2:232699093-232699115 GAATAATAGGGGTTTGGGGAGGG + Intronic
947843695 2:233226736-233226758 GATCTGAAGGGGGGTGGGTATGG + Intronic
948218311 2:236248759-236248781 GATTTGAATGAATTTGTGGAAGG + Intronic
948292295 2:236834807-236834829 GATTTGGAGAGGTCTGTGGATGG - Intergenic
948755911 2:240159491-240159513 GCTCTGCAGGGGTTTGGGGAAGG - Intergenic
1169514090 20:6297475-6297497 GTTGTCAAGGGGTTGGGGGAAGG - Intergenic
1169629745 20:7617253-7617275 GATTAGTAGGGGTTTGGGAAGGG + Intergenic
1170446192 20:16430508-16430530 GACGTGGTGGGGTTTGGGGATGG - Intronic
1170614430 20:17937512-17937534 GTTCTGATGGGGTTTGGAGAGGG - Intergenic
1170673117 20:18453443-18453465 GAGTTGTAGGGTTTGGGGGAAGG - Intronic
1170792009 20:19516248-19516270 CATTTGGAGGGTTTGGGGGAGGG + Intronic
1170819112 20:19740895-19740917 CATTCTAAGGGATTTGGGGAGGG - Intergenic
1170993413 20:21327049-21327071 GATGGGACAGGGTTTGGGGAGGG + Intronic
1171036716 20:21718340-21718362 CATTTGAAGGTGTGAGGGGAAGG + Intronic
1171452617 20:25247150-25247172 AGTTTGAAGGGGTTGAGGGAAGG + Intergenic
1171464811 20:25320003-25320025 GTTCTGAAGGGGTTGAGGGAAGG - Intronic
1172033376 20:31996357-31996379 GATCAGCAGGGGTGTGGGGAAGG - Intronic
1172470450 20:35189887-35189909 GAATTGAAGAGTTTTGAGGAAGG + Intergenic
1172939811 20:38646369-38646391 GCTTAGAAGCGGGTTGGGGAGGG + Intronic
1173321138 20:41987877-41987899 GGCTTGCCGGGGTTTGGGGATGG + Intergenic
1173915427 20:46704722-46704744 GATTTTAAGGGTTTTGGAGTGGG + Intergenic
1174091424 20:48051734-48051756 GACTTTAAGGGGTTAGAGGAGGG + Intergenic
1175106693 20:56620313-56620335 GATTTCAAGGGGTCTGAGGTGGG + Intergenic
1175301725 20:57947782-57947804 GGTGGGATGGGGTTTGGGGAGGG - Intergenic
1177597265 21:23261348-23261370 GATTTGCGGGGGTGTGGGGGAGG - Intergenic
1178607752 21:34054526-34054548 GATCTGAAGGGGGATGAGGAAGG + Intergenic
1178687711 21:34724260-34724282 GACTTAAAGGGGTGTGGAGAAGG + Intergenic
1180639589 22:17287652-17287674 CATTTGAAGGGTTTGGGGCAGGG - Intergenic
1182743226 22:32584088-32584110 GATTTCAAGGGGTTTGAAGTGGG - Intronic
1183057398 22:35315390-35315412 GCTTTGGAGGGTTTTGGGGCGGG - Intronic
1183253062 22:36743980-36744002 AAGGGGAAGGGGTTTGGGGAGGG - Intergenic
1184786030 22:46672401-46672423 GGTGGGAGGGGGTTTGGGGAGGG + Intronic
1184868860 22:47220283-47220305 GACTGGAAGGGGTGAGGGGAGGG - Intergenic
949405074 3:3705495-3705517 GAAATGAAGGGGGTTGGGGGAGG + Intronic
949530922 3:4954234-4954256 GATGTGATGGTGTTTGGAGATGG + Intergenic
949704788 3:6803837-6803859 ACTTGGAAGGGGGTTGGGGAGGG - Intronic
949933305 3:9097593-9097615 GATGTGCAGAGATTTGGGGAAGG - Intronic
950749090 3:15114719-15114741 GATTTTAAGGGGTTTGGAGTGGG - Intergenic
952141264 3:30481200-30481222 GATTTGGAAGGGTCTGGGGGTGG + Intergenic
952249524 3:31637853-31637875 TTTTGGAAGGGATTTGGGGAGGG + Intergenic
953637839 3:44677726-44677748 GATTTACAGAGGTTTGGGGAGGG + Intergenic
953738485 3:45516326-45516348 ACTTTGAAGGAGTTTGAGGAAGG + Intronic
954484814 3:50837770-50837792 GGGTGGAAGGGGTTTGGGGAGGG + Intronic
955032079 3:55231671-55231693 ACTTTGAAGGGGTTTGAGCAAGG - Intergenic
955380296 3:58433179-58433201 GGTTACCAGGGGTTTGGGGAAGG + Intronic
955941664 3:64151878-64151900 GGTTTTTAGGGGTTAGGGGATGG + Intronic
956386648 3:68726230-68726252 GATTTGCATGGGTTTTTGGAGGG - Intergenic
957164855 3:76659268-76659290 TATTTCCAGGGGTTGGGGGAAGG + Intronic
957297277 3:78348978-78349000 GATTTGGAGTAGTTTGGGCAGGG - Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
957973725 3:87416768-87416790 GATGTGATGGTGTTTGGAGATGG + Intergenic
959207348 3:103326975-103326997 GATTTGATCTGGATTGGGGATGG + Intergenic
961210522 3:125121492-125121514 GATTTGAATGGGCTTAGGGATGG + Intronic
961299593 3:125914220-125914242 GATTGGAAGCGGATTGAGGAAGG - Intergenic
961719608 3:128884275-128884297 GAGCTGAAGGGATTTGGTGAAGG + Intronic
962352344 3:134665157-134665179 GATATGAAGGGGATTGGGCTGGG + Intronic
962740248 3:138358042-138358064 GATGTAAAGGGGTCTGGGCATGG + Intronic
962829000 3:139123393-139123415 GATGTGTGGGGTTTTGGGGAAGG - Intronic
963001514 3:140686020-140686042 TATTTGCAGAGGTTTGGGGTGGG + Intronic
963929047 3:150982846-150982868 GAACTGAAGGGGGCTGGGGAGGG + Intergenic
964840973 3:160993378-160993400 GATTTGGGAGGGTTGGGGGAAGG + Intronic
965078348 3:164005579-164005601 TGTTGGGAGGGGTTTGGGGAAGG + Intergenic
966020452 3:175202968-175202990 GTTTTGGAGGGGTTTGGGCGGGG - Intronic
966140680 3:176752581-176752603 GAGTGGAGGGGGGTTGGGGAGGG + Intergenic
966300046 3:178468766-178468788 GATTGTCAGGGGTTGGGGGAGGG + Intronic
967173144 3:186839620-186839642 CATTTCTAGGGGTTTGGGGATGG + Intergenic
967864556 3:194179548-194179570 GATGTGAAGGGATGTGGGGAAGG - Intergenic
969816278 4:9690058-9690080 GATTGGAAGCGGATTGAGGAAGG - Intergenic
970424502 4:15933818-15933840 GGCTTGAAGGAGCTTGGGGAGGG + Intergenic
970458497 4:16249392-16249414 AGTTTGCAGAGGTTTGGGGAGGG + Intergenic
970593014 4:17576063-17576085 GTTTTTAAGGGTTTTGGAGAGGG - Intergenic
971949629 4:33327952-33327974 CATTTGTAGGTGTTTGGTGAGGG - Intergenic
972136319 4:35899187-35899209 GATTTGAGGGAGTTTGGTGAAGG - Intergenic
973093278 4:46164806-46164828 CACTTTAAGGGGTGTGGGGATGG - Intergenic
973583695 4:52370434-52370456 GACTTTAAGGGGTTTGGAGTAGG + Intergenic
973683530 4:53345950-53345972 GATTAGGGGGGGCTTGGGGAGGG + Intronic
975850048 4:78562968-78562990 GATTACAAGGGGATTGGGGGAGG + Intronic
976275244 4:83270124-83270146 GAGTTGAAAGGGTTTAAGGAAGG - Intronic
977028740 4:91855499-91855521 GAGTTCAAGGGGTGTGGAGAGGG - Intergenic
977085744 4:92596411-92596433 GATGTGCAGGTGTTTGGAGATGG - Intronic
981018883 4:140004523-140004545 GAAAGGGAGGGGTTTGGGGAGGG + Intronic
982126140 4:152185529-152185551 GAGTTGAGGGAGTTTGGGGTGGG - Intergenic
982407926 4:155041299-155041321 GATTATAATGGGTTTGAGGAAGG - Intergenic
982514765 4:156331223-156331245 GATTTGAAAGGGTGTGTGGGTGG + Intergenic
982700015 4:158650210-158650232 GTTTTCTAGGGGTTGGGGGAAGG + Intronic
984008564 4:174343148-174343170 GTTGCCAAGGGGTTTGGGGAAGG - Intergenic
984047111 4:174814857-174814879 GATTTGGATGAGGTTGGGGATGG - Intronic
984561024 4:181270543-181270565 GTTTAGAAAAGGTTTGGGGATGG - Intergenic
986584398 5:9299684-9299706 CATTTGAACAGGTTTTGGGAAGG + Intronic
987205166 5:15618008-15618030 GTGTTGCAGGGGTTGGGGGAGGG + Intronic
987494770 5:18629793-18629815 ACTTTGAGGGGCTTTGGGGAAGG - Intergenic
988425461 5:31058509-31058531 AACTTGAAGGGTTTTAGGGATGG + Intergenic
989438525 5:41442774-41442796 GATTTGAAGTGTTTGGGTGAGGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989980162 5:50633844-50633866 GGTTGCCAGGGGTTTGGGGATGG + Intergenic
990218555 5:53561650-53561672 GATTTGAAGGGGGTAGGAGGTGG + Intronic
992625773 5:78634693-78634715 GATTGGAAAGGGTGAGGGGATGG - Intronic
993020616 5:82586154-82586176 TATTTGGATGGTTTTGGGGATGG + Intergenic
993106428 5:83605817-83605839 GTTTTGTAGTGGTTTGGGGGTGG - Intergenic
993824619 5:92667417-92667439 GATTTGAGGGGAATTGGTGAAGG + Intergenic
993841140 5:92880250-92880272 TTTTTAAAGGGGTTGGGGGATGG + Intergenic
994743878 5:103654983-103655005 TATATGAAAGGGTTTGGGGGTGG - Intergenic
995742245 5:115367154-115367176 GATTCCAAGGGGCTGGGGGAAGG - Intergenic
996120090 5:119661905-119661927 GGTTTCCAGGGGTTAGGGGAAGG - Intergenic
996206502 5:120744391-120744413 GGTTGGAAGGGGATTGGGGAAGG + Intergenic
996895140 5:128472341-128472363 GGTTGGCAGGGGTTTGGGGTGGG + Intronic
999103891 5:149051846-149051868 GATTTGAAGGTGTTGAGAGATGG - Intronic
999138480 5:149340179-149340201 GATTTTAGGGGATATGGGGAGGG + Exonic
999496087 5:152099756-152099778 GTTTTGCAGTGTTTTGGGGAGGG - Intergenic
999818717 5:155202694-155202716 GATTTGGAGGGGGTTTGGGGAGG - Intergenic
1000106579 5:158065526-158065548 GCTTAGGAGGGGTTTGGGGTGGG + Intergenic
1000518222 5:162266870-162266892 GATTTGATGGGGTTTGATGGGGG - Intergenic
1000632245 5:163604055-163604077 AATATGAAGGGGATTGAGGAGGG + Intergenic
1001696280 5:173672819-173672841 GACTTCGAGGGGCTTGGGGAGGG + Intergenic
1001837242 5:174842836-174842858 AATTTTAAGGGGTTTGGAGTGGG - Intergenic
1002162015 5:177319974-177319996 AATTTCAATGGGTTTGGGGTAGG - Intergenic
1002891397 6:1335789-1335811 GATGTGAATGGGGTTGGGAAGGG + Intergenic
1003326953 6:5099169-5099191 GATTTGAAGGGGTTAGTTGAAGG + Intergenic
1003684538 6:8288129-8288151 GATTTCCAGGGGTTGGGGAAGGG - Intergenic
1003931251 6:10926640-10926662 GAAATGATGGGGTTTGGGGGAGG + Intronic
1004138551 6:12992141-12992163 GATTTGGAGGGGATTGGAGAAGG - Intronic
1004433704 6:15569467-15569489 GATTTTAAGGGGTTTGGAGTGGG - Intronic
1005278082 6:24241726-24241748 GGTTTGAAGGACTTTGGGGAAGG - Intronic
1005460299 6:26062839-26062861 GTTTTGAATGGGTTAGGGAATGG - Intergenic
1007408878 6:41650109-41650131 GATGGGGAGGGGTTTGGGGTGGG - Intronic
1007657651 6:43461508-43461530 GATGTGATGGGGATAGGGGATGG - Intergenic
1009293757 6:61917472-61917494 GATTGACAGGGGTTAGGGGAAGG + Intronic
1010500225 6:76590312-76590334 GTTTGGCAGGGGTTTGGGGGTGG - Intergenic
1010828276 6:80498924-80498946 GAAAGGAAGGGATTTGGGGAGGG - Intergenic
1010951022 6:82037290-82037312 GATATGAAGGAGTTTGGGCTAGG - Intergenic
1010955477 6:82086305-82086327 GATTTCTAGGGGCTGGGGGAAGG + Intergenic
1012404083 6:98874694-98874716 GATTTGAAGGGGTAGGAGGTAGG - Intronic
1012626229 6:101406420-101406442 GATCTGAAAGGGTTTGGGGAGGG + Intronic
1012927834 6:105285387-105285409 GAGCTGAAGGGGTTTGGAGCAGG - Intronic
1013599632 6:111692169-111692191 GATTTGAAGGTGTTTGGGAAAGG + Intronic
1015366837 6:132405056-132405078 GACTGCAAGGGGTTGGGGGAAGG + Intergenic
1016584760 6:145672292-145672314 GTTTTAAAGGGATTTGGGGAAGG - Intronic
1016784660 6:147997262-147997284 GATATGAATGGGTAGGGGGAGGG - Intergenic
1017983418 6:159422229-159422251 GATTTGAAGTGGTCTGGCAAAGG + Intergenic
1019066289 6:169302152-169302174 GCTTTGATGGGGCATGGGGAAGG - Intergenic
1019868356 7:3734610-3734632 CATTTGACGGAGTTTGGGAAGGG - Intronic
1020106337 7:5423868-5423890 GGTTGGAGGGGGTTGGGGGAGGG + Intronic
1022208914 7:28189306-28189328 TATTTTCAGGGGGTTGGGGATGG - Intergenic
1022411570 7:30142436-30142458 TATTTGAAGGGGGTTGTGGGTGG - Intronic
1023020036 7:36003714-36003736 AATGTGAAGGGGCTTGGGAATGG + Intergenic
1024448042 7:49504682-49504704 GATTTTAAGGGATTAGGGAAGGG - Intergenic
1024551437 7:50565818-50565840 GATTTTGATGGGTTTGGGGAAGG - Intergenic
1024653942 7:51433409-51433431 GACTTGAAAGTGTTTGGTGAAGG - Intergenic
1025023643 7:55498594-55498616 GATTGGCAGGGATGTGGGGAGGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026847366 7:73705579-73705601 GAGTTGAAGGGGTGGGGGGGCGG + Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1028995125 7:97091531-97091553 GATTGTCAGGGGTTAGGGGAAGG - Intergenic
1030779911 7:113587581-113587603 CATTTGAAGGGCTTTGGGGTAGG - Intergenic
1030814027 7:114012209-114012231 GATCTGATGGGATATGGGGAGGG - Intronic
1030914735 7:115298265-115298287 AATTTTAAGGGGTTTTGGGGGGG + Intergenic
1031221663 7:118974417-118974439 GATTTGAAGGGTTTATGTGAGGG + Intergenic
1031927675 7:127653322-127653344 GATTTGGAAGGGTTTTGGGGAGG - Intronic
1032162364 7:129520668-129520690 GATTTGGGGTGGTTTGGGGAAGG - Intergenic
1033230530 7:139594002-139594024 GATGGAAAGGGGGTTGGGGAGGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034954995 7:155328637-155328659 GATGTGAATGTCTTTGGGGAGGG - Intergenic
1036497767 8:9284954-9284976 GATTTAAGAGGATTTGGGGAAGG + Intergenic
1037460132 8:19100521-19100543 TAGCTTAAGGGGTTTGGGGAGGG + Intergenic
1037821669 8:22138179-22138201 CATTTGCAGGGGTTCAGGGAGGG + Exonic
1038250551 8:25900024-25900046 GATTTGAAGGGTTCGAGGGAAGG - Intronic
1039057405 8:33547958-33547980 GATCAAAAGGGGTGTGGGGATGG - Exonic
1042005310 8:64173082-64173104 GATCTGTAGGGTTGTGGGGAGGG - Intergenic
1042864722 8:73347166-73347188 GATTTCCAGGGGCTGGGGGAAGG + Intergenic
1042872239 8:73409774-73409796 GATTTTGAGGGGTTTGGAGCAGG + Intergenic
1043007268 8:74835161-74835183 GATTTGAAGGGATGGGGGTAAGG - Intronic
1044068290 8:87724301-87724323 GAATTTAATGTGTTTGGGGAAGG + Intergenic
1046999738 8:120562004-120562026 TGTTTGGATGGGTTTGGGGAGGG - Intronic
1047318039 8:123752690-123752712 GAGTTGAGGAGGGTTGGGGAGGG + Intergenic
1047737549 8:127779848-127779870 CATTTGAATGGGGATGGGGAAGG + Intergenic
1049877754 8:145036867-145036889 TAGTGGAAGGTGTTTGGGGATGG + Intergenic
1050691114 9:8227311-8227333 GAAATGAAGGGGTTTGAGGAAGG + Intergenic
1050948580 9:11558811-11558833 GAGTTGAAGGGATTTGGGAATGG + Intergenic
1051976020 9:22950213-22950235 GATAACAAGGGGCTTGGGGAAGG + Intergenic
1054919694 9:70529850-70529872 AATTTGAAGGTGTTTGTGGTGGG + Exonic
1056902017 9:90608702-90608724 GATTTTAAGGGTTTTGGAGTGGG - Intergenic
1056924276 9:90819728-90819750 GATTTGAAGGGGCCAGGGGTGGG - Intronic
1058770512 9:108226760-108226782 GATTTGGATGGATATGGGGATGG + Intergenic
1059369126 9:113811126-113811148 TAATTGAAGAGGTTGGGGGAAGG + Intergenic
1059938319 9:119333880-119333902 GACTTGAAGGGGCTTTGGTATGG - Intronic
1061910377 9:133719241-133719263 TATTTTATGGGATTTGGGGAAGG - Intronic
1203341412 Un_KI270420v1:495-517 CATTTGGAGGGCTTTGGGGATGG - Intergenic
1185750939 X:2609290-2609312 GACTCGAAGGGGTTGGGTGAGGG - Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186475882 X:9857333-9857355 GATTTTAGGGGGAGTGGGGATGG + Intronic
1187650432 X:21397575-21397597 GATGGGAAGGGGAGTGGGGATGG + Intronic
1187980286 X:24749286-24749308 GAATGGGAGGGGTTTGGGGTTGG + Intronic
1188438759 X:30193482-30193504 CATTTGAAGGGGGCTGGGGTTGG - Intergenic
1189742017 X:44128763-44128785 TATTTGAAGGAGTTTGGTTAAGG + Intergenic
1189748327 X:44193241-44193263 AATTTGAAGGGGTCGGGGGTGGG - Intronic
1191111192 X:56804056-56804078 AATGTGAAGGGGTATGGGGGAGG + Intergenic
1191156783 X:57283104-57283126 GATGGGAAGGGGATTGCGGAGGG + Intergenic
1192552600 X:72066128-72066150 TCATTGAAGGGGTCTGGGGAAGG + Intergenic
1195201130 X:102551251-102551273 GGTTTGCAGAAGTTTGGGGAGGG - Intergenic
1195289428 X:103417553-103417575 AATGTGATGGTGTTTGGGGATGG - Intergenic
1195542496 X:106078751-106078773 GATTTGCAGGGAGGTGGGGATGG - Intergenic
1196182462 X:112707035-112707057 GGTAGGAAGGGGTTTGGGCAAGG - Intergenic
1197466638 X:126812700-126812722 CCTTTGAAAGGGTATGGGGAGGG + Intergenic
1198608002 X:138365535-138365557 GATTTCTAGGGGCTGGGGGAGGG - Intergenic
1198977970 X:142358568-142358590 GAATTGAAGGAGTTTGTGGATGG - Intergenic
1199080645 X:143572977-143572999 ATTTTGAAGGGGTTTTGGGATGG - Intergenic
1199362247 X:146935499-146935521 GATTTGAAGGGTATTGGACAGGG - Intergenic
1199872738 X:151913256-151913278 AATGGGAAGGGGTTAGGGGATGG - Intronic
1201280479 Y:12338167-12338189 GATGTGAAGTTGTTTTGGGAAGG - Intergenic
1201489718 Y:14526286-14526308 AATGTTAAGGGGTTGGGGGATGG + Intronic
1202023474 Y:20492731-20492753 GATTTGTTGGTGTTTGGGCATGG - Intergenic