ID: 936654887

View in Genome Browser
Species Human (GRCh38)
Location 2:114473644-114473666
Sequence TCCCAGATATTGAACCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936654887 Original CRISPR TCCCAGATATTGAACCTTAG AGG Intronic
902640294 1:17762629-17762651 TCCCCGATATCGAACCCCAGGGG + Intronic
904284617 1:29446045-29446067 TCTCTGATATTGAACCTCGGGGG - Intergenic
905288681 1:36906214-36906236 TCCCTGGTATTGCACCTGAGTGG - Intronic
906124056 1:43415765-43415787 GCTCAGATACTGAACCTCAGAGG - Intronic
909946143 1:81665557-81665579 TCCCAGATATAGAGCCATGGAGG - Intronic
911013059 1:93302197-93302219 CCCCAGGTACTGAACCTAAGAGG + Intergenic
912867513 1:113271183-113271205 TCCCAGATATCAAAGGTTAGTGG - Intergenic
914726762 1:150334449-150334471 TCCCAGCTACTGAACCTGGGAGG - Intronic
915770909 1:158422137-158422159 TACCAGATTTTGTACCTTTGAGG + Intergenic
916480044 1:165206740-165206762 TCCCACATAAAGAGCCTTAGGGG + Intronic
923160811 1:231312980-231313002 ACCCACAAATTAAACCTTAGTGG - Intergenic
924205701 1:241709406-241709428 TTTGAGATATTGAACCTAAGGGG - Intronic
1063114681 10:3065884-3065906 TCCCAGAAATTGGACTTCAGTGG + Intergenic
1063783056 10:9349178-9349200 TCTCAGATATTCAACATGAGAGG + Intergenic
1064340150 10:14478255-14478277 TGCCAGTTATTGACCCTTGGTGG + Intergenic
1071319710 10:84442090-84442112 TCCCACATTTTTAACCTTAAGGG + Intronic
1077841866 11:5983982-5984004 TCTCATAAATGGAACCTTAGCGG - Intergenic
1080242107 11:30138264-30138286 TCCCAGGTCTTGAAACTTACAGG + Intergenic
1081048085 11:38301291-38301313 TTCCATATATTGAAGTTTAGTGG - Intergenic
1081187108 11:40057360-40057382 TCCCAGGTATGGAAACTTGGTGG - Intergenic
1086602561 11:88652520-88652542 TCCAAGATAGTAAACCTTTGAGG + Intronic
1087685821 11:101263688-101263710 TCACAGACATTGAAACTTAGAGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1091087753 11:132739383-132739405 TCCCAGGCAATGAACCTAAGTGG + Intronic
1096110951 12:49028933-49028955 TCCCAGATACCAAACCTTATGGG - Exonic
1097236633 12:57544882-57544904 TCCAAGATACTCAAGCTTAGGGG + Intronic
1100223811 12:92535969-92535991 TCCTAGAAAATCAACCTTAGTGG - Intergenic
1106623236 13:31391369-31391391 TCCCAGATAGTTAATTTTAGGGG + Intergenic
1108618228 13:52156810-52156832 GCCCAGCTACTGAACCTAAGAGG + Intronic
1110179742 13:72601694-72601716 TCACAGACATAAAACCTTAGTGG - Intergenic
1115468763 14:33746051-33746073 TCCCAGAAACTGAACCTGCGGGG + Intronic
1115701701 14:35959766-35959788 CCCCAAATAGTGAACCTGAGAGG + Intergenic
1119887393 14:78154336-78154358 TCTCAGCTTTTGAATCTTAGTGG + Intergenic
1121210487 14:92204798-92204820 TCCTAGATACTGAACCATAAAGG - Intergenic
1121832985 14:97067815-97067837 TTCCAGATAGGGAACCTCAGTGG + Intergenic
1130399716 15:83538460-83538482 TTCAAGATATAGAACATTAGTGG + Intronic
1131000488 15:88936195-88936217 CCCCAGGTATTGAACATAAGAGG + Intergenic
1138433170 16:56982336-56982358 TCCCAGTCATTGATACTTAGCGG + Intronic
1143111321 17:4554615-4554637 TCCCAGAAAGTGTACCTAAGAGG + Intronic
1153882506 18:9433654-9433676 CCCCAGATAGTGAAGTTTAGAGG - Intergenic
1158915016 18:62115987-62116009 TCCCAGATATTCCAACTCAGGGG + Intronic
1166500687 19:43338802-43338824 CTCCAGATACTGAACCTAAGTGG + Intergenic
1166509450 19:43394911-43394933 CCCCAGATACTGAACCTAAGTGG - Intergenic
1167941903 19:52954268-52954290 TCCCAGCTACTGAACCTGGGAGG + Intronic
926399092 2:12477235-12477257 TCCCATAGATAGAAGCTTAGAGG - Intergenic
931480169 2:62631659-62631681 TCCCAGACCTTGAAACTTAGTGG - Intergenic
931688612 2:64816272-64816294 TCCCAGTCACTGAACCTAAGAGG + Intergenic
933726751 2:85431327-85431349 TCCCAGTGAGTGAATCTTAGAGG + Intronic
934991321 2:98923909-98923931 TCCTGGATATTGATCCTTGGAGG + Intronic
935526819 2:104181006-104181028 TCCCAGACATGGATCCTTTGAGG - Intergenic
936654887 2:114473644-114473666 TCCCAGATATTGAACCTTAGAGG + Intronic
939333396 2:140792304-140792326 CACCAGACATTGAACCTAAGAGG + Intronic
940793493 2:158052788-158052810 TCCCAGATAGTAAACATTGGAGG + Intronic
941585532 2:167353408-167353430 TGCCAGAAGTTGAACCTTAGTGG + Intergenic
944252895 2:197595306-197595328 TCTCAGCTACTGAACCTAAGAGG - Intronic
947622587 2:231600325-231600347 GCCCAGCTACTGAACCTAAGAGG + Intergenic
1177096603 21:16842972-16842994 TACCAGCTATTTAACCTCAGGGG + Intergenic
1179349205 21:40591587-40591609 TCCAAGAAATTTAACCCTAGTGG - Intronic
949114762 3:307380-307402 TCCCAGCTGTTAAACCTTTGAGG + Intronic
951772075 3:26269649-26269671 TCCCAGCTGTGGAACCATAGGGG - Intergenic
953784890 3:45903881-45903903 ACCCAGATATTTACCCTTATAGG + Intronic
956408638 3:68955199-68955221 TCCCAGAAAGTCAACCTTATGGG + Intergenic
957645941 3:82926704-82926726 TCCCAGATATTAATTCTTATTGG + Intergenic
958092866 3:88899290-88899312 TCTCAGAAATTGATCCTTAAGGG + Intergenic
959604357 3:108225627-108225649 GCCCAGCTATTGAACCAAAGAGG - Intergenic
963097330 3:141557849-141557871 TTCCAGATTTGGAACCTTGGGGG - Intronic
965893708 3:173546801-173546823 TCCAAGATATAGAACATTGGTGG - Intronic
969272863 4:6114564-6114586 TCCCAGATTTTGTAGCTTGGAGG - Intronic
970567969 4:17350973-17350995 TCCAAGTCTTTGAACCTTAGTGG + Intergenic
976380777 4:84395736-84395758 TCCCAGATTTTGAACTTTTTTGG + Intergenic
982476854 4:155863489-155863511 TTCCACATATTGAACCTCAATGG + Exonic
985393952 4:189521620-189521642 TCCCAGATACTGAACCTAAGAGG + Intergenic
989207912 5:38829941-38829963 CCCCAGATACTGAACCTAAGAGG + Intergenic
989667275 5:43869908-43869930 TCCTAGAAACTGTACCTTAGTGG - Intergenic
991246253 5:64511410-64511432 TCCCAGACATTAAAGCTAAGAGG + Intronic
998431423 5:142073660-142073682 TCCCAGTCATTGAACCTAGGCGG + Intergenic
1005336388 6:24800811-24800833 TCCAAGATATAGAAACTGAGAGG - Intronic
1014015245 6:116522066-116522088 TCTCAGATATTCTAGCTTAGGGG + Exonic
1014707706 6:124767850-124767872 TCCCAGAGATTGCACTTTAGTGG - Intronic
1015053357 6:128869236-128869258 GCCCATGTATTGAAACTTAGTGG - Intergenic
1021331183 7:19340467-19340489 ATGCAGATATTGAACCTGAGAGG - Intergenic
1029880031 7:103798568-103798590 TCTCAGATATAGGATCTTAGGGG + Intronic
1030766724 7:113419513-113419535 TCCAAAATATTGAGCCTCAGGGG + Intergenic
1030896649 7:115069346-115069368 TCCCAGATCTTGAATCTCAGAGG - Intergenic
1032988097 7:137361310-137361332 TTCCAGATATGGACCCTCAGTGG - Intergenic
1035548083 8:499077-499099 TACCAGAAATGGAATCTTAGGGG - Intronic
1035660027 8:1340339-1340361 TGCCAGATATTAGACCTTTGTGG - Intergenic
1041402282 8:57458507-57458529 TCCCAGATATTTAACCCCTGTGG + Intergenic
1045176761 8:99733592-99733614 TCCTAGATTTTGAATCTTGGAGG + Intronic
1045875787 8:106979360-106979382 TCCTTGATATGGTACCTTAGAGG + Intergenic
1047536350 8:125723637-125723659 ACCCAGGTTTTGAACCTCAGAGG + Intergenic
1050340867 9:4637246-4637268 ACCCAGAGAGGGAACCTTAGAGG - Intronic
1050458059 9:5852952-5852974 CCCCAGACACTGAACCTAAGAGG - Intergenic
1052783024 9:32800455-32800477 GATCAGATATTGAACCTAAGGGG + Intergenic
1055862977 9:80775844-80775866 TCACAGATTTTGATCCTTACTGG - Intergenic
1056563006 9:87749033-87749055 TCCCAGTCAGTGAACCTAAGAGG + Intergenic
1060038249 9:120277379-120277401 TCCCATATATTTAATCTTACAGG - Intergenic
1186129825 X:6454532-6454554 TGCCAGATATTTAATCTTTGAGG + Intergenic
1186578770 X:10794275-10794297 TCTCAGACATGGAACCTTGGGGG - Intronic
1187519536 X:20001582-20001604 TCCAAGCAATTGAACCTTTGCGG - Intergenic
1189496852 X:41516258-41516280 TCCCAGATTTTCCAGCTTAGTGG - Intronic
1189601353 X:42630083-42630105 TCCCTGCCATTGAACCTGAGTGG - Intergenic
1195655885 X:107331263-107331285 TCCAGGATTTTGAATCTTAGAGG + Intergenic
1196467542 X:115988083-115988105 TCCCAAATATTAGGCCTTAGGGG + Intergenic
1198730664 X:139724328-139724350 GACCAGAAATTGAACATTAGTGG - Intergenic