ID: 936659674

View in Genome Browser
Species Human (GRCh38)
Location 2:114528819-114528841
Sequence TTGATGATGAATCAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936659674_936659680 30 Left 936659674 2:114528819-114528841 CCTTCTTCCTGATTCATCATCAA 0: 1
1: 0
2: 0
3: 27
4: 311
Right 936659680 2:114528872-114528894 CTTCTGTTCCTCTTTACATATGG 0: 1
1: 0
2: 3
3: 24
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936659674 Original CRISPR TTGATGATGAATCAGGAAGA AGG (reversed) Intronic
900018926 1:173032-173054 TTGAGGTTAAAGCAGGAAGAAGG - Intergenic
902558800 1:17263299-17263321 TTGATGAAGAATAAGGTTGAGGG + Intronic
905364803 1:37444892-37444914 TAGATGATGAATCAGCAATGAGG + Intergenic
906794203 1:48683869-48683891 TGGAGAATGAATGAGGAAGACGG + Intronic
906812228 1:48839635-48839657 TTGGTGATGAATTAGGAGGTTGG + Intronic
908989076 1:70062683-70062705 TAGAAGCTGAATCAGGAAAAAGG + Intronic
909239387 1:73192806-73192828 TTGTTTATGAACCAGCAAGAAGG - Intergenic
909891281 1:81010259-81010281 GTGACGATGTAGCAGGAAGATGG + Intergenic
910329492 1:86054648-86054670 TTGATGAGGTTTCAGGAAAAAGG + Intronic
910458079 1:87419630-87419652 TTGGTAATGAAACAGGAAAATGG - Intergenic
910467557 1:87516384-87516406 TTTATGATGGATCAGGAATCAGG + Intergenic
915043313 1:152986562-152986584 CTGATGCTGCAGCAGGAAGAAGG + Intergenic
916206820 1:162322900-162322922 CTGATGATTAATCAGGCAGATGG + Intronic
917122657 1:171657817-171657839 ATGATAAAGAATCAGGAAGAAGG - Intergenic
919067227 1:192707855-192707877 TAGATGAGGACTCAGCAAGAAGG + Intergenic
919656542 1:200202407-200202429 TTGGTGATGAGTCAGAAATAAGG - Intergenic
920598382 1:207296389-207296411 TTGATGAAAAATCAGGATGTTGG - Intergenic
922159479 1:223068138-223068160 TTGGTGATGACTCAGGGAGCTGG - Intergenic
922356660 1:224782773-224782795 TTGATGAAGAAACTGGAGGAGGG + Intergenic
924348959 1:243096466-243096488 TTGAGGTTAAAGCAGGAAGAAGG - Intergenic
1063298769 10:4833117-4833139 TTGAGGAGGAGTCAGGCAGAAGG + Intronic
1064354703 10:14606084-14606106 TTGATCATGTAGCAGGAAGCAGG - Intronic
1065310808 10:24414611-24414633 TTTATGGTGAATCTGGAAGCAGG + Intronic
1065954570 10:30682548-30682570 TGGATGGTGACTCAGAAAGATGG - Intergenic
1066078703 10:31907882-31907904 TTGATTATGTATAAGGCAGAGGG - Intronic
1066727408 10:38408437-38408459 TTGAGGTTAAAGCAGGAAGAAGG + Intergenic
1067308051 10:45084256-45084278 TTGATGATTCATAAGGAAAATGG - Intergenic
1069055601 10:63841286-63841308 TGGATCATGAAGCTGGAAGAAGG - Intergenic
1071099992 10:82024870-82024892 ATGATGTGGAATGAGGAAGACGG - Intronic
1072333714 10:94378553-94378575 TTGGTGAGGATTCAGGAAGATGG + Intergenic
1072900881 10:99405652-99405674 TTGCTGAGGAATTAGGAAAATGG - Intronic
1073893975 10:108132622-108132644 TTGATAAGGAAAGAGGAAGATGG + Intergenic
1074390417 10:113053011-113053033 TAGCAGATGAATCAGGAAGAAGG - Intronic
1075750650 10:124768179-124768201 TTGATGATAAACGAGGAAGAAGG + Intronic
1075993074 10:126854357-126854379 TAGATGATGAATCAAGGAAAAGG + Intergenic
1076496724 10:130902257-130902279 ATGATGATGTATGAGGACGATGG + Intergenic
1076543977 10:131231657-131231679 TGGATGCTGAACCAGGAGGAAGG - Intronic
1076975525 11:168228-168250 TTGAGGTTAAAGCAGGAAGAAGG - Intronic
1077541730 11:3149717-3149739 TTGATGATCAAAGAGGAAGAAGG - Intronic
1079011918 11:16835495-16835517 TTAATGATGAAACTGGAAGAGGG + Intronic
1079237685 11:18701513-18701535 TTGATGAAGAATGAGTAACAGGG - Intronic
1079417288 11:20251105-20251127 TCGATTATGACTCAGGAAAATGG + Intergenic
1082163334 11:48908852-48908874 TTGATAAGGCATAAGGAAGAGGG - Intergenic
1083194388 11:61075340-61075362 TTGTTGATGAATGATAAAGAAGG + Intergenic
1086157694 11:83685949-83685971 TTGATGATGAATAAGGCATGGGG - Intronic
1086514463 11:87595812-87595834 TGGATCATGGATCTGGAAGATGG - Intergenic
1088029068 11:105224078-105224100 TTTATGATGGATCAGGTAGTGGG - Intergenic
1089041104 11:115450942-115450964 TTGATGATTAAAAAGGAAGGAGG - Intronic
1090638673 11:128711448-128711470 TTGATGATGAAGCCAGGAGACGG - Intronic
1090896353 11:130979311-130979333 TTGCTCTAGAATCAGGAAGAGGG - Intergenic
1091184993 11:133638880-133638902 GTGATGATTTTTCAGGAAGAAGG - Intergenic
1091864636 12:3821086-3821108 TAGGTGTTGAATCAGGATGACGG + Intronic
1093517857 12:20012182-20012204 TTGATGATTAATAAGTAAGATGG + Intergenic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1095490748 12:42731466-42731488 TGGATGAAGAATAAGGAAGCTGG - Intergenic
1096793517 12:54059982-54060004 TGGAGGATAAATCAGGAGGAAGG + Intergenic
1096838596 12:54367698-54367720 TGGATGAAGAGTTAGGAAGAAGG + Intergenic
1097380620 12:58891508-58891530 TAGATTAGGAATCAAGAAGAAGG - Intronic
1097826121 12:64176319-64176341 ATGATGATGATTGAGGATGATGG + Intergenic
1098555230 12:71811275-71811297 ATAATGATGAATCAGGAAATTGG - Intergenic
1100254326 12:92867031-92867053 TGGAAGATTAATTAGGAAGAGGG - Intronic
1101078527 12:101156721-101156743 CTGATTCTGAATCAGGAAGGTGG - Exonic
1101559601 12:105843981-105844003 GTAATGATGAGTCTGGAAGATGG + Intergenic
1102434810 12:112913184-112913206 TTAATGATGACACTGGAAGATGG - Intronic
1104355310 12:128079940-128079962 TTGATGTTAACTCAGGAACAAGG - Intergenic
1106434729 13:29713296-29713318 TTGATCATGAATAAAGCAGAGGG - Intergenic
1107542463 13:41403865-41403887 TTGAGGATACAACAGGAAGATGG - Intergenic
1108163292 13:47665582-47665604 TTGATGGGGAATGAGAAAGAGGG - Intergenic
1109352217 13:61198046-61198068 TTGATCATTAATTTGGAAGATGG - Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1110352854 13:74529943-74529965 TTAATGAAGAAGGAGGAAGATGG - Intergenic
1110599848 13:77360481-77360503 GTGATGAAGAAACAGGAAGAAGG + Intergenic
1111238093 13:85435120-85435142 TAGATGATGACTCAGCAATAAGG - Intergenic
1111530565 13:89532366-89532388 TTGCTGATTGATCAGGATGATGG + Intergenic
1113274763 13:108716426-108716448 TGGAGGATGAATCTGGAGGACGG + Intronic
1114765998 14:25371131-25371153 TTAATGAGGAAGCAGGAGGAAGG - Intergenic
1116111798 14:40594539-40594561 ATGAAGATGCATCAGGAAGTCGG + Intergenic
1116637441 14:47415807-47415829 GTGAGGATGCAGCAGGAAGACGG - Intronic
1116980502 14:51165352-51165374 TTGATGATGGCCAAGGAAGAGGG - Intergenic
1117183228 14:53213862-53213884 TGGATAATGAATCAGGAAATAGG + Intergenic
1118009583 14:61595906-61595928 TTGAAGATGAATGAGTCAGAGGG + Intronic
1118226837 14:63908916-63908938 TTGATTATGATTCAAAAAGAAGG + Intronic
1118554929 14:67007826-67007848 TTAATGATGAATGAAAAAGAGGG + Intronic
1119776484 14:77252275-77252297 TTGCTGATGATTCAAAAAGAGGG + Intronic
1120164551 14:81182408-81182430 TTGATGAGGATTCTGAAAGAAGG - Intronic
1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG + Intergenic
1121893269 14:97619097-97619119 GTGATGATTAAGCAAGAAGAAGG - Intergenic
1122129394 14:99596341-99596363 CCGTTGAGGAATCAGGAAGAAGG + Intronic
1124135036 15:27027816-27027838 ATAATGATGTATCAGGAAAAGGG - Intronic
1124322953 15:28729271-28729293 TTGATGATGACTTTGGATGATGG - Intronic
1124356656 15:29000500-29000522 TGGAGGATGAACCAGCAAGACGG - Intronic
1124523873 15:30429832-30429854 TTGATGATGACTTTGGATGATGG - Intergenic
1124534793 15:30536383-30536405 TTGATGATGACTTTGGATGATGG + Intergenic
1124763856 15:32471224-32471246 TTGATGATGACTTTGGATGATGG - Intergenic
1124774771 15:32577827-32577849 TTGATGATGACTTTGGATGATGG + Intergenic
1125098104 15:35878030-35878052 TTGCTGATAAATTAGGAACATGG + Intergenic
1125426674 15:39555901-39555923 TGGATTAAGAATCAGGTAGAAGG + Intergenic
1125447104 15:39769784-39769806 TTTATCATGAATCAGGACAATGG - Intronic
1125879899 15:43185127-43185149 TGAATGATGAATAAGAAAGACGG + Exonic
1127051032 15:55084536-55084558 TTGTTGTTGAATCAAGATGAGGG - Intergenic
1127352055 15:58162890-58162912 TTGATTATGAATCAGCAATTTGG - Intronic
1127664654 15:61133834-61133856 CTGATGATGCAGTAGGAAGAAGG - Intronic
1128099974 15:64990347-64990369 GTGATGAAGGAACAGGAAGATGG - Intergenic
1128616329 15:69113479-69113501 TAAATGATGAGTCAGGATGAGGG + Intergenic
1128911940 15:71523561-71523583 ATGCTGATGTATTAGGAAGATGG + Intronic
1129261491 15:74370615-74370637 TTCGTGGTGAAGCAGGAAGATGG - Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129874692 15:78965990-78966012 TTGGTGTTGAATAAGGCAGAGGG + Intronic
1130367473 15:83253447-83253469 TTGATAATGAATGGGAAAGAAGG + Intergenic
1130391965 15:83464670-83464692 TTGCTGATGAATTGGGAATAAGG - Intronic
1130644616 15:85713288-85713310 TAGAAGATGAAGCAGGTAGAAGG - Intronic
1130772971 15:86943659-86943681 GTGATGAAGAAAAAGGAAGAGGG + Intronic
1131139816 15:89968077-89968099 ATGATGATGAAGAAAGAAGAGGG + Intergenic
1133686749 16:8172313-8172335 TTGATGATGAGTTAGGATGAAGG + Intergenic
1134883858 16:17772582-17772604 TGTATGAGGAGTCAGGAAGAAGG - Intergenic
1135910904 16:26559684-26559706 TTCATCATGCATCAGGAAGGGGG - Intergenic
1138317484 16:56082647-56082669 TTGTCTATGAACCAGGAAGAGGG - Intergenic
1139059549 16:63232143-63232165 GAGAGGATGAAGCAGGAAGATGG + Intergenic
1139717711 16:68826841-68826863 TTGTTGATGAATCATGGACAAGG + Intronic
1140321499 16:73956282-73956304 TGGATGATGGATGAGGGAGACGG + Intergenic
1141348125 16:83267300-83267322 TGAATGATAAAGCAGGAAGAGGG - Intronic
1142444733 16:90129431-90129453 TTGAGGTTAAAGCAGGAAGAAGG + Intergenic
1142462777 17:106035-106057 TTGAGGTTAAAGCAGGAAGAAGG - Intergenic
1142529668 17:571370-571392 TTAATGAGGAATCTGGATGAAGG + Intronic
1143244478 17:5471515-5471537 TTTTTGAGGAATCAGGAACAAGG + Exonic
1143983386 17:10890296-10890318 CTGTTGGTGAATCAGGAAGGGGG + Intergenic
1149135787 17:53361872-53361894 TTGCTGATAAATTAGAAAGAGGG - Intergenic
1150166130 17:62945301-62945323 GTGATGAGGAATGAGGAAGCTGG - Intergenic
1150961166 17:69913960-69913982 ATGATGATGATGCAGGAGGATGG + Intergenic
1152527659 17:80898370-80898392 TAGAGGATTAATCAGGAAAAAGG - Intronic
1152992093 18:372839-372861 GTCATGATGACTCAGGAAGAGGG + Intronic
1155292297 18:24354401-24354423 TTGAGGGTGAAGCAGGAACACGG + Intronic
1155421839 18:25664835-25664857 TTGGGGATTACTCAGGAAGAGGG - Intergenic
1156844362 18:41647057-41647079 TTGATGATAACACAGGAAGAGGG - Intergenic
1157630164 18:49087061-49087083 TGGAAGATAAAGCAGGAAGATGG + Intronic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158443854 18:57501598-57501620 TTGATGTTCAATCAGGCAAAAGG + Intergenic
1158923544 18:62224342-62224364 TTAATGATGAAAGATGAAGATGG + Intronic
1159199501 18:65166400-65166422 ATGATGATTACTCAGCAAGATGG + Intergenic
1161619082 19:5289030-5289052 TGGATGATGTATCAGGAATAGGG + Intronic
1164558399 19:29270711-29270733 TTGATGCTGAGCCAGAAAGATGG + Intergenic
1164742286 19:30584675-30584697 ATGATGATGAATCAGGGAGGAGG - Intronic
1164751693 19:30660177-30660199 TTGAAGATAAACCAGGCAGAAGG + Intronic
1166415842 19:42594536-42594558 GTGATGATTAACCAGGAATATGG + Intronic
1167698870 19:51030687-51030709 TGGAGGATGAATCAGGGAAAGGG - Intronic
1167832649 19:52038616-52038638 TAGATTTTGAATTAGGAAGATGG - Intronic
1168517471 19:57019491-57019513 TGACTCATGAATCAGGAAGATGG - Intergenic
925145826 2:1582741-1582763 TTAAAGATGAAACTGGAAGATGG - Intergenic
925342074 2:3144865-3144887 GTTATTATGAATCAGGAAGTTGG - Intergenic
926525679 2:13977114-13977136 TTGATGATGCATGAGAGAGATGG + Intergenic
926592457 2:14754067-14754089 ATGATGATGTAGCAGGAAGAAGG - Intergenic
927075623 2:19574095-19574117 ATGATGATGAATGAAGATGAAGG - Intergenic
927082694 2:19646185-19646207 TTGAACATGATTCAGGAAGCAGG - Intergenic
928774545 2:34744269-34744291 TTGCTTATTAATCAGAAAGAAGG + Intergenic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
930649037 2:53946227-53946249 TTGGTTATGAAGCAGCAAGAAGG + Intronic
930854315 2:55996316-55996338 TTGATGATGAATAATGAATATGG + Intergenic
931177464 2:59868391-59868413 TTGATGCTGATGCAGGAAGTAGG + Intergenic
931553568 2:63473979-63474001 TAGATGATAAAACAGGAATAAGG - Intronic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
936659674 2:114528819-114528841 TTGATGATGAATCAGGAAGAAGG - Intronic
937624848 2:124032869-124032891 TAGAAGATGCATCAGGATGATGG - Intronic
938986528 2:136581678-136581700 CAGATGATGATTCAAGAAGATGG - Intergenic
939442030 2:142261784-142261806 TTGTTGATGTGTAAGGAAGAAGG + Intergenic
940133421 2:150409669-150409691 TTGACCATGAATGAGAAAGAAGG - Intergenic
940579113 2:155553590-155553612 CTGAGGATGAAGCAGGAACATGG + Intergenic
940646651 2:156399162-156399184 TTGATTCTGAATCAGGAAATGGG - Intergenic
941229941 2:162899353-162899375 ATGATAATCAGTCAGGAAGATGG - Intergenic
943028417 2:182656492-182656514 TGGATGAGGTATCAGGAATATGG + Intergenic
943118390 2:183704085-183704107 TTGATGAGGATTCAGGTAAAAGG + Intergenic
943951947 2:194141432-194141454 TTGAAGAAGACTCAGGAACAGGG - Intergenic
945184218 2:207123319-207123341 TTGATGAAAAATCAGGATGCTGG + Intronic
945915849 2:215703153-215703175 CTGATGTTGAATAAGGGAGAAGG + Intergenic
946030807 2:216703311-216703333 TTGTTGGTGAATGAGGAAGGAGG + Intergenic
946370085 2:219275906-219275928 TTAATAATAAATCTGGAAGATGG + Intronic
946465935 2:219912238-219912260 TTGCGGATAAATCAGGATGATGG + Intergenic
946913914 2:224495959-224495981 TTAAAAATGAAACAGGAAGATGG - Exonic
946983019 2:225239240-225239262 CTCATGATGAATAAGGAAGTAGG + Intergenic
947716658 2:232343135-232343157 TTGATGATGAGCCAGGTTGAGGG - Intronic
947944100 2:234084836-234084858 TTGCTGATGGATCAGGATGTTGG + Intergenic
1169803746 20:9538285-9538307 TAGAGGATGAATTAGCAAGAGGG - Exonic
1171966956 20:31537787-31537809 TGGATGATTAAACAGGGAGAAGG + Intronic
1172991869 20:39042581-39042603 TTTGTGATGAAACAGGATGATGG + Intergenic
1173714059 20:45186711-45186733 TTGTTGCTGAAACAGTAAGAAGG + Intergenic
1174496823 20:50951338-50951360 GTAATGATGATACAGGAAGATGG + Intronic
1174837917 20:53875812-53875834 TTGATGAGGAAGCAGGAACAGGG - Intergenic
1175283324 20:57820034-57820056 TTGCTGCTGAACCAGGTAGAAGG + Intergenic
1175301294 20:57944876-57944898 TTCAGGAGGAATCTGGAAGAAGG - Intergenic
1175682482 20:61000213-61000235 TTGATTATGAGTCAGGCAGTCGG + Intergenic
1177416965 21:20806513-20806535 TTGATGAGGAATGATGAAGGCGG + Intergenic
1178040938 21:28640317-28640339 CTCATGATGGCTCAGGAAGAGGG + Intergenic
1178583276 21:33853572-33853594 ATGATGAGGAATCGGAAAGAAGG - Intronic
1178618456 21:34153831-34153853 TTGATGATGCAGCAGGGTGAGGG - Intergenic
1180887584 22:19258155-19258177 TTCATGAAGAACCATGAAGAGGG + Intronic
1184926919 22:47648883-47648905 TTGATGATGTAACAGCAACAAGG + Intergenic
951615929 3:24544035-24544057 TGGAAGATGAATCAAGTAGAAGG + Intergenic
952261899 3:31748101-31748123 TAGATGATGAACCAGGTGGAAGG - Exonic
954235865 3:49256770-49256792 TTGGTGATTAAACAGAAAGATGG + Exonic
956323414 3:68024651-68024673 TTGCTGATGGTTCAGGAAGATGG + Intronic
956365750 3:68500766-68500788 TTTATGATTAATCAAGATGAAGG + Intronic
957368842 3:79263923-79263945 CTGATGATGAATCGGATAGAAGG - Intronic
959232924 3:103680169-103680191 ATGATAATGAAACAGGAAGAAGG - Intergenic
959491948 3:107000957-107000979 TTGCTTATGAAACAGGAAGGAGG - Intergenic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
961796881 3:129415494-129415516 TTGAGGATGAAACTGGAAGCAGG - Intronic
963472642 3:145761988-145762010 TTGATGAGGAATCAGGTGGGTGG - Intergenic
964818731 3:160746187-160746209 TTTATGGGGAATGAGGAAGATGG + Intergenic
965907198 3:173723844-173723866 TTAATGATGATTCAGATAGATGG + Intronic
966884167 3:184366206-184366228 TTGATGAGGAAACAGGCTGAAGG - Intronic
966910409 3:184556479-184556501 TTCATGTTTAATTAGGAAGATGG - Intronic
968365352 3:198181561-198181583 TTGAGGTTAAAGCAGGAAGAAGG + Intergenic
969633231 4:8350677-8350699 TAGATGGTGAAGCAGGAAGGGGG - Intergenic
970780062 4:19726443-19726465 TTGATGATAAAAGAGGAAAAAGG + Intergenic
972602226 4:40582738-40582760 TTGAAGAAGAAACAGGTAGAGGG - Intronic
973216200 4:47672011-47672033 TACATGATGAATGAGGAAGCTGG + Intronic
975474298 4:74805283-74805305 TTGATAATGAATCTAGAAGCTGG - Intergenic
978024396 4:103854000-103854022 TGGATTATGTATCAGGAATATGG - Intergenic
979254388 4:118596728-118596750 TTGAGGTTAAAGCAGGAAGAAGG + Intergenic
979334576 4:119449304-119449326 TTGAGGTTAAAGCAGGAAGAAGG - Intergenic
979422404 4:120521465-120521487 TTGAAGATGACACAGAAAGATGG + Intergenic
979491573 4:121334416-121334438 GTGATTATGAAACAGGAAGTGGG - Intronic
980824203 4:138053751-138053773 TGGATGATGCATCAGTAGGAGGG - Intergenic
980970097 4:139559469-139559491 TTGGTCTTGAATCAGGAGGAGGG + Intronic
981787100 4:148491802-148491824 TTCAGGAGGAATCATGAAGAGGG - Intergenic
981826514 4:148948211-148948233 TTGAAGATGAATTAGGGGGAGGG + Intergenic
982140680 4:152314705-152314727 TTTATTATGAATCAGGAATGAGG - Intergenic
987239609 5:15981637-15981659 AAGATGATGACTCCGGAAGAGGG + Intergenic
987612606 5:20225938-20225960 TTTATGATCTTTCAGGAAGACGG + Intronic
987800723 5:22693088-22693110 TGGATGCTGAAGCAGGAAGATGG - Intronic
989734907 5:44691970-44691992 TTGATGTTGCATCATGCAGAGGG - Intergenic
990516916 5:56539023-56539045 TTGATGATGAGAAAGGATGAAGG + Intronic
993775421 5:91988905-91988927 ATGATGATGAAACAGCATGACGG + Intergenic
995144068 5:108766804-108766826 TTTATGATAAACCAGGAAGTTGG + Intronic
995420097 5:111955000-111955022 ATGAAGATGCATGAGGAAGAAGG + Intronic
995432155 5:112092127-112092149 TTAAAGATGAATCATTAAGAAGG - Intergenic
995486982 5:112649086-112649108 TTAATTATGACTCAGGCAGAAGG - Intergenic
996116570 5:119626881-119626903 TTGATGATGAATCTGGTGGTGGG + Intronic
997035168 5:130181699-130181721 ATGATCAAGAATCAAGAAGAGGG - Intronic
997383422 5:133453770-133453792 CTCATGACTAATCAGGAAGAGGG + Intronic
997430788 5:133839418-133839440 TGCATTATGAATCTGGAAGAGGG - Intergenic
998725721 5:145011619-145011641 ATGATGATGACCAAGGAAGAAGG - Intergenic
1001000097 5:167997386-167997408 TAGAAGATGATTCAGGAAGCAGG - Intronic
1001023744 5:168206030-168206052 TTGCTGATGGATCAGGTATAAGG + Intronic
1001738305 5:174026051-174026073 TTCATGATTAAATAGGAAGAAGG + Intergenic
1001742359 5:174064593-174064615 GTGATGAAAAAGCAGGAAGAAGG - Intronic
1002447033 5:179296099-179296121 GTGATGGTGAAGCAGGAGGATGG + Intronic
1002702095 5:181131387-181131409 TGGAAGCTGGATCAGGAAGAGGG - Intergenic
1003080095 6:3014824-3014846 TATTTGATGAATCAGGAAAAAGG + Intronic
1004094976 6:12544584-12544606 TTGATGATGGATAATTAAGAAGG - Intergenic
1006220872 6:32490165-32490187 ATCATGATGAATGAGGAACAGGG - Intergenic
1006456838 6:34136854-34136876 TTGATCATGTAACAGGAACAAGG + Intronic
1007054171 6:38865324-38865346 TTGATTATAAGTCAGGAAGTGGG + Intronic
1007813999 6:44507243-44507265 ATGATGATGAAAGAGGAAGAGGG + Intergenic
1008805802 6:55426369-55426391 AGGATGATGAAGCAGAAAGATGG + Intergenic
1010655791 6:78509002-78509024 GAGATGATGAAACAGGAAGTAGG + Intergenic
1011105738 6:83778305-83778327 CTGATAATGAAAGAGGAAGAGGG + Intergenic
1011218126 6:85027239-85027261 TTGATGATGTATCAAGTAAAAGG + Intergenic
1011852521 6:91647720-91647742 TTGATGTTGATTGTGGAAGAGGG - Intergenic
1011852647 6:91649524-91649546 TTGATGTTGATTGTGGAAGAGGG - Intergenic
1011980835 6:93375881-93375903 GTGATCATGAATGAGGAAAATGG - Intronic
1012954597 6:105555188-105555210 TTGAGGATGAAGCAGGAACAAGG + Intergenic
1012995274 6:105966685-105966707 CTGATGATGAAGTGGGAAGATGG - Intergenic
1013600283 6:111697901-111697923 TAGAGGGTGAATGAGGAAGAAGG + Intronic
1013831136 6:114274014-114274036 TTGATGGTGTAACATGAAGAGGG + Intronic
1015706948 6:136098423-136098445 TTGATCATCAATCTAGAAGAAGG + Intronic
1017047739 6:150363368-150363390 TTGATGATGGACCAGCCAGAAGG + Intergenic
1018297502 6:162364743-162364765 GTGAAGGGGAATCAGGAAGAGGG + Intronic
1019896527 7:3987735-3987757 TGGAAGGTGAGTCAGGAAGAGGG - Intronic
1019932132 7:4230596-4230618 TGGATGATTACTTAGGAAGATGG + Intronic
1020027984 7:4912654-4912676 GTGGTGATGACTGAGGAAGAGGG + Intronic
1020712326 7:11623449-11623471 TAGATGATGAATAAGGAAGGAGG - Intronic
1020827972 7:13055683-13055705 ATGATTATGGATCAGGAAGGTGG - Intergenic
1021295909 7:18905799-18905821 TTGATGAGGGAGAAGGAAGAAGG - Intronic
1021587365 7:22223581-22223603 TTGATGATGCAGGAGGGAGAAGG + Intronic
1021929302 7:25563715-25563737 TTTAAGATCAATCTGGAAGAAGG + Intergenic
1023462743 7:40418424-40418446 GTGAGGGTGAATCAGGAACATGG - Intronic
1024069481 7:45774375-45774397 TTGAGGTTAAAGCAGGAAGAAGG + Intergenic
1029304310 7:99607504-99607526 TTGAAGATGAGTCAGAAAGGAGG + Intronic
1030015439 7:105215386-105215408 TTGATGATGAAAATGGAAAATGG + Intronic
1030244019 7:107360993-107361015 TTGATGATTTATTAGGAGGATGG - Intronic
1030400624 7:109044488-109044510 TTTATGATGGATAAAGAAGAGGG - Intergenic
1031462437 7:122068128-122068150 TTGAGAATGAATCAGGGAAAGGG - Intergenic
1031512950 7:122671374-122671396 TAATTAATGAATCAGGAAGAGGG + Intronic
1031587999 7:123555998-123556020 ATGATGGTGACTGAGGAAGAGGG + Intronic
1032684561 7:134219939-134219961 GTGATGAAGAAACAGGAAGCTGG - Intronic
1032859891 7:135867070-135867092 ATGAGGCTGAAGCAGGAAGATGG - Intergenic
1034294987 7:149964243-149964265 TTTTTGATGAATAAGGAATAGGG + Intergenic
1034811074 7:154132703-154132725 TTTTTGATGAATAAGGAATAGGG - Intronic
1036568784 8:9961340-9961362 GTGATGAGGCATCAAGAAGAGGG + Intergenic
1037106356 8:15112851-15112873 TTGATCATGAATCTGTAAGTAGG - Intronic
1039178603 8:34838011-34838033 CTCATGATCCATCAGGAAGAGGG - Intergenic
1040288735 8:46113564-46113586 TGGATGATGAGGCAGGCAGATGG - Intergenic
1040300708 8:46186599-46186621 TTGATGTTGAGGCAGGCAGAGGG - Intergenic
1040307534 8:46219969-46219991 ATGATGTTGAAGCAGGCAGAGGG + Intergenic
1040800899 8:51338740-51338762 TTGAGGATGAATCAACAAGAAGG - Intronic
1041131167 8:54702582-54702604 TTGCTGATGAATCAGGGTGGTGG + Intergenic
1041969443 8:63720617-63720639 TTGAAGATGCATGAGGGAGAAGG + Intergenic
1041991287 8:63995043-63995065 TTGAAGATGAATAAGTATGAAGG + Intergenic
1043812268 8:84755091-84755113 GTCAAGATGACTCAGGAAGAGGG + Intronic
1045062698 8:98423096-98423118 TTCTTGATGCATCAGGAGGAAGG + Intronic
1046304219 8:112341548-112341570 GTGGTGCTGAATAAGGAAGATGG + Exonic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1046537937 8:115539897-115539919 TCGATGATGGATCATGTAGACGG - Intronic
1048774248 8:137927915-137927937 TTGAGGATAAATCAGTAAAATGG - Intergenic
1048820019 8:138372017-138372039 GTGATGACGGCTCAGGAAGAGGG + Intronic
1050716807 9:8537956-8537978 TTGATTATGAATCACAAAAAGGG - Intronic
1052035112 9:23671747-23671769 TTGATGTTGAAACTGGATGAAGG - Intergenic
1052587944 9:30453038-30453060 TTGACTATGAATCAGGAAGTGGG - Intergenic
1054800029 9:69338781-69338803 TTGATGATGATACAGAAATAAGG - Intronic
1055609119 9:78003455-78003477 GAGATGACGAACCAGGAAGAAGG + Intronic
1055800060 9:80024990-80025012 TGGATTATGAATCTGCAAGAGGG - Intergenic
1055904907 9:81281902-81281924 ATGAAGATGCATCATGAAGAAGG - Intergenic
1056164496 9:83928136-83928158 TTGAGAAGGAATGAGGAAGATGG + Intergenic
1056625465 9:88249493-88249515 CTGACTATGAATCAGGAAGCAGG + Intergenic
1056660111 9:88536867-88536889 TTGATAATGAATCTCCAAGATGG + Intronic
1057327044 9:94074929-94074951 TTGATGATGGATGAGAACGAAGG + Intronic
1062749719 9:138244428-138244450 TTGAGGTTAAAGCAGGAAGAAGG + Intergenic
1186090840 X:6047505-6047527 TGGATGATGGAGTAGGAAGATGG + Intronic
1186757423 X:12687347-12687369 TTGATAATGAATGAGGAAAAAGG - Intronic
1187661913 X:21556930-21556952 TTGATGATGCAGGAGAAAGAAGG + Intronic
1187678290 X:21740107-21740129 ATGATATTGACTCAGGAAGAAGG + Intronic
1187963350 X:24586917-24586939 TTAATTATGAATGAGGAAAATGG + Intronic
1189141156 X:38607775-38607797 TTTCTGCAGAATCAGGAAGAAGG - Intronic
1189686070 X:43564763-43564785 TAGATGTTGAACCAGGAGGAGGG - Intergenic
1189968791 X:46397103-46397125 ATGATGATGATTTTGGAAGAGGG - Intergenic
1191885639 X:65885042-65885064 CTGAGGATGCAGCAGGAAGATGG + Intergenic
1195106239 X:101604138-101604160 TTGATGGTGAATAATGAAAATGG + Intergenic
1195638130 X:107141655-107141677 TAGAAGACGAAACAGGAAGAAGG + Intronic
1196071631 X:111529999-111530021 ATGATGCTGAATCAGAAAAAGGG + Intergenic
1196930050 X:120673088-120673110 TTGATGTTGAATCTGAAAGTTGG + Intergenic
1198971027 X:142280094-142280116 TAGATGATGTATGAGGAAAATGG + Intergenic
1199482876 X:148317056-148317078 TTCCTGATAAAGCAGGAAGAGGG + Intergenic
1199517497 X:148694380-148694402 TTGATGATGCCTTATGAAGAAGG + Intronic
1199550840 X:149059820-149059842 TTGACTATGAATCAGGGAGCAGG - Intergenic
1200812357 Y:7499272-7499294 ATGATGAGGAAGAAGGAAGAAGG - Intergenic
1201789321 Y:17821203-17821225 TTGATGATAAATTATGAGGAAGG - Intergenic
1201812232 Y:18084784-18084806 TTGATGATAAATTATGAGGAAGG + Intergenic
1202334731 Y:23795865-23795887 TTGATGATAAATTATGAAGTAGG - Intergenic
1202536036 Y:25874194-25874216 TTGATGATAAATTATGAAGTAGG + Intergenic