ID: 936662725

View in Genome Browser
Species Human (GRCh38)
Location 2:114560180-114560202
Sequence AAGCTATTATTGGTGAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936662721_936662725 20 Left 936662721 2:114560137-114560159 CCTTAGAAATTGTCTAATCCATA 0: 1
1: 0
2: 1
3: 16
4: 215
Right 936662725 2:114560180-114560202 AAGCTATTATTGGTGAACCATGG 0: 1
1: 0
2: 0
3: 7
4: 97
936662723_936662725 2 Left 936662723 2:114560155-114560177 CCATATTGTGACTGGCATTATGA 0: 1
1: 0
2: 1
3: 11
4: 131
Right 936662725 2:114560180-114560202 AAGCTATTATTGGTGAACCATGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936662725 Original CRISPR AAGCTATTATTGGTGAACCA TGG Intronic
912498038 1:110103860-110103882 AAGCTCATATTGGTGACCCCTGG + Intergenic
913425126 1:118720213-118720235 AAGATATTGTTGGAGAAGCATGG - Intergenic
916482863 1:165231041-165231063 AAGCTCTAGTTAGTGAACCAGGG - Intronic
918748156 1:188233210-188233232 AAGCTAGTGTTTGTCAACCAGGG - Intergenic
1064842222 10:19606405-19606427 AAGCTGTTCTTGTTGAACCTGGG + Intronic
1066134866 10:32435162-32435184 AAGCTATTGTTGGCTGACCATGG + Intergenic
1075164320 10:120053271-120053293 AAGCTATTATCTGTGGAGCAGGG + Intergenic
1080051842 11:27865925-27865947 AAACTATTATTGGTGCATCATGG - Intergenic
1080227798 11:29979693-29979715 AAGCTATTTATGGTGAAGGAAGG - Intergenic
1080840674 11:35980955-35980977 AAGCTATTATTGGGGACCCTCGG + Intronic
1084525025 11:69691710-69691732 AAGCTCTGATTGGTGAGCAAGGG - Intergenic
1088541673 11:110919922-110919944 AAGCCTTTATAGGTGAATCATGG + Intergenic
1089737392 11:120559224-120559246 AAGCTAGTCCTGGGGAACCATGG - Intronic
1089875700 11:121719706-121719728 ATGCTGTCATTGGAGAACCAGGG - Intergenic
1091164589 11:133463762-133463784 AAACTTTTTTTGGAGAACCAAGG - Intronic
1091683252 12:2541811-2541833 AAGCTATTTTGGGTGACCAAAGG + Intronic
1095194156 12:39293033-39293055 AACCTAATCTTGATGAACCATGG - Intergenic
1097447721 12:59693414-59693436 AAACTATTAGTGATGATCCATGG - Intronic
1101290966 12:103368674-103368696 ATGATATTATTGGTGAACACTGG + Intronic
1101720090 12:107343455-107343477 AAGTTATTATTGGTCAAATATGG - Intronic
1102020971 12:109682621-109682643 TGGCAATTACTGGTGAACCAAGG - Intergenic
1106281008 13:28271150-28271172 ATGCTAGAATTTGTGAACCATGG - Intronic
1107379681 13:39842835-39842857 CAGCTATCATTGGTGAAATATGG + Intergenic
1109260894 13:60144023-60144045 AAACCATTATCGGTGACCCAAGG - Intronic
1114197488 14:20491607-20491629 AAGGTAATATTAGTGATCCAAGG - Intergenic
1114617077 14:24074075-24074097 AAGCCATTATTGCTGAAGAATGG + Exonic
1115964331 14:38870239-38870261 AATTTATAATTGGTGAATCAAGG - Intergenic
1117547165 14:56803175-56803197 GAGCTATGATTGGTGTACGAGGG + Intronic
1119165675 14:72490427-72490449 CAGCTCTTATTGGTGAAGCCTGG + Intronic
1121406417 14:93721795-93721817 GAGCTATTAATGATGAAGCAGGG + Intronic
1124000145 15:25751752-25751774 AAGCTATTATTGATTAATAATGG + Intronic
1124356270 15:28997025-28997047 AAGCCATTATTTGTAAAGCAAGG + Intronic
1124942303 15:34229348-34229370 AAGTTATTATTTTTGAAACAGGG + Intronic
1126305029 15:47246232-47246254 AAGCAATTAGTGGGGAGCCATGG + Intronic
1126610843 15:50528024-50528046 AAACTATTATTGGTTAATTAAGG - Intronic
1128077384 15:64836117-64836139 TAGCTATTATTAATGAGCCAGGG - Intergenic
1131550023 15:93349404-93349426 AAGCAATTACTGGTGAACAATGG + Intergenic
1146416064 17:32634420-32634442 AACCTATCACTGGTGACCCATGG + Intronic
1149957764 17:61072064-61072086 AAACTATTTTTGGTGAAAAAAGG + Intronic
1151298155 17:73200948-73200970 AAGCCATTATTGATGAACATGGG - Intronic
1156975324 18:43215000-43215022 AAGCTATTAATGTTGCAACAGGG - Intergenic
1159768341 18:72518105-72518127 AAGCTATTATTTGTAAAAGAGGG - Intergenic
1160000447 18:75014856-75014878 TAGCTATTATTGTTGGAACATGG - Intronic
1161560640 19:4970657-4970679 AAGCTATTATTGGAGAATTAGGG - Intronic
1164750578 19:30651547-30651569 AAACTATCATTTGTGAACCACGG - Intronic
1167198656 19:48048751-48048773 AAGCTGTTATTGCTGGATCAGGG - Intronic
1167866417 19:52332294-52332316 AAGCTATTATGCGTAACCCATGG + Intergenic
1168067689 19:53928097-53928119 AGGTTATTTTTGGAGAACCAGGG + Intronic
929131269 2:38575497-38575519 AAGCTTTCATAGTTGAACCATGG - Intronic
934844269 2:97652146-97652168 AAGTTATTATTTTTGAAACAGGG + Intergenic
935734176 2:106093349-106093371 AACATATTCTTGGTTAACCATGG - Exonic
936662725 2:114560180-114560202 AAGCTATTATTGGTGAACCATGG + Intronic
937948595 2:127365602-127365624 AAGCTTTTGGTGGTGAACCTGGG - Intronic
939782742 2:146469213-146469235 AAACTACTATTGGAGAACAAAGG - Intergenic
942086355 2:172447682-172447704 AAGCAAGTGTTGGTGGACCAAGG + Intronic
944050332 2:195460428-195460450 AAGCAATTATTGGTGACCTGTGG - Intergenic
945542332 2:211104419-211104441 AAGTTATTTTTGGTAAACAATGG + Intergenic
946585216 2:221178479-221178501 AGGCTACTGTTGGTGAATCAAGG - Intergenic
1170534125 20:17323540-17323562 AAGCTATTAATGTGGAGCCAGGG + Intronic
1177109997 21:17014887-17014909 AGGATATTTTTGGTGAACAAAGG - Intergenic
1177735020 21:25078292-25078314 AAAGTATTTTTGGTGATCCAAGG + Intergenic
1178201657 21:30414263-30414285 AACATCTTTTTGGTGAACCACGG + Intronic
1178783883 21:35634244-35634266 AAGATATCGTTGGTGAATCACGG + Intronic
950268801 3:11596486-11596508 TAGTTCTTACTGGTGAACCAGGG + Intronic
950759523 3:15208339-15208361 GAGCTATTATTAGTGGGCCACGG - Intronic
954892244 3:53941499-53941521 CAGCTATTCATGGTTAACCATGG - Intergenic
955019628 3:55106803-55106825 AGGCTGTTTTTGGTGAGCCAAGG - Intergenic
955800273 3:62679309-62679331 AAGGTATTATAGGTGAACTAGGG + Intronic
957968296 3:87349837-87349859 AAGCTATAATTTGGGAAACATGG + Intergenic
961225349 3:125239895-125239917 AAGTGATTAATGGTGACCCAGGG + Intronic
961597908 3:128033827-128033849 AAGCTGTTTTTGATGAACCGTGG - Intergenic
961599194 3:128046002-128046024 AAGCTATCATTGGAGAAGCTAGG - Intergenic
964569629 3:158097540-158097562 AAGCTGAAATTGGAGAACCAAGG - Exonic
965383703 3:168021215-168021237 AAGATATTATGGGTGTGCCAGGG + Intronic
975074082 4:70182912-70182934 ATGCTATTATTGGTGCACTAGGG - Intergenic
976054829 4:81051690-81051712 CAGATATTATTGGTGATGCAGGG + Intronic
980347842 4:131645968-131645990 AAGCTATAATTAATGAAGCATGG + Intergenic
981089972 4:140722155-140722177 AAGCTATTATGGTTGAAGCTTGG - Intronic
985876156 5:2597922-2597944 AAGCTATTAATGGGAAAACAAGG + Intergenic
988736871 5:34031383-34031405 AACCTATGAATGGTAAACCACGG - Intronic
990525320 5:56620119-56620141 AAACTTTTACAGGTGAACCAGGG - Intergenic
991434834 5:66587210-66587232 AAGCTATTATTGTTGGGGCAGGG - Intergenic
991771418 5:70044519-70044541 AAGCTCTGATTGGTGAGCGATGG + Intergenic
991850709 5:70919937-70919959 AAGCTCTGATTGGTGAGCGATGG + Intergenic
1003826337 6:9956381-9956403 TAGCTATGAATGGTCAACCAAGG - Intronic
1005938475 6:30543110-30543132 AAGCTGGTCTTGGTGAATCAGGG - Exonic
1015481529 6:133716458-133716480 AAGCTCTGATTGGTGAATGATGG + Intergenic
1020339763 7:7097223-7097245 AAGCTCTGGTTGGTGAACGATGG + Intergenic
1022349118 7:29550298-29550320 AATCTATTTTTGGTTAACCTTGG - Intergenic
1024142411 7:46475583-46475605 AAGCTATGATTTTTTAACCAAGG - Intergenic
1024439335 7:49397836-49397858 AAAGTATGTTTGGTGAACCAGGG + Intergenic
1027770971 7:82405836-82405858 AAGCTATGATTTCTGAGCCAGGG - Intronic
1028792001 7:94864245-94864267 AAGCTATTAATAGTGAGCCTGGG - Intergenic
1028855457 7:95587258-95587280 AAGCTAAAAATGGTGAAACAAGG - Intronic
1033990741 7:147283011-147283033 AAGAAATTATTGGTGGACTATGG - Intronic
1039989205 8:42473684-42473706 ATTCTATTATTGGAGAGCCAAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1044974052 8:97645756-97645778 AAGATATAATGGGAGAACCATGG - Intronic
1045398842 8:101790747-101790769 GAGCAATTATTGTTGTACCAAGG - Intronic
1047218988 8:122903470-122903492 AAGGTATTATTGGAGAACGTGGG + Intronic
1058787734 9:108406711-108406733 AAGATATTCTAGGAGAACCATGG + Intergenic
1060310787 9:122459548-122459570 AAGCTTTTATTGGTTAAAAAGGG - Intergenic
1192732497 X:73815319-73815341 AAGCTATTTTTGTTGAGACAGGG - Intergenic
1196975224 X:121151744-121151766 AACATATTTCTGGTGAACCATGG + Intergenic
1202063229 Y:20910203-20910225 AATGTATTTCTGGTGAACCAGGG + Intergenic