ID: 936662734

View in Genome Browser
Species Human (GRCh38)
Location 2:114560209-114560231
Sequence CTGTGGGAGTTGGGAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1015
Summary {0: 1, 1: 0, 2: 9, 3: 85, 4: 920}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936662734 Original CRISPR CTGTGGGAGTTGGGAGGAGA AGG Intronic
900106524 1:983794-983816 CTGTGAGAGGTGGGAGGTGGGGG + Intergenic
900623227 1:3596726-3596748 CTGTAGGAGCAGGGTGGAGACGG - Intronic
901456528 1:9366223-9366245 CTGGGGCAGTTGCGGGGAGAAGG + Intronic
901503923 1:9672018-9672040 CAGGGGGAGTGGGTAGGAGATGG + Intronic
902087097 1:13871809-13871831 TTCTGGGAAGTGGGAGGAGATGG + Intergenic
902380811 1:16051455-16051477 CTGTGGGAGTGGGGAGCCCAGGG - Intronic
902399357 1:16149679-16149701 CTTTGGGAGTTGGGTGGCGGGGG - Intronic
902404765 1:16176576-16176598 CAGTGGGAGCTTGGAGGAGGAGG - Intergenic
902559150 1:17266269-17266291 CCCTGGGAGTTAAGAGGAGAAGG + Intronic
902769538 1:18637680-18637702 CTGTGGGGGCTGGGCGTAGATGG - Intronic
902771991 1:18650476-18650498 CTGTGGGGGATGGAAGGAGCAGG + Intronic
902822993 1:18954928-18954950 CTCAGGGAGTGGGGAGAAGAGGG + Intronic
902883174 1:19386329-19386351 ATGTTTGAGTTGGGAGGAGGAGG - Intronic
902969023 1:20033297-20033319 GTGTTGGAAGTGGGAGGAGAGGG + Intronic
903110751 1:21130987-21131009 CTTTGGGATTTGGGAGGTCAAGG + Intronic
903147420 1:21383549-21383571 GAGTGGGAGTGGGGAGGAGCGGG - Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903276166 1:22223357-22223379 CCCTGGGAGTTGGGTGAAGAGGG + Intergenic
903474453 1:23609824-23609846 ATCTGGGAGGTGGGAGGTGATGG - Intronic
903517144 1:23918984-23919006 CTGCGGGAAATGGGAGGAAACGG + Intergenic
903963363 1:27071124-27071146 CGGAGGGAGTTGGGAGCCGAGGG - Intergenic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904377660 1:30091907-30091929 CAGTGGGAGGTGGCAGGAGTGGG + Intergenic
904418764 1:30378208-30378230 CAGTGGGTGGTGGGAAGAGATGG + Intergenic
904671774 1:32171359-32171381 AGGTGGGAGGTGGGAGGGGAAGG + Exonic
904969007 1:34404450-34404472 CTGGGAGAGTTTGGAGGAGCAGG - Intergenic
905013557 1:34762455-34762477 CTGTGTGTGTTGGGGGGTGATGG - Exonic
905036757 1:34923700-34923722 CTGTGGGTGCTGGGAGGTGGTGG - Intronic
905223699 1:36466201-36466223 CTATGGAGATTGGGAGGAGAGGG + Exonic
905508504 1:38499938-38499960 TTGTGGGTGTTGGGAGGCCAGGG - Intergenic
906061659 1:42953062-42953084 ATTTGGGAGTGGGGAGGAAACGG - Intronic
906727492 1:48054729-48054751 CTGTGGGAGCTGGGGGTCGAGGG + Intergenic
906795002 1:48689684-48689706 CTGTGTGTGTTGGGATGAGATGG + Intronic
907517226 1:55000441-55000463 CTGTGTGAGTTAGGAGGGGGGGG + Intronic
907559720 1:55377567-55377589 GTATGGGAGCTGGGAGGTGAGGG - Intergenic
907566632 1:55440919-55440941 CTGGGGCTGTTGGGAGGTGAGGG + Intergenic
907576350 1:55529337-55529359 GTGTTGGGGATGGGAGGAGAGGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907787984 1:57632629-57632651 GTGTGAGAGTTGTGAGGAGAAGG + Intronic
908162354 1:61422795-61422817 ATGAGGGAGTGGGGTGGAGAGGG - Intronic
908178823 1:61583803-61583825 ATTTGGGAGTGGGGAGGCGAGGG + Intergenic
908250729 1:62263656-62263678 CTGTGTGAGGGGGAAGGAGAGGG - Intronic
908360694 1:63366529-63366551 CTGTAGGAGTTAGGAGAAGAGGG - Intergenic
908777336 1:67653249-67653271 CAGTGGAAGTGGGGAGGAGTAGG - Intergenic
908919550 1:69172703-69172725 TTCTGGGAGGTGGGAGAAGAGGG + Intergenic
909190399 1:72542464-72542486 CTGTGGGACATGGGAGCAGAGGG - Intergenic
909269149 1:73600815-73600837 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
909449667 1:75784518-75784540 CTGTGTGTGTGGCGAGGAGAGGG + Intronic
909458862 1:75884485-75884507 TTCTGGGAGTTGGGAGGTAAGGG - Intronic
910263727 1:85316250-85316272 CCTTCGGAGTTGGGAGGGGAAGG + Intergenic
910939197 1:92515025-92515047 CAGGGGGAGTTGGGGAGAGAAGG - Intronic
911060998 1:93747787-93747809 CTGGGGGAAGTGGCAGGAGATGG - Intronic
911213268 1:95164994-95165016 ATGTGGGAGCTGGGAAAAGACGG - Intronic
911550176 1:99269072-99269094 CTGTGGGGGTTGGGGGGCTAGGG - Intronic
912084535 1:105982273-105982295 CTGGGGGAGCTGTGAGAAGAGGG + Intergenic
912929119 1:113940602-113940624 CTGCAGGAGCTGGGAGGAGGAGG - Exonic
913322592 1:117599641-117599663 ATGTGTGTGGTGGGAGGAGAGGG - Intergenic
913679620 1:121176803-121176825 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914031454 1:143964450-143964472 CAATGGGAGTTGAGAGGAGGAGG - Intronic
914157993 1:145103514-145103536 CAATGGGAGTTGAGAGGAGGAGG + Intronic
914240194 1:145848019-145848041 CTGTGGTAGTTGGGAGGATTCGG + Intronic
914492110 1:148158800-148158822 CTGGGGGAGTGGGGCGGGGAGGG - Intergenic
914917985 1:151830094-151830116 ATGTGGGGGTTGGGAGTAGGGGG + Intronic
915021052 1:152778637-152778659 CTGGGGGATTTCTGAGGAGAAGG + Intronic
915243609 1:154541300-154541322 TGGTGGGGGTTGGGAGAAGAGGG + Intronic
915247283 1:154565397-154565419 CTGGGGGATTTGAGAAGAGAAGG + Intergenic
915253086 1:154604414-154604436 CAGTGGGCCTTGGGTGGAGAAGG - Intronic
915292882 1:154898095-154898117 GTGTGGGAGTTGTGGGGAGGAGG - Intergenic
915444499 1:155967037-155967059 AAGAGGGAGGTGGGAGGAGAGGG - Intronic
915899260 1:159834646-159834668 ATGGGGGATTTGGGAGGTGATGG - Exonic
915915991 1:159941390-159941412 CTGAGGGAGTTGGGACCTGAGGG - Intronic
916481846 1:165221384-165221406 TGGGGGGAGTTGGGGGGAGACGG - Intronic
916581648 1:166114647-166114669 TAGTGGGAGTAGGGAGGAGGTGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916611797 1:166398700-166398722 CTGTGGGAGGTGGGATAGGAGGG - Intergenic
916651596 1:166839423-166839445 CTGAGGGTGTTGGGAGGCGAGGG - Intergenic
916829287 1:168474615-168474637 CTGGTGGAGCTGTGAGGAGAGGG + Intergenic
917351966 1:174087757-174087779 CTGTTGAGGGTGGGAGGAGAAGG - Intergenic
917618247 1:176768223-176768245 CAGGGGGAGGTGGGAGAAGAAGG - Intronic
918752682 1:188292474-188292496 CTGTTGGAGATGGGAGAGGAGGG - Intergenic
918961430 1:191283025-191283047 ATGTGGGAGCTGGTAGGAGCTGG - Intergenic
919624432 1:199897513-199897535 ATCTGGGGGTTGGGAGGTGATGG - Intergenic
919804394 1:201372558-201372580 GTGTAGGAGTTCTGAGGAGAGGG - Intronic
920285492 1:204875782-204875804 TTGTGGGAGTGGGGAGGAACAGG - Intronic
920431377 1:205921304-205921326 CTGGGGGTGTTGGGAGCACAGGG + Intronic
920432404 1:205927457-205927479 CTAGGGGAGTTGGGGGGAGGTGG - Intronic
920466926 1:206195347-206195369 CAATGGGAGTTGAGAGGAGGAGG - Intronic
920799267 1:209172562-209172584 CTGTGGGGACTGGGAGGAGCGGG + Intergenic
920838575 1:209534735-209534757 CTGTGGGAGGTGAGAGGACTGGG - Intergenic
920843817 1:209576939-209576961 CTGTGGGAGATGGGATGACCAGG - Intergenic
921560196 1:216648313-216648335 TTGTGGGAGGTGGGGGGAGGTGG + Intronic
921627727 1:217396531-217396553 ATTTGGGGGTGGGGAGGAGAGGG - Intergenic
921977241 1:221216415-221216437 CTGGGGGGGTTGGGAGGGGGTGG + Intergenic
922056475 1:222046616-222046638 CTCAGGGAGTTGGGAAGAGTTGG - Intergenic
922240919 1:223755194-223755216 CAGTGGGAGATGGTGGGAGATGG - Intronic
922796918 1:228344819-228344841 CTGTGGAAGTAGGGTGGAGCTGG - Intronic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
923185036 1:231563533-231563555 CTGGAAGAGGTGGGAGGAGATGG + Intronic
923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG + Intronic
923687564 1:236163940-236163962 GTGTGGGAGGTGGGAGGAGATGG - Intronic
924642646 1:245848800-245848822 CTGTGGGATTTTGGAGTAAAGGG + Intronic
924706761 1:246508615-246508637 CTGGGGGTGTTGGGAGGGGCTGG + Intergenic
1062979895 10:1713195-1713217 GTGTGGGTGATGGGAGGCGAAGG + Intronic
1063040492 10:2332643-2332665 CAGTGGGAGGTGGGAGCTGAGGG - Intergenic
1063074756 10:2703671-2703693 CTGTGGAAGTTGGGAGGTGTTGG - Intergenic
1063611924 10:7570064-7570086 CTTTGAGAGGTGAGAGGAGAAGG + Intronic
1063717111 10:8539112-8539134 CTGTGGAAGGTGGGTGGATAAGG - Intergenic
1063968781 10:11367166-11367188 GGGAAGGAGTTGGGAGGAGAAGG - Intergenic
1064029000 10:11870719-11870741 TTTTGGGGGTTGGGAGGAGTAGG + Exonic
1064527334 10:16270917-16270939 CTGTCTGAGTGGGGAAGAGAAGG - Intergenic
1064640829 10:17414340-17414362 ATATGGGAGGTTGGAGGAGACGG - Intronic
1064971774 10:21073672-21073694 CTTTGGGAGTAGGGAGCAGTGGG - Intronic
1065302435 10:24335245-24335267 CTGGGGAGGTTAGGAGGAGATGG + Intronic
1065617666 10:27545634-27545656 CTTAGGGAGTGGGGAGGACAGGG - Intergenic
1066049594 10:31621450-31621472 CTGTGGGAGTTGTGATGTGACGG + Intergenic
1066153381 10:32649152-32649174 CTGTGGGAGTTGTGGTGGGAGGG + Intronic
1066373418 10:34836584-34836606 GTGTAGGAGTTGGGAGAAGTAGG - Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1067879182 10:50029047-50029069 GTGTGGGAGTTGTGGGGAGGAGG + Intergenic
1067979410 10:51067176-51067198 CTGTGGGAGGTGGGATAGGATGG + Intronic
1067993670 10:51244490-51244512 CAGGGGGAATTGGGAGGAGGAGG - Intronic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069086862 10:64150669-64150691 CTATGGGAGTGGTGTGGAGATGG + Intergenic
1069346463 10:67476424-67476446 GTCTGGGAGTGGGGTGGAGAGGG - Intronic
1069960026 10:72074005-72074027 CTCTGGGAGCTGGGGGGAGAGGG + Intronic
1069963825 10:72096893-72096915 CTGCGGGGGCTGGGAGGAGTGGG + Exonic
1070180772 10:74011417-74011439 CTAGGAGAGTAGGGAGGAGAGGG - Intronic
1070307602 10:75248865-75248887 CTGTGGAGGTTTGGAGGAGAAGG - Intergenic
1070637901 10:78143861-78143883 CTGTGGTAGCTGGGAAGAGGTGG + Intergenic
1071268286 10:83983784-83983806 CTGTGGGAGGTGGGAAGAGAGGG - Intergenic
1071380055 10:85049828-85049850 CTGTTACAGTTGGGAGAAGAGGG + Intergenic
1072038935 10:91589767-91589789 CTGGGGGAGTGTGGGGGAGAAGG + Intergenic
1072637324 10:97186209-97186231 CTGCGGGGGATGGGAGAAGAGGG + Intronic
1072682399 10:97516788-97516810 CTGTAGGAGATGCGAGGAGATGG - Intronic
1072800362 10:98388509-98388531 CTGTGCGGGCAGGGAGGAGACGG + Intronic
1073059495 10:100724798-100724820 CTGTGGGAGTTGGGAGCTGGGGG - Intergenic
1073564400 10:104522674-104522696 CGGGGGGAGAGGGGAGGAGAAGG + Intergenic
1073570909 10:104580416-104580438 CGGTGTGAGGGGGGAGGAGATGG + Intergenic
1074309979 10:112313725-112313747 CTGTGGGAGATAGAAGGACACGG - Intergenic
1074570273 10:114618019-114618041 CTATAGGGGTTGGGAGGAGTGGG - Intronic
1074920166 10:118000348-118000370 AACTGGGAGTTGGGTGGAGAAGG - Intergenic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075044969 10:119139606-119139628 CGGAGGGAGTAGGCAGGAGATGG + Intergenic
1075579189 10:123603961-123603983 CCGTGGAGGTTGGGATGAGAAGG - Intergenic
1075852974 10:125603769-125603791 CTGCAGGAGTTGGGTGGGGAGGG - Intronic
1076544016 10:131231850-131231872 ATGTGGGAGTCTGGTGGAGAGGG + Intronic
1076550980 10:131278039-131278061 CTGTGGGAGATGGAAGCGGAGGG + Intronic
1076619129 10:131775793-131775815 AGGTGGGAGTGGAGAGGAGAAGG + Intergenic
1076627757 10:131832355-131832377 CTGGGGCAGCTGGGAGCAGAGGG + Intergenic
1076731998 10:132443918-132443940 GAGTGGGGGTTGAGAGGAGAGGG - Intergenic
1077356897 11:2122840-2122862 GTGTGGGAGCTGGGAAGAGCGGG + Intergenic
1077687575 11:4311130-4311152 AGGTGGGAGTGGGGAGGAAAAGG + Intergenic
1078077435 11:8174591-8174613 CTCTGGGAGTTGGGAGAACTGGG - Intergenic
1078170898 11:8928543-8928565 CTGTGGGAGGAGGGTGGAGGTGG - Intronic
1078187206 11:9062165-9062187 CTGAAGGAGTTGGGGGAAGAGGG - Intronic
1078535939 11:12174344-12174366 GGGTGGGGGTGGGGAGGAGAGGG - Intronic
1078835799 11:15028104-15028126 CTGTGGGAAGTGGGTGGAGCTGG + Intronic
1079542664 11:21594373-21594395 CTGGTGGAGTTGTGAGAAGAGGG + Intergenic
1079977979 11:27116318-27116340 TTGGGGGGGTTGGGAGGATAGGG + Intronic
1080231192 11:30018502-30018524 GTGTGGGAGTGGGGTGGAGATGG - Intergenic
1080684329 11:34502787-34502809 CAGTGGGTGGTGGGAGGAGAAGG + Intronic
1080685447 11:34511544-34511566 CTGTGGGAGTGAGGCAGAGATGG + Exonic
1080853154 11:36088918-36088940 GTGTGAGACTGGGGAGGAGAGGG - Intronic
1080885796 11:36366916-36366938 CTGTGGGAGAAGGGAGGAGAAGG - Intronic
1081016688 11:37891242-37891264 CTAGTGGAGCTGGGAGGAGAGGG - Intergenic
1081581063 11:44352339-44352361 CTGTGGCAGAAGGGAGCAGACGG + Intergenic
1081612150 11:44569039-44569061 CTGTGAGAGGTGGGAAGGGAGGG + Intronic
1081783041 11:45726767-45726789 CTGTGGCAGGTGGGAGGATCCGG + Intergenic
1081914195 11:46720282-46720304 CTGGGGGAGATGGGAGGAGAGGG - Intronic
1082025213 11:47566230-47566252 CTTTGGGAGGCGGGAGGAGGAGG + Intronic
1082650837 11:55790669-55790691 ATGTGGGAAATGGGTGGAGAAGG - Intergenic
1083328268 11:61884745-61884767 GTGTGGGGGTTGGGGGGACAGGG - Intronic
1083373588 11:62201841-62201863 CTTTGGGAATAGGGAGGAGATGG + Intergenic
1083489312 11:63003445-63003467 GTATGTGTGTTGGGAGGAGATGG + Intronic
1084662519 11:70554542-70554564 CTGGGGGAGGGGGGAGGAGAGGG - Intronic
1084751693 11:71208313-71208335 ATGGGGAAGTTGGGGGGAGAAGG + Intronic
1084981247 11:72829934-72829956 CTGGGGGAGCTCTGAGGAGAGGG + Intronic
1085031344 11:73272682-73272704 CAGTGGGGGCGGGGAGGAGATGG + Intronic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1087137902 11:94739260-94739282 TTCTAGGAGTTGGGAGGGGATGG + Intronic
1087162047 11:94958669-94958691 CTTTAGGAGGTGAGAGGAGAAGG - Intergenic
1087207528 11:95412482-95412504 TTGGGGGAGTGGGGCGGAGATGG + Intergenic
1087726651 11:101725842-101725864 ATGAGAGAGTAGGGAGGAGAGGG + Intronic
1088481199 11:110297333-110297355 CTTTGGCAGTTGGAAGGAGTTGG + Intergenic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1088969282 11:114758052-114758074 CTGTGGAGGCTGGGAGGAAAAGG - Intergenic
1088974567 11:114804225-114804247 CTATGGGAATAGGGAGCAGAGGG - Intergenic
1089181181 11:116583879-116583901 CATTGGGAGTTGGGTGAAGATGG - Intergenic
1089237705 11:117046633-117046655 CTTTGGGAGGTGGAAGGAGGTGG + Intronic
1089527486 11:119107007-119107029 CTGGGGGTGTTGGGAGAAGGGGG + Intronic
1089539501 11:119181488-119181510 CTGGGGGAGGTGGGGAGAGAGGG + Intronic
1089930565 11:122306549-122306571 CTTTGGGAGTTGTCAGGAGTTGG + Intergenic
1090020458 11:123123845-123123867 CTGTGGCAGCTCAGAGGAGATGG + Intronic
1090579962 11:128148794-128148816 ATGAGGGAGTAGGGAGCAGAGGG + Intergenic
1090921093 11:131206379-131206401 ATGTGGGGGCTGGGAGGAAAGGG - Intergenic
1091293190 11:134453818-134453840 CTGTTGGCACTGGGAGGAGATGG + Intergenic
1091387992 12:107245-107267 CAGTGGCAGCTGGGAGGGGAAGG + Intronic
1091396502 12:156852-156874 CTGTGGCAGGTGGGAGGAGATGG + Intronic
1091667918 12:2432512-2432534 GTGGGGCAGGTGGGAGGAGAGGG - Intronic
1091787401 12:3251353-3251375 CTGGGGGTGTGGGGAGGAGGAGG + Intronic
1091935394 12:4430750-4430772 CTGTGGGATGTGGCAGCAGAGGG + Intronic
1092097041 12:5851352-5851374 GTCTGGGAGTGAGGAGGAGAAGG + Intronic
1092149108 12:6235023-6235045 CTGGAGGATGTGGGAGGAGATGG + Intronic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1092261565 12:6955853-6955875 CTGTGGGGGGTGTGGGGAGATGG - Intronic
1092729034 12:11511149-11511171 TTGTGGGAGCAGGCAGGAGAGGG - Intergenic
1093256725 12:16876806-16876828 TTGTGCAAGTTTGGAGGAGAGGG + Intergenic
1093338666 12:17943104-17943126 CTATGGCTGCTGGGAGGAGAAGG - Intergenic
1093536613 12:20230742-20230764 CTAGGGGAGTTGTGAGAAGAGGG - Intergenic
1093649463 12:21626619-21626641 CTGTGAGCCTTTGGAGGAGAAGG + Intergenic
1094207178 12:27852972-27852994 TTGTGGGAGTGTGGGGGAGAAGG - Intergenic
1094226226 12:28049098-28049120 CAGTGGGAGTTTGGATCAGATGG + Intergenic
1094256996 12:28443064-28443086 CTGTTAAAGTTGGAAGGAGATGG + Intronic
1094660609 12:32466952-32466974 CTCTGGGAGTAGGGTGGTGAAGG - Intronic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1096064639 12:48729887-48729909 CAGTTGGGGTTGGGAGGGGAAGG - Intergenic
1096229019 12:49887302-49887324 GTGAGGAAGATGGGAGGAGAAGG + Intronic
1096482760 12:51952832-51952854 CTGTGGGGATTGGGAGGTAAGGG - Intronic
1096765466 12:53885121-53885143 GGGTGGGAGTGGTGAGGAGAGGG + Intergenic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097244015 12:57596060-57596082 ATATGTGAGTAGGGAGGAGAGGG - Intronic
1097279637 12:57836926-57836948 CTGTGGGGGATGGGAGGTGGTGG - Intronic
1097481067 12:60126454-60126476 CTAGTGGAGTTGTGAGGAGAGGG + Intergenic
1097604806 12:61740328-61740350 CTGTCAGAGTTGGGAGGCAAGGG + Intronic
1097710762 12:62914536-62914558 CTGTGGGAGAGGGAAGGTGATGG + Intronic
1097747682 12:63317680-63317702 CTTTGGGTGTTGGGATGAGGTGG + Intergenic
1097889220 12:64760268-64760290 CGGTGGGCGGTGAGAGGAGAGGG - Intergenic
1098706212 12:73692996-73693018 GGGTGGGAGTGGGGAGGAGTTGG + Intergenic
1099103319 12:78470494-78470516 GTGTGGGAGTGGGGAGCAGGGGG - Intergenic
1099675518 12:85755800-85755822 CTGGTGGAGCTGGGAGAAGAGGG + Intergenic
1102329138 12:112013992-112014014 CTGTGGAAGCTGGGAGGGGTTGG + Intronic
1102820713 12:115907065-115907087 CTTTGGGAGGTGGGAGCAGGTGG + Intergenic
1102867955 12:116389310-116389332 ATAAAGGAGTTGGGAGGAGATGG - Intergenic
1103020561 12:117530819-117530841 CTGATGGAGTTGGGGGCAGAGGG - Intronic
1103042769 12:117709559-117709581 CTTTGGGAGGTGGAAGCAGAAGG - Intronic
1103136190 12:118509934-118509956 CTGTTGGACTTGGGCTGAGAGGG + Intergenic
1103451363 12:121031593-121031615 GGCTGGGAGTTGGGAAGAGAAGG + Exonic
1103520461 12:121534403-121534425 AGGAGGGAGGTGGGAGGAGAGGG + Intronic
1103562947 12:121801474-121801496 GTTTGGGAGCTGAGAGGAGAAGG - Intronic
1103821334 12:123701239-123701261 GTGGAGGAGTTGGGAGGAAATGG + Intronic
1104062552 12:125280864-125280886 ATTTGGGAGTTGAGAGGAGGGGG + Intronic
1104889795 12:132134740-132134762 CTCGGGGAGGTGGGAGGAGTGGG - Intergenic
1104889819 12:132134810-132134832 CTCGGGGAGGTGGGAGGAGTGGG - Intergenic
1104889854 12:132134915-132134937 CTCGGGGAGGTGGGAGGAGCGGG - Intergenic
1104889887 12:132135023-132135045 CTCGGGGAGGTGGGAGGAGTGGG - Intergenic
1104889955 12:132135233-132135255 CTCGGGGAGGTGGGAGGAGTGGG - Intergenic
1104890035 12:132135482-132135504 CTCGGGGAGGTGGGAGGAGTGGG - Intergenic
1104890081 12:132135622-132135644 CTCGGGGAGGTGGGAGGAGCGGG - Intergenic
1104890093 12:132135658-132135680 CTCGGGGAGGTGGGAGGAGCGGG - Intergenic
1104890105 12:132135694-132135716 CTCGGGGAGGTGGGAGGAGCGGG - Intergenic
1104890199 12:132135970-132135992 CTCGGGGAGGTGGGAGGAGCGGG - Intergenic
1104890223 12:132136040-132136062 CTCGGGGAGGTGGGAGGAGCGGG - Intergenic
1104890235 12:132136076-132136098 CTCGGGGAGGTGGGAGGAGCGGG - Intergenic
1104890247 12:132136112-132136134 CTCGGGGAGGTGGGAGGAGCGGG - Intergenic
1104890259 12:132136148-132136170 CTCGGGGAGGTGGGAGGAGCGGG - Intergenic
1104890294 12:132136253-132136275 CTCGGGGAGGTGGGAGGAGCGGG - Intergenic
1104890328 12:132136360-132136382 CTCGGGGAGGTGGGAGGAGCGGG - Intergenic
1105206600 13:18231038-18231060 GGGTGGGAGGTGGGAGGAGGGGG - Intergenic
1105580733 13:21693361-21693383 CTGTGGGTATTGGGTGGACATGG + Intronic
1105603156 13:21905182-21905204 CTTTGGGATGTGGGAGGAAATGG + Intergenic
1106233947 13:27845652-27845674 CTGAGGCGGTGGGGAGGAGAAGG - Intergenic
1106442715 13:29791866-29791888 TTGGGGGAGTTGGTAGGATATGG - Intronic
1107013680 13:35692197-35692219 CTGTGTGAGAGGGGAGGAGAAGG + Intergenic
1107463529 13:40628486-40628508 CTTTGGGACTGGGGAGGGGAAGG - Intronic
1107469055 13:40675023-40675045 CTGGGGAAGTAGGGTGGAGAAGG + Intergenic
1107686883 13:42909768-42909790 CTGGGGGGGTTAGGAGGAAATGG + Intronic
1107966178 13:45600182-45600204 CAGTGGGAGTTAGAAGTAGACGG - Intronic
1108059220 13:46515832-46515854 CTGTGGGAGTTGGCATGGGAAGG - Intergenic
1108450520 13:50558187-50558209 CTATAGGAGTTGAGAGCAGAGGG + Intronic
1109150045 13:58835742-58835764 CTGGAGGAGTGGGGAGCAGAGGG - Intergenic
1109276141 13:60306392-60306414 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1109738801 13:66523647-66523669 CTGTAGGAGTTGGCAGGGGGAGG + Intronic
1109747696 13:66647926-66647948 CTGTGGGCCTGGGGAAGAGACGG + Intronic
1110035971 13:70684365-70684387 GTGTGGGAGTGGGGAAGAGGAGG + Intergenic
1110422524 13:75329102-75329124 GTGTGGGGGTTGGGGGGAGGTGG - Intronic
1110848153 13:80213245-80213267 CTTTGGGAGGTGGAAGCAGAAGG + Intergenic
1110859034 13:80327624-80327646 CTGAGAGAGTAGTGAGGAGAAGG - Intergenic
1110868022 13:80420038-80420060 ATATGGGAGAAGGGAGGAGAAGG - Intergenic
1111087505 13:83395386-83395408 CGGTGGAGGGTGGGAGGAGAGGG + Intergenic
1111201375 13:84942207-84942229 CTCTTGGAGTAGGGATGAGATGG - Intergenic
1111507535 13:89213633-89213655 CTGGGGTGGTGGGGAGGAGAGGG - Intergenic
1111793126 13:92883969-92883991 CTTTGTGGGGTGGGAGGAGATGG + Intergenic
1111947647 13:94682281-94682303 CTGTGCCAGGTGGGTGGAGAAGG + Intergenic
1111986340 13:95070392-95070414 TATTGGGAGTTGTGAGGAGAGGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112577893 13:100653356-100653378 TTTTGGGAGTTGTGAGGAGGAGG + Intronic
1112602243 13:100868398-100868420 CTGTGGGTATTTGGAGGATAGGG + Intergenic
1112760419 13:102688665-102688687 CTGTGGGGGCTGGGAGGAGGGGG + Intronic
1112785764 13:102950542-102950564 CAGTGGGACTTGGGAGACGAAGG - Intergenic
1112962453 13:105143352-105143374 GTGTGGGAGATGCGAGGAAAGGG + Intergenic
1113064631 13:106360529-106360551 CTCTGGGATTTGGGAAGGGAGGG + Intergenic
1113335241 13:109370766-109370788 CTGCTGGGGTTGGAAGGAGAGGG - Intergenic
1113486505 13:110656517-110656539 CTGTCGGGGCTGGGAGGAGGTGG + Intronic
1113583179 13:111443356-111443378 CTGTTGGAGGTGGCAGGAGGCGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114491431 14:23104660-23104682 CTGAGGGAGAAGGGATGAGAGGG - Intergenic
1114615499 14:24065804-24065826 ATGAGGGAGTGGGAAGGAGAGGG - Intronic
1116027256 14:39530299-39530321 AGGTGGCAGGTGGGAGGAGAGGG - Intergenic
1116465344 14:45225536-45225558 CTGTGCTAGTTAGGAGGACATGG + Intronic
1117130708 14:52684009-52684031 ATGTGGGAGGAGGGAGGATAAGG - Intronic
1117336492 14:54760715-54760737 CTGAGGGAGTTGGGAGAGAAAGG - Intronic
1117614604 14:57520721-57520743 CTGTTGGGGGTGGGGGGAGATGG - Intergenic
1117641622 14:57805615-57805637 CTGTTGGAGTGGGGAGTAGGGGG + Intronic
1117889571 14:60404576-60404598 CTGTTGGGGGTGTGAGGAGAAGG - Intronic
1118109261 14:62697698-62697720 AGTTGGGAGTTGGGAGGAGTTGG - Intergenic
1118315405 14:64722892-64722914 CTGTGGGATAGGGGAGGAGCAGG + Intronic
1118880333 14:69820121-69820143 CTGTTAGAGGTGGGAAGAGAAGG + Intergenic
1119072737 14:71604236-71604258 CTGTGGGAGGCTGGAGCAGATGG - Intronic
1119463149 14:74828913-74828935 CTGTGGTGGGTGGGAGGACAAGG + Intronic
1119485662 14:74984974-74984996 CTGTGGGAGGTGGGAGCAAGAGG + Intergenic
1119662274 14:76460527-76460549 CTGAGGGAGCAGGGAGGAGCTGG - Intronic
1119730517 14:76948175-76948197 CTGTGGGTGAGGGGAGGTGAGGG - Intergenic
1119735039 14:76976340-76976362 GTGTGGGAGGTGGGAGGGGCAGG - Intergenic
1119802464 14:77458009-77458031 CGGTGGGAGTGGGGAGGAGCCGG + Exonic
1119901355 14:78262628-78262650 CTGTGGCAGGTGGGAGGACCTGG - Intronic
1119949958 14:78734826-78734848 AGGTGGAAGTGGGGAGGAGAGGG + Intronic
1120215853 14:81679911-81679933 CTGTGGGACTTCAGAGGAAATGG + Intergenic
1120235834 14:81889914-81889936 CAGTGGGAGGTGGGAGGTGGGGG - Intergenic
1120452201 14:84682691-84682713 GTGTGGAAGGTGGGAGGAGGGGG - Intergenic
1120575613 14:86176742-86176764 GGGTGCGAGTTGGGGGGAGATGG + Intergenic
1120749665 14:88186204-88186226 CTGTGGGTGCTGGGAGGCCAAGG - Intronic
1121492004 14:94367739-94367761 CTATCACAGTTGGGAGGAGAGGG - Intergenic
1121779912 14:96615701-96615723 ATGTGAGGGTTTGGAGGAGAGGG + Intergenic
1121869207 14:97391777-97391799 CTGACGGAGTTGGCAAGAGATGG - Intergenic
1121994336 14:98590433-98590455 ATGGGGGAGATGGGAGCAGAAGG + Intergenic
1122557648 14:102590334-102590356 CTGTGGGAGGTGTAAGGAGAGGG + Intergenic
1122907008 14:104806221-104806243 GTGTGGGAGTGGGCAGGAGCTGG - Intergenic
1123116876 14:105898881-105898903 CTGTGGGTGGTGGGAGGGCAGGG + Intergenic
1202904280 14_GL000194v1_random:59583-59605 GGCTGGGACTTGGGAGGAGAAGG - Intergenic
1124135215 15:27029220-27029242 CTGTGTGAGTTGGAAGCAGCTGG + Intronic
1124356250 15:28996884-28996906 CTGTGCCAGTTGTGAGGGGACGG + Intronic
1124631309 15:31339067-31339089 CCTTGGGTGTTGGGAGGAGGTGG + Intronic
1125471505 15:40008746-40008768 CTGTGAGAGTTGAGAAGAAAAGG - Intronic
1125520338 15:40344824-40344846 CTGATGGAGTTGGGAGGTGGAGG - Intergenic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1127269004 15:57384071-57384093 GTGGGTGGGTTGGGAGGAGAAGG + Intronic
1127485346 15:59413174-59413196 CTGTGGGAGATGGGGGAACATGG + Intronic
1127969487 15:63947179-63947201 GTGTGGGAACTGGGTGGAGAGGG - Intronic
1128214000 15:65921950-65921972 CTGTGGGAGTGCAGAGGAGCTGG - Intronic
1128743875 15:70100423-70100445 ATTTGGGAGCTGAGAGGAGAGGG + Intergenic
1129235502 15:74221590-74221612 CTGTGTGGGTGGGGAGGTGATGG + Intergenic
1129656113 15:77526751-77526773 CTGGGGGGTTCGGGAGGAGAGGG + Intergenic
1129767367 15:78178869-78178891 CAGTGGGGGCTTGGAGGAGACGG - Intronic
1129805977 15:78458382-78458404 TTGTGGGAGTAGGGAGTATATGG + Intronic
1130162249 15:81413603-81413625 CTGGGGAAATTGGGAGGGGAGGG + Intergenic
1131736561 15:95338848-95338870 CTCTAGACGTTGGGAGGAGAGGG - Intergenic
1131937130 15:97519095-97519117 CAGTGGGAGTGGGGAATAGATGG + Intergenic
1132613623 16:829680-829702 CTGTGGGAGGCCGAAGGAGATGG - Intergenic
1133011292 16:2913272-2913294 TGGTGGGAGTGGGAAGGAGAGGG + Intronic
1133027517 16:2995183-2995205 CTGAGGGGGATGGGAGGAGCTGG + Intergenic
1133699254 16:8293854-8293876 GTGAGGGGGTGGGGAGGAGATGG + Intergenic
1134491911 16:14702038-14702060 CTCTGGGAGATGGGAGCAGAGGG + Intergenic
1134497292 16:14741160-14741182 CTCTGGGAGATGGGAGCAGAGGG + Intronic
1134756846 16:16674639-16674661 CTTTGGGAGTGGGGAGGTGGAGG + Intergenic
1134909293 16:18009573-18009595 CTGTGAGAGCTGATAGGAGATGG + Intergenic
1134989222 16:18684524-18684546 CTTTGGGAGTGGGGAGGTGGAGG - Intergenic
1135515896 16:23133440-23133462 ATGAGGGAGTTGGGGGGAGACGG + Intronic
1135656811 16:24257016-24257038 TGGTGGGTGTTTGGAGGAGATGG + Intronic
1135946010 16:26865612-26865634 GTCTGGGAGTTTGGAGGACAGGG - Intergenic
1136121249 16:28136533-28136555 TTTTGGGAGTTGGGTGGAGCAGG - Intronic
1136138671 16:28274848-28274870 ATGTGGGAGTGGGTGGGAGAGGG + Intergenic
1136248166 16:28986725-28986747 AGGTGGGAGGTGGGAGGTGAGGG + Intronic
1136344630 16:29666767-29666789 CTGTGGGGCCTGGGTGGAGAGGG + Exonic
1136927745 16:34389542-34389564 CTGGGCGAGCTGGTAGGAGAAGG + Intergenic
1136976829 16:35022264-35022286 CTGGGCGAGCTGGTAGGAGAAGG - Exonic
1137347236 16:47675472-47675494 GTGTGTGTGTTGGGAGAAGAGGG - Intronic
1137389726 16:48071274-48071296 TGGTAGGAGTCGGGAGGAGAAGG + Intergenic
1137391285 16:48083448-48083470 CTTGGGGATTTGGGAGGTGAAGG + Exonic
1137403347 16:48171171-48171193 CTGGGGGACTGGGGAGGAGGTGG - Intronic
1137420191 16:48326812-48326834 CTGTGGGAAGAGGGAGGAAAGGG - Intronic
1138458912 16:57136515-57136537 CTCTGGCAGTTGGCAGGAGGGGG - Intronic
1138530404 16:57631466-57631488 GGGTGGAAGTAGGGAGGAGAGGG + Intronic
1139419966 16:66844223-66844245 GGGTGGGAGTTGGGGGGAGAGGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139529607 16:67536633-67536655 CTGTGGGAGTAGGGATGGGGTGG + Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1140189448 16:72802778-72802800 CTTTGGAAGCTGGTAGGAGAGGG - Intronic
1140190711 16:72813633-72813655 ATGTGTGTGTTGGGAGGAGGAGG - Intronic
1140661990 16:77197146-77197168 GGGTGGGAGTTGGGGGGAGTGGG + Intronic
1141134775 16:81458142-81458164 ATGAGGAAGTGGGGAGGAGAGGG + Intronic
1141164679 16:81652517-81652539 GTGTGGGAGTTGGGAGAGGGAGG + Intronic
1141443344 16:84043113-84043135 CTGCTGGAGTTGGGTGGAGGAGG - Intergenic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1141673681 16:85506356-85506378 ATGTGGGGGTGGGGAGGAGCAGG + Intergenic
1141675916 16:85517240-85517262 CTGTGGGAGGCGGGAGGAGATGG + Intergenic
1141683585 16:85557424-85557446 GTGGGGGTGTAGGGAGGAGAGGG + Intergenic
1141763972 16:86046586-86046608 CTGTGGGAAGTGGCAGGGGAGGG + Intergenic
1141982182 16:87557344-87557366 CCGTGGGGGTTGGGAGGGGCGGG + Intergenic
1142184076 16:88686213-88686235 CTGTCCCAGGTGGGAGGAGAAGG - Intronic
1142254538 16:89007275-89007297 AGGGGGGAGTGGGGAGGAGATGG - Intergenic
1142548308 17:720935-720957 CTGAGGGAGTTGGGGGAGGATGG + Intronic
1143034300 17:3985741-3985763 CTGGGGGAGCAGGGAGCAGAGGG + Intergenic
1143092923 17:4459926-4459948 GTGTGAGTATTGGGAGGAGAGGG + Intronic
1143484586 17:7246716-7246738 CTCTGGGAATTGGGAGGATTTGG - Intronic
1143993124 17:10983975-10983997 CTGTAGAAGTTGGAAGAAGAGGG - Intergenic
1144696273 17:17305814-17305836 GTTGGGGAGTGGGGAGGAGAGGG + Intronic
1144728635 17:17514403-17514425 CTCTTGGGGATGGGAGGAGAAGG - Intronic
1144884919 17:18451338-18451360 CGGTGGGAGCAGGGAGGAGGGGG - Intergenic
1145018842 17:19414987-19415009 CTGCGGGCTTTGGGAGGAGAAGG - Intronic
1145147304 17:20493039-20493061 CGGTGGGAGCAGGGAGGAGGGGG + Intergenic
1146180960 17:30697927-30697949 CTGGGGGAGTTGGGGTGTGAGGG - Intergenic
1146224085 17:31050836-31050858 CCATGGGAGATGGGAGGAGCGGG + Intergenic
1146280500 17:31541353-31541375 CTCAGGGATTTGGGAGGGGAGGG - Intergenic
1146341230 17:32021295-32021317 CCATGGGAGATGGGAGGAGCGGG - Exonic
1146556411 17:33828326-33828348 CTCTAGGGGTTGGGATGAGAGGG + Intronic
1147573470 17:41585689-41585711 ATGTGGGAGCAGGGAGGAGGGGG + Intronic
1148127427 17:45244047-45244069 CGGTGTGACTTGGGAGGGGATGG + Intronic
1148161527 17:45453113-45453135 CAGTGGGAGGTGGCAGGAGAGGG + Intronic
1148174238 17:45550129-45550151 CCGTGGGAAATGGGAGGAGTGGG + Intergenic
1148275024 17:46295318-46295340 CCGTGGGAAATGGGAGGAGTGGG - Exonic
1148297131 17:46512897-46512919 CCGTGGGAAATGGGAGGAGTGGG - Exonic
1148361687 17:47017377-47017399 CCGTGGGAAATGGGAGGAGTGGG - Intronic
1148679080 17:49462962-49462984 CTGTTGGGGCAGGGAGGAGAAGG - Intronic
1148699749 17:49580254-49580276 CTGTGGGTGGGGGGAGGGGAGGG + Exonic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1149394658 17:56227380-56227402 TTGTGGGAGATGCGAGGAGGGGG - Intronic
1149601447 17:57895703-57895725 CTGTGGCACCTGGGAGGGGAGGG - Intronic
1149606276 17:57927286-57927308 CGGGGGGAGTGGGGAGGAGGAGG - Intronic
1149614697 17:57988128-57988150 CGGGGGGAGTGGGGAGGAGGGGG - Exonic
1149845669 17:60008236-60008258 CTGGGGGTGTTGGGAGGGGCTGG + Intergenic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1150084017 17:62264816-62264838 CTGGGGGTGTTGGGAGGGGCTGG + Intergenic
1150392762 17:64799758-64799780 CAGTGGGAGGTGCCAGGAGAGGG + Intergenic
1150405456 17:64897051-64897073 CCGTGGGAAATGGGAGGAGTGGG + Exonic
1150488635 17:65560458-65560480 CTTTGGGAGGTGGGATGAAAGGG - Intronic
1150784590 17:68152263-68152285 CCATGGGAGATGGGAGGAGCAGG + Intergenic
1151348290 17:73516542-73516564 TTGTGGGAGAAGGGAGGAGGAGG - Intronic
1151354989 17:73553090-73553112 CTGTGGGGGCTGGGAGGGAAGGG + Intronic
1151669485 17:75564212-75564234 CTGTAGCAGTTGGAAGGAGATGG + Intronic
1151691560 17:75689365-75689387 CTGGGGGAGTTGGGAGGCTGAGG - Intronic
1151692271 17:75693935-75693957 CTTTGTGATTTGGGAGGAGCAGG + Intronic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1152102648 17:78311647-78311669 GTGTGGGAGTGGGGAGGATCGGG - Intergenic
1152274662 17:79349285-79349307 TGGTGAGAGGTGGGAGGAGAGGG - Intronic
1152700442 17:81815779-81815801 CTGGTGGAGTTGGGTGGAGTTGG + Intergenic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1153198400 18:2625371-2625393 CTGTGGGAGGTGGGAGAGGCAGG + Intergenic
1153640899 18:7156179-7156201 GAGTGGGTGTTGAGAGGAGATGG - Intergenic
1153758766 18:8310267-8310289 CTGTGGGAGTGGGGAGACAATGG - Intronic
1154010339 18:10568744-10568766 CTCTGGGAGCTGAGAGAAGAGGG - Intergenic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1154217928 18:12429072-12429094 CGCTGGGATTTGGGAGGTGAGGG + Intronic
1154472427 18:14717521-14717543 CTGTGTGAGGTGGGAGGCTACGG + Intergenic
1155313168 18:24544878-24544900 TTGTGGGAGTTTGGAGGAAGGGG + Intergenic
1156491325 18:37498211-37498233 CTGGGGGAGCTTTGAGGAGATGG - Intronic
1156676495 18:39532591-39532613 CTGTGGGAGTGGTTAGGACAAGG - Intergenic
1157182983 18:45513903-45513925 CTCTGTGTGTTGGGTGGAGAAGG - Intronic
1157327783 18:46681385-46681407 CAGTGGGAGATGAGAGGAGGGGG - Intronic
1157614919 18:48980729-48980751 CAGTGCCAGCTGGGAGGAGATGG - Intergenic
1157909264 18:51599754-51599776 CAGTGGAAGATGGGAAGAGATGG - Intergenic
1158283673 18:55854970-55854992 CTGTGGAAGTTTGGAGAAGGTGG + Intergenic
1158843303 18:61411829-61411851 CTTTGGGACTTGGGTGGAGAGGG + Intronic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1159926177 18:74271032-74271054 CTGGAGGAGTTGGAATGAGAGGG - Intronic
1160172481 18:76566617-76566639 CTGGGGGACTTCGGAGGAGGTGG + Intergenic
1160353134 18:78201976-78201998 CTGAGGGAGTGGGGAGGAGGAGG - Intergenic
1160367118 18:78335655-78335677 CAGAGGGAGGTAGGAGGAGAGGG + Intergenic
1160704557 19:524014-524036 CTGTGGGCTTCGGGAGGACAGGG - Intergenic
1160707914 19:538354-538376 ATGAGGGCGATGGGAGGAGAGGG - Intronic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1161004005 19:1925478-1925500 CAGGGGGAGTTGGGGGGTGAGGG - Exonic
1161044036 19:2124986-2125008 TTGTGGGAGGTGGGGGGTGAGGG + Intronic
1162316621 19:9942886-9942908 TTGGGTGAGTTGGGAGGTGATGG + Intergenic
1162373404 19:10291812-10291834 GAGTGGGTGTGGGGAGGAGATGG + Intronic
1162675407 19:12294714-12294736 CTACGGGAGTTGGGAGGACCCGG - Exonic
1162774361 19:12969991-12970013 GGGTGGGTGTGGGGAGGAGAGGG + Intronic
1163115219 19:15185074-15185096 TTGGGGGAGGTGGGGGGAGATGG - Intronic
1163235757 19:16029537-16029559 CTGGGGCAGGCGGGAGGAGAGGG + Intergenic
1163375051 19:16924996-16925018 CTGTGGCTGTTAGGATGAGATGG - Intronic
1163406484 19:17126204-17126226 CCCTGGGAGCTGGGAGCAGAGGG - Intronic
1163554576 19:17984775-17984797 ATCTGGGGGTTGGGAAGAGAGGG - Intronic
1163590897 19:18193629-18193651 CTCCGGGGGTTGGGAGGTGATGG - Intronic
1163836809 19:19579937-19579959 CTGTGGATGGTGGGGGGAGATGG - Intronic
1164585999 19:29476416-29476438 AAGTGGGAGATGGGAGGACAGGG - Intergenic
1165367961 19:35381226-35381248 GAGGGGGAGTTGGGAGGAGAAGG - Intergenic
1165745531 19:38228253-38228275 GGGTGGGAGTTGGGAGAGGAAGG - Intronic
1165779352 19:38423198-38423220 CTGTGGGAGGAAGGAGGGGAGGG - Intronic
1165856399 19:38881242-38881264 CAGTGGGAGTTGGGAGCAGTGGG + Intronic
1166359149 19:42245121-42245143 CCGTGGGAGTTTGAAGGTGACGG + Intronic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1166691093 19:44821440-44821462 CTCTGGGAGTAGGGAGGGGAAGG + Intergenic
1166783206 19:45352899-45352921 GTGTCTGAGTTGGGGGGAGAGGG + Intronic
1166881656 19:45933915-45933937 ATGTGGGGAGTGGGAGGAGACGG + Exonic
1166970683 19:46565263-46565285 CTGTGGGAGCTGGGAGAGGTAGG - Intronic
1166988651 19:46677747-46677769 GGATGGGAGTGGGGAGGAGAAGG - Intronic
1167146103 19:47681375-47681397 CTGTGGCAGCTGGGGGGGGAAGG + Intronic
1167208442 19:48118027-48118049 AGGTGGGAGTTGGGAGGAATGGG + Intronic
1167244734 19:48366006-48366028 GTGCGGGAGATGGGAGGACAAGG + Intronic
1167250264 19:48395497-48395519 GTGTGTGTGTTGGGAGGTGAGGG + Intronic
1167286574 19:48601794-48601816 TTGAGGGAGGTGGAAGGAGATGG + Intronic
1167454431 19:49591172-49591194 CTGGGGGAGGGGGGAGGGGAAGG - Intergenic
1167495161 19:49813249-49813271 CTGTTTGAGTTGGGTGAAGAAGG - Exonic
1168012217 19:53542189-53542211 GTGTGTGTGTTGGGAGGGGAAGG + Intronic
1168148289 19:54431412-54431434 GTGCGGGAGTTGGGGGGAAAGGG - Intronic
1168288023 19:55344004-55344026 CCTTGGGACTCGGGAGGAGAGGG + Intronic
925038252 2:708837-708859 CTGGGGGATTTGAGGGGAGACGG + Intergenic
925292141 2:2755109-2755131 CTGGGGGACTTTGGAAGAGAAGG + Intergenic
925330062 2:3051663-3051685 CTGGGGGAGTTGGGAAGCTAGGG - Intergenic
925416795 2:3676001-3676023 ATGTGGGAGGAGGCAGGAGATGG - Intronic
926051101 2:9745269-9745291 CAGTGGGTGTGGGGAGGAAAGGG - Intergenic
926526849 2:13991955-13991977 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
926634526 2:15165661-15165683 CGGTGGGAGTGGGGTGGACAGGG + Intergenic
926637923 2:15203920-15203942 GTGTGTGAGTGGGGAGGAGGAGG + Intronic
927207006 2:20617220-20617242 CAGTAGGAGTGGGGAGGGGATGG - Intronic
927471466 2:23380763-23380785 CTGGGGGTGGTGGGAGGAGGGGG + Intergenic
927885875 2:26718181-26718203 CTGTGGGAGATGGGGGCAGGTGG - Intronic
927967782 2:27282373-27282395 CTGTGGGGGTTGGGAGACAAGGG - Intronic
928322425 2:30294550-30294572 TAGTGGGTGTTGGGAGGAAAAGG - Intronic
928475627 2:31624509-31624531 CTGTGTGGGGTGGGGGGAGAGGG - Intergenic
928477090 2:31639225-31639247 ATATGGGAGTTGGGCGGGGATGG - Intergenic
928826433 2:35427014-35427036 TTGTGGGAGGTAGGAGGAGAAGG + Intergenic
929128894 2:38546565-38546587 CTTTGGGAGGTGGGAGGCCAAGG - Intergenic
929250523 2:39749749-39749771 CAGGGGGAGGTGGGAGGGGAGGG - Intronic
929611887 2:43276923-43276945 CTGTGGGAGGTGGGAGAGAAGGG - Intronic
929785398 2:44986699-44986721 ATGTGTGAGTTGGGAGCTGAAGG - Intergenic
929803975 2:45128454-45128476 CTGTGATAGCTGGGAGGACAAGG - Intergenic
929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG + Intronic
929931879 2:46263619-46263641 CTGTTGGGGAAGGGAGGAGATGG + Intergenic
930218985 2:48726487-48726509 ATGAGGGAGTTGGGCGGGGAGGG - Intronic
930471202 2:51816505-51816527 CTGTGTGAATTTGGAAGAGAAGG - Intergenic
930512129 2:52358737-52358759 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
931784726 2:65608710-65608732 GTCTGGGAGCTGGGAGGAGATGG + Intergenic
931987104 2:67752769-67752791 CTGTGGGAGCTGAGATGAGCTGG - Intergenic
932108600 2:68972232-68972254 GTGTGGGAGGTTGGGGGAGAGGG - Intergenic
932125990 2:69145989-69146011 TTTTGTGAGTTGGGAGCAGAGGG + Intronic
932418349 2:71586935-71586957 CAGTGGGAGTAGGGAGGATAGGG - Intronic
932435202 2:71699319-71699341 CTGGGGGAGGAGGGAGGAAAGGG - Intergenic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
932668838 2:73719378-73719400 GTGTGCTGGTTGGGAGGAGAAGG + Intergenic
932805467 2:74779066-74779088 CTGTGGGTGCAGGGAGGAGAGGG - Intergenic
932883217 2:75523614-75523636 CTGTGATGGTTGGGAGGGGAAGG - Intronic
932898661 2:75671522-75671544 CAGTGGCAGTAGGGATGAGAAGG - Intronic
934748273 2:96774148-96774170 CTGTGGGAGGGGGCAGGGGAAGG + Intronic
935078044 2:99765283-99765305 CTGTGGAGGCTGGAAGGAGAAGG + Intronic
935122564 2:100195834-100195856 CTAGGGGAGTTGGAAGGAGGAGG + Intergenic
935650262 2:105375821-105375843 CACTGGGAGTTGGGGGCAGAGGG + Intronic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
937129463 2:119496787-119496809 CTGTGGTGGTTGGCAGGAGTAGG - Intronic
937273480 2:120669995-120670017 ATGTGGGAGGGGGGAGGTGAAGG - Intergenic
937399550 2:121570186-121570208 CTTTGGGAGTTGGGTGGGGAGGG - Intronic
938279662 2:130055030-130055052 GTGTGGGGGTTGGGAGGTGGGGG - Intergenic
938317057 2:130337256-130337278 CAGTGGTAGTTGGGAGGCGCTGG - Intergenic
938435733 2:131282412-131282434 GTGTGGGGGTTGGGAGGTGGGGG + Intronic
939676930 2:145084230-145084252 ATGTGGGATATGGGAAGAGATGG + Intergenic
939747479 2:145993650-145993672 CATTGGGAGTTGGAAGGACAAGG - Intergenic
939866677 2:147480904-147480926 CTGTGGGAGTTCACAAGAGAGGG + Intergenic
940277677 2:151956513-151956535 CTGAGAGAGTTGGAAGGAGATGG + Intronic
940884696 2:158978678-158978700 CACTGGGAGATGGGAGGTGATGG + Intronic
941767384 2:169313196-169313218 CTTTGAGAGTTGAGAGAAGAAGG - Intronic
941874559 2:170419729-170419751 CGGAGGGAGTGGGGATGAGAGGG - Intronic
942133712 2:172905172-172905194 CTGTTCGGGTGGGGAGGAGAGGG - Intronic
942414678 2:175746407-175746429 CTGGGGGTGTTGGGGGGAGGGGG - Intergenic
942463182 2:176183648-176183670 CTGTAGGAGTTGGGGTGGGAGGG - Intergenic
942632749 2:177969261-177969283 CTGTCGGGGTTGGGAGGCAAGGG + Intronic
943110762 2:183602614-183602636 TGGTGGGAGTTGGGAGTAGAGGG - Intergenic
943314846 2:186374543-186374565 CTGGGGGAGTTGGGGGGACTGGG + Intergenic
943436144 2:187867795-187867817 CTGTAGAACTTGGGAGGAGCTGG - Intergenic
943437643 2:187886108-187886130 CTGGTGGAGCTGGGAGAAGAGGG - Intergenic
943482553 2:188439197-188439219 CTGTTGGAGTTGGAAAGGGATGG + Intronic
944675365 2:202031079-202031101 CTTTGGGAGTTGGGTGTGGAAGG + Intergenic
944916372 2:204364840-204364862 CTGTGGCAGTGAGGAGGTGAGGG - Intergenic
944940691 2:204622336-204622358 TCGTGGGAGTTGGGAGAAGAGGG - Intronic
945035788 2:205702927-205702949 CTCTGGGAGTTCAGAGGAAAGGG - Intronic
945471358 2:210230782-210230804 TGGTGGGGGTTGGGAGGAGGTGG - Intergenic
945608194 2:211963281-211963303 GTGTGGGAGGTGGGAAGAAAGGG - Intronic
946034051 2:216727800-216727822 CTTTGGGAGTATGGAGGAGTGGG + Intergenic
946226170 2:218265227-218265249 CTTTGAGAATTGGGAGCAGATGG - Intronic
946391572 2:219419509-219419531 CTGGGGGAGGTGGGGGGAGGGGG + Intronic
946413913 2:219529860-219529882 CTGTGGGAGAGGGGAGGATCAGG + Intronic
946834957 2:223763513-223763535 CTCTGGGAGTTGGGGGCAGGTGG - Intronic
947325222 2:228967357-228967379 CTCTTGGACTTGGGAGGAGGAGG - Intronic
947634580 2:231673502-231673524 CCCTGGGGGATGGGAGGAGAAGG - Intergenic
947861127 2:233358559-233358581 TTGAGGGAGTTGAGAGGAAACGG - Intronic
948010035 2:234645395-234645417 CTGTGGGAGTAGGGAGGTAGTGG - Intergenic
948421951 2:237865230-237865252 CTGGGGGAGTAGGGAGGGCAGGG + Intronic
948427153 2:237895414-237895436 CTGTGGGGGTTTTGAGGAGTTGG - Intronic
949002976 2:241628028-241628050 CTGGTGGAGCTGGGCGGAGAGGG - Intronic
949052550 2:241904899-241904921 CTGTGGGTGTTGTCAGGAGGTGG + Intergenic
1168814618 20:728230-728252 CGGTGGGGGTGGGGAGCAGACGG + Intergenic
1169046967 20:2540930-2540952 GTGTGGGAGGCAGGAGGAGAGGG - Intronic
1169343560 20:4813409-4813431 CTGTGGAAGATGGGAGGAAGCGG + Intronic
1169422761 20:5473185-5473207 CTGTTGGTGCAGGGAGGAGAGGG - Intergenic
1169636869 20:7702101-7702123 ATGTGTGTGTTGGCAGGAGAGGG + Intergenic
1170489878 20:16862151-16862173 CTGTGGAATGTGGGAGGAGGAGG + Intergenic
1170567777 20:17616508-17616530 CTGGAGGAGTTGGGGGGAGGTGG - Intronic
1170612744 20:17928112-17928134 ATGTGGGAGTGGGGAGGTAAAGG + Intergenic
1170837748 20:19899574-19899596 CTATGAGATTTGGGAGGAGTTGG + Intronic
1171298569 20:24039901-24039923 CAGGAGGAGGTGGGAGGAGAGGG - Intergenic
1172101056 20:32484034-32484056 CGGTGGGGGCTGGGGGGAGAGGG + Intronic
1172103853 20:32503534-32503556 CTGTGGCATTTGTGAGGATATGG - Intronic
1172775007 20:37402238-37402260 CTGCGGGAGTAGGGAGCACAGGG - Intronic
1172778542 20:37422397-37422419 CCCTGGGAGTTGGGAGCACAGGG - Intergenic
1172798965 20:37563291-37563313 GTGTGGGGGCTGGGAGGGGAAGG + Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1173367704 20:42402146-42402168 GTGTGGGAGATGGGGAGAGAAGG + Intronic
1173843732 20:46175146-46175168 GGGTGGGAGGCGGGAGGAGATGG - Intronic
1173963482 20:47093089-47093111 CTGTGGCAAATGGGAAGAGAAGG - Intronic
1174082294 20:47979181-47979203 TTGTGGGATCTGGGAGAAGAAGG + Intergenic
1174429385 20:50456686-50456708 GAGTGGGAGGTGGGAGGTGAGGG - Intergenic
1175078152 20:56393081-56393103 CTGTGGGAGTTGAGAAGTTAGGG + Intronic
1176076031 20:63248574-63248596 CTGTGGGTATTGGCAGGCGAGGG - Intronic
1176142116 20:63549297-63549319 CGGTGGGTGTGGGGAGGAGACGG - Intronic
1176162387 20:63654292-63654314 CTTTGGGAGTTATGAGGAGAGGG - Intergenic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176239344 20:64068745-64068767 CTGTGGAAGTTGGCAGAAGCAGG - Intronic
1176623651 21:9074350-9074372 GGCTGGGACTTGGGAGGAGAAGG - Intergenic
1176802064 21:13440378-13440400 CTGTGTGAGGTGGGAGGCTACGG - Intergenic
1177072822 21:16532086-16532108 CTCTGGGTGCTGGAAGGAGAGGG + Intergenic
1177351187 21:19944023-19944045 CTATCGGAGTGGGGAGTAGAAGG - Intergenic
1177512965 21:22113999-22114021 CTGTGGGGGTTGGGTGGTGAGGG + Intergenic
1177614892 21:23503941-23503963 TAGTGGGAGTTGGGAGCAGGTGG + Intergenic
1178753797 21:35328623-35328645 CTGTGGGAGTTGGGGGTTGAGGG + Intronic
1179161831 21:38905671-38905693 GTGCGGGAGGTGGGAGGGGAGGG - Intergenic
1179311367 21:40198751-40198773 CAGTGGGAGGTGGGATGACATGG + Intronic
1179403890 21:41109595-41109617 CTGTGGCAGTGGGGAAGTGAAGG + Intergenic
1179929111 21:44555565-44555587 CTGTGGGAGATGGGCGGTGAAGG + Intronic
1180759343 22:18187666-18187688 GGGTGGGAGGTGGGAGGAGGGGG + Intergenic
1180769651 22:18371962-18371984 GGGTGGGAGGTGGGAGGAGGGGG + Intergenic
1180776677 22:18490704-18490726 GGGTGGGAGGTGGGAGGAGGGGG - Intergenic
1180799050 22:18623391-18623413 CTCTGGTAGCTGGGAGGAGCAGG + Intergenic
1180809406 22:18748070-18748092 GGGTGGGAGGTGGGAGGAGAGGG - Intergenic
1180827591 22:18874925-18874947 GGGTGGGAGGTGGGAGGAGGGGG + Intergenic
1180962352 22:19767591-19767613 CTGGGGAGGTTGGGATGAGACGG - Intronic
1181072325 22:20353056-20353078 GGGTGGGAGGTGGGAGGAGGGGG - Intronic
1181118719 22:20650840-20650862 GTGTGGGAATTGTGGGGAGAAGG - Intergenic
1181195396 22:21181990-21182012 GGGTGGGAGGTGGGAGGAGGGGG - Intergenic
1181214051 22:21310784-21310806 GGGTGGGAGGTGGGAGGAGGGGG + Intergenic
1181222668 22:21371875-21371897 CTCTGGTAGCTGGGAGGAGCAGG - Intergenic
1181509235 22:23381681-23381703 CTGTGGCAGGTGGGAGGGAACGG + Intergenic
1181638429 22:24184864-24184886 CTCTGGTAGCTGGGAGGAGCAGG - Exonic
1182012263 22:27010825-27010847 GTGAGGAAGTTGAGAGGAGATGG - Intergenic
1182254818 22:29030779-29030801 GGGTGGGAGTGGGGAGGAGGAGG + Intronic
1182254866 22:29030987-29031009 CTTGGGGGGTTGGGAGGTGAGGG - Intronic
1182645434 22:31805162-31805184 CTGTGGGAGTTGGGAATAGAAGG - Intronic
1182821530 22:33220952-33220974 CTGTGGGAGTGAGAAAGAGAGGG - Intronic
1183099555 22:35575507-35575529 GTGTGGGAGGGAGGAGGAGATGG - Intergenic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1183299896 22:37053712-37053734 CTGTGGGTGGAGGCAGGAGAGGG + Intronic
1183377912 22:37475746-37475768 CTGCAGGAGTTGGAGGGAGAGGG + Intronic
1183424691 22:37733219-37733241 CTGTTGGAGGTGGGAGCAGAGGG + Intronic
1183506211 22:38210333-38210355 CTGTGTGGGCTGGGAGGAGCTGG + Intronic
1183736607 22:39648140-39648162 CTGTGAGAGCTGGAAGGACAGGG - Intronic
1183742022 22:39674114-39674136 CTCTGGCAGATGTGAGGAGAAGG - Intronic
1183786316 22:40031034-40031056 CTCTGGCAGTGGGGAGGGGAAGG + Exonic
1184178274 22:42802105-42802127 CTGTGGGAAGAGTGAGGAGAGGG + Intronic
1184496862 22:44847035-44847057 TCGAGGAAGTTGGGAGGAGAAGG + Intronic
1184800295 22:46754892-46754914 CAGTGGGGGTGGGGAGGGGATGG - Intergenic
1184820082 22:46903569-46903591 CTGAGGGAGTTGCGAGGAATCGG + Intronic
1203231482 22_KI270731v1_random:113149-113171 GGGTGGGAGGTGGGAGGAGGGGG + Intergenic
1203277688 22_KI270734v1_random:100915-100937 GGGTGGGAGGTGGGAGGAGGGGG + Intergenic
949628155 3:5891348-5891370 CTGTGGGACTAGGGAGTAAATGG + Intergenic
950297102 3:11841725-11841747 CTGCTGGAGTTGGGGGGAAAAGG - Intronic
950438032 3:12992342-12992364 GGGTGGGGGGTGGGAGGAGATGG + Intronic
950456811 3:13097578-13097600 GTGCGGGAGTTGGGAGGTGGGGG - Intergenic
951180386 3:19652620-19652642 CTCTGGGAGTAGGGAGGATTAGG + Intergenic
951532746 3:23713037-23713059 CTGTGGGGGTTGGGGAGAGAAGG - Intergenic
951765033 3:26188169-26188191 GTGTGGTGGTTGGGTGGAGAGGG + Intergenic
952331464 3:32367736-32367758 CTGTGGGAGGGTGGGGGAGAAGG - Intronic
952886517 3:38015803-38015825 CTCTGGGAGTTGGGAGGCCATGG - Intronic
953150414 3:40319468-40319490 CTGAGGGAGATGGGTGGTGAGGG - Intergenic
953162250 3:40432108-40432130 CTTTGAAATTTGGGAGGAGATGG + Intergenic
953381518 3:42476223-42476245 CTGTGGGAGTTTGCAGAGGATGG + Intergenic
953613733 3:44470670-44470692 CTCTGGGAGGTGGGATGAAAGGG + Intronic
953885548 3:46712692-46712714 CTGTTGGAGGTGAGAGGAGTGGG - Intronic
954132804 3:48568856-48568878 CTGTGGGAGTGACCAGGAGAGGG + Intronic
954182004 3:48888631-48888653 CTGTAGGACTTGGGTGCAGAAGG - Intronic
954858114 3:53664190-53664212 ATGAGGGAGGTGGGAGGGGAAGG - Intronic
955667250 3:61363833-61363855 CTGATGGAGTTGGGAGGAAATGG + Intergenic
955756610 3:62231124-62231146 CTGTGTTAGATGGGAGGGGAGGG + Intronic
956085327 3:65602530-65602552 CTGTGGGAGTTAGAAGGAAATGG + Intronic
956167200 3:66405779-66405801 CTGCAGGCCTTGGGAGGAGATGG - Intronic
956600893 3:71021196-71021218 GGCTGGGAGTTGGGAGGAAATGG - Intronic
956656864 3:71560893-71560915 CTGAGGGAGTTGGAAGGAAATGG + Intronic
956853061 3:73248991-73249013 CTGGGAGAGGTGGGAAGAGAGGG + Intergenic
956973440 3:74553082-74553104 CTGTGGGGGTTGGGGGGCTAGGG - Intergenic
958138800 3:89533484-89533506 CTGTGGAAAATTGGAGGAGAGGG - Intergenic
959023611 3:101215550-101215572 TAGTGGGAGCTGGGAGGTGAAGG - Intergenic
959358976 3:105366819-105366841 CCGGGGAAGTGGGGAGGAGACGG + Intergenic
959453256 3:106528733-106528755 CTTTGGGGGTTGGGGGGTGAGGG + Intergenic
959908772 3:111739488-111739510 CTGTGTGTGTTTGGAGGAGGAGG + Intronic
959946704 3:112133054-112133076 CTGTGGGAGAGCAGAGGAGATGG - Intronic
960423869 3:117482358-117482380 CTGTGGGACTTGAGAGGAAGAGG + Intergenic
960615080 3:119589143-119589165 CTGTGGGAGGAGTGAGGAGAAGG - Exonic
960772364 3:121208905-121208927 TTGTGGGGGTTGGGAGGCTAGGG - Intronic
960884727 3:122382975-122382997 CTGTAGGAGGAGGGAGGAGGGGG - Intronic
960915858 3:122694179-122694201 CTGTGGGAAATGGGAGGAAAGGG + Intronic
961218129 3:125177640-125177662 CTATGGGGGTTAGGGGGAGATGG + Intronic
961479065 3:127167867-127167889 CAGGGGCAGGTGGGAGGAGATGG - Intergenic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961958178 3:130825845-130825867 CTCTGGGAATTGGGAGGAGGGGG + Intergenic
962426254 3:135271559-135271581 CAGAGGGAGTTGGGGGCAGAAGG + Intergenic
963051421 3:141147071-141147093 CAGTGGGGGCTGGGATGAGAAGG + Intronic
963201112 3:142586800-142586822 GAGTAGGAGTTTGGAGGAGAGGG + Intergenic
963421010 3:145061235-145061257 CTGGTGGAGTTGTGAGAAGAGGG - Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964207058 3:154186004-154186026 CTGTGAGTGTTGGGAGGGAAAGG + Intronic
965630430 3:170727033-170727055 AAGTGGGAGTTGGGAGAATAGGG - Intronic
967387461 3:188925708-188925730 GTGTGGGAGGTGGGAGGAGTGGG + Intergenic
967605196 3:191436675-191436697 TAGTGGGAGATGGGAGGAGAGGG - Intergenic
967732854 3:192922015-192922037 ATTTGGGAGTTGGGAGTAGAAGG - Intergenic
967754849 3:193157226-193157248 CGGGGGGAGTGGGGAGGAGGGGG - Intergenic
967784984 3:193483255-193483277 ATGGGGGAGTTGGGAGGAAGCGG + Intronic
968084630 3:195868811-195868833 CGGGGGGAGTTGGGAGTGGAGGG - Intronic
968522404 4:1039910-1039932 CTGGGGGCCTTGGGAGGGGAGGG + Intergenic
968585526 4:1414465-1414487 CTGCAGGAGGTGGGTGGAGATGG + Intergenic
968585567 4:1414587-1414609 CTGCAGGAGGTGGGTGGAGATGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968658547 4:1789280-1789302 CTGGGGAAGGTGGTAGGAGATGG + Intergenic
969010085 4:4054860-4054882 CTGGGGGAAAGGGGAGGAGATGG - Intergenic
969112360 4:4851973-4851995 CTGAGGGACTGGGGAGGGGAGGG - Intergenic
969142154 4:5085990-5086012 CAGTGCTACTTGGGAGGAGAAGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969325554 4:6441935-6441957 CTGCAGGAGTAGGGCGGAGAAGG - Intronic
969478599 4:7434979-7435001 CTGTGGGAGTGGCCAGGAGGTGG - Intronic
970230402 4:13904151-13904173 GTGTGGGGGTGGGGAGGAAAAGG + Intergenic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
970432241 4:15999948-15999970 CGGTGGGAGTTGGACTGAGAGGG + Intronic
970573683 4:17407003-17407025 CTTGGGGAGGTGGGAAGAGAGGG - Intergenic
971303976 4:25464332-25464354 CTGCTGGAGTTAGGAGGAGCTGG + Intergenic
971362280 4:25949319-25949341 CTGTGGGGGGTAGGAGGAAAGGG + Intergenic
971426808 4:26524183-26524205 CTGAGGGAGCTGGGGGGAGCTGG - Intergenic
973030108 4:45326876-45326898 GGGTGGGTGTTGGGAGGTGATGG + Intergenic
973302810 4:48607616-48607638 GAGTGGGAGTGGGGAAGAGAAGG - Intronic
974791349 4:66694091-66694113 TTGTGGGAGTTGGTTAGAGAAGG - Intergenic
975082005 4:70292408-70292430 TGATGGGAGTTGGGAGGGGATGG + Intergenic
975799313 4:78042874-78042896 CTGTGGATGTTGGAAGGAGCAGG - Intergenic
975814283 4:78201827-78201849 CAGTGTGAGTTGGGAGAAAAGGG + Intronic
976113664 4:81703441-81703463 CTGTGAGTGTTGGGAGCCGAAGG - Intronic
978249535 4:106613474-106613496 GTGTTGGAGTTGGTAGGAAAGGG - Intergenic
978629712 4:110730324-110730346 CTGTCGGGGTGGGGAGGGGAGGG - Intergenic
978940972 4:114435348-114435370 CTTAGGGAGGTGGGAGGAGCAGG - Intergenic
979537592 4:121841227-121841249 GTTTGGGAGTGGGAAGGAGAGGG + Intronic
979578937 4:122332777-122332799 CTGTGGGGGGTGGGGGGAGGGGG - Intronic
979776572 4:124596023-124596045 CTGTGGGGGTTGGAGGGAGCAGG + Intergenic
980037218 4:127899386-127899408 CTGTGGGGGATGGGAGGTTAGGG - Intergenic
980480801 4:133385183-133385205 CGGTGGGAGTTGGGAATAGGAGG + Intergenic
981728427 4:147872152-147872174 CTGAGGAAGTTGGGTGGTGAGGG + Intronic
983123366 4:163916745-163916767 CTGTGGGGGTAGGGAGAATATGG - Intronic
983372074 4:166873096-166873118 CTGGTGGTGTTGGGAGGTGAGGG - Intronic
983685770 4:170407072-170407094 CTTTGGGATGTGGGAGGAAACGG - Intergenic
984710651 4:182881331-182881353 GGGTGGGAGCAGGGAGGAGAGGG - Intergenic
985140975 4:186840512-186840534 GAGAGGGAGTGGGGAGGAGAAGG - Intergenic
985988483 5:3536681-3536703 CTGTGGGAGTGTGGACGGGAGGG + Intergenic
986551653 5:8962758-8962780 CTGTGGGGTTTGGGGGGATAGGG - Intergenic
986685500 5:10272459-10272481 CTGTGGGTGGAGGGAGCAGAAGG - Intergenic
986814507 5:11393931-11393953 CTGCAGGAGTTGTGAGGTGATGG - Intronic
986868622 5:12019788-12019810 CTGTAGGAGGTGGAAGCAGAGGG - Intergenic
987021543 5:13877905-13877927 CTGTGGAAGTTGTGCAGAGACGG + Intronic
987085228 5:14461631-14461653 ATGGTGGAGTGGGGAGGAGAGGG - Intronic
989045828 5:37272580-37272602 CTGTGGGAATTGGGAGGCTTGGG - Intergenic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
991212109 5:64117848-64117870 GTATGAGAGTTGGAAGGAGAGGG - Intergenic
991236372 5:64403653-64403675 CTGGGGGCTTTGGGAGGAAATGG + Intergenic
992005442 5:72472926-72472948 CTGTGGGAGTTGAGAGGAAGGGG - Intronic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992158536 5:73978539-73978561 CCGTGGAAGTGGGGTGGAGATGG + Intergenic
992474011 5:77084741-77084763 CTGTGGGGCATGGGAGGGGAAGG - Intronic
993052575 5:82943011-82943033 CTTTGGAGGGTGGGAGGAGAGGG - Intergenic
993653432 5:90550446-90550468 GTCAGGGAGTGGGGAGGAGATGG + Intronic
994095857 5:95846803-95846825 CTGTGGTAGTTGGAAGGCCATGG + Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994900397 5:105762563-105762585 CTGGGGGAGCTGTGAGAAGAGGG - Intergenic
995453854 5:112331722-112331744 CTGATGGAGTTGGGAGGCAAGGG + Intronic
996222433 5:120950051-120950073 CTAGGGGAGCTGTGAGGAGAGGG + Intergenic
996937543 5:128965791-128965813 CTGTCGCGGTTGGGAGGCGAGGG + Exonic
997239716 5:132297358-132297380 CTCTGGTGGTTGGGAGGAGGAGG + Intronic
997526093 5:134554199-134554221 CTGTGGGGATTGGAAGGGGAGGG + Intronic
997949552 5:138231277-138231299 CCCTGGGAATTGGGAGGAGTGGG - Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998157449 5:139795112-139795134 CTGAGGGAGGCGGGAGGTGAGGG - Intergenic
998205272 5:140153180-140153202 CTGGGGGAGGGGTGAGGAGATGG - Intergenic
998383535 5:141742705-141742727 CAGTGGGAAGTGGGAGGGGAGGG + Intergenic
998416799 5:141952116-141952138 CTATGGGAGTAAGAAGGAGAAGG + Intronic
998586269 5:143431037-143431059 ATGTGGGAGGAGAGAGGAGAAGG + Intronic
998662025 5:144249417-144249439 TTGTGGGAGAGGGGAGGGGAAGG - Intronic
998960507 5:147481515-147481537 CTGTGAGACTTGGGAGGTGTGGG - Intronic
999149519 5:149417474-149417496 CGATGTGAGATGGGAGGAGAGGG - Intergenic
999268163 5:150280530-150280552 GTGTGGGAGGTGGGAAGAGGAGG - Intronic
999299443 5:150482074-150482096 CTGTGGGAATGTGGAGGGGAAGG - Intergenic
999362758 5:150999641-150999663 CTGTGGGAGTAGGGAGCACAGGG - Intergenic
1001040994 5:168335087-168335109 CTGAGGGAGCTGTGAGGTGAGGG + Intronic
1001456770 5:171868177-171868199 TTGTGGTAGTGGGGAAGAGAGGG + Intronic
1001711804 5:173784773-173784795 CTGTGGGAGATGAGTAGAGATGG + Intergenic
1001963562 5:175894917-175894939 CTGTGGGAGTTGTGTGTTGAGGG - Intergenic
1002060143 5:176621052-176621074 AGGTGGGAGCAGGGAGGAGAGGG - Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1003016225 6:2469508-2469530 CTGTGGGACGTGGGAGCAGTGGG + Intergenic
1003303803 6:4908536-4908558 CTGTGGGGGGCAGGAGGAGAGGG - Intronic
1003500876 6:6701798-6701820 ATGTTGGTGCTGGGAGGAGAAGG - Intergenic
1003571413 6:7258710-7258732 CTGGGGAAGTCGGGAGGAAATGG + Intergenic
1003943242 6:11049248-11049270 CTGTCGGGGTTGGGGGGTGATGG - Intergenic
1005002812 6:21259801-21259823 TGGTGTGAGTTGGGAGCAGATGG + Intergenic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006136152 6:31897453-31897475 GTGTGGGAGGTGGGGGGAGTGGG - Intronic
1006269688 6:32954363-32954385 CTGTGGGAGTGGGAAGGTGGAGG + Intronic
1006405639 6:33843298-33843320 TTGTGGGAGCTGGCAGGAGTGGG + Intergenic
1006718062 6:36132559-36132581 CAGGAGGAGGTGGGAGGAGAAGG + Intronic
1006728252 6:36215622-36215644 CTGTAGGAGTTGGGCTGAGCTGG + Intronic
1006915271 6:37589870-37589892 CTGTGGGGGGTGGGAAGAGAAGG - Intergenic
1006989751 6:38204549-38204571 CTGGGGGGATTGGGAGGTGATGG + Intronic
1007091567 6:39187957-39187979 CTGTGTGTGATGGCAGGAGAGGG + Intergenic
1007371954 6:41431953-41431975 CTGGGAGAGGTGAGAGGAGATGG + Intergenic
1007394609 6:41570408-41570430 AGGTGGGAGGTGGGAGGAGCTGG + Intronic
1007453050 6:41954640-41954662 CTTTGGGAGGTGGAAGCAGAAGG - Intronic
1007829741 6:44629336-44629358 CAGGGTGAGATGGGAGGAGAGGG - Intergenic
1007839091 6:44701123-44701145 CTGTGGGGGCTGGATGGAGAGGG + Intergenic
1007903932 6:45439964-45439986 CAGTGAGAGTTAGGAGTAGAGGG + Intronic
1008174242 6:48247092-48247114 TAGTGGGAGGTGGGGGGAGAAGG + Intergenic
1008400738 6:51059731-51059753 CTATGGGAGTTTGCAGGACATGG - Intergenic
1008838672 6:55869956-55869978 GTGTGGGAGTGGTAAGGAGAGGG + Intronic
1009760664 6:68001332-68001354 CAGTGGGAGTGAGGAGGAGGTGG - Intergenic
1012570099 6:100713640-100713662 GTGTGGGAGTAGGGAGCACATGG + Intronic
1013328558 6:109073490-109073512 CTGTGGGTCTTAGGAGAAGACGG - Intronic
1013653302 6:112218761-112218783 ATGTGGGAGATGGGAAGAAAAGG + Intronic
1013803999 6:113976637-113976659 CTGTGGGAGTTGGGGGCAAGAGG + Intronic
1013998344 6:116335969-116335991 CTGTGGGAGTCTGGTGCAGAAGG + Intronic
1014207651 6:118673594-118673616 CTGTGGGAGTAGGGCAGAGGTGG - Intronic
1014883034 6:126746404-126746426 CTGTTGGAGCTGTGAGAAGAGGG - Intergenic
1015135681 6:129867214-129867236 CTCTGGCAGTTGGGAGTAAAAGG + Intergenic
1015636442 6:135279523-135279545 CAGCGGGAGTTGGCAGGAGGAGG + Intergenic
1016700888 6:147052926-147052948 CTGAGGGAGATGGGAGGAATTGG - Intergenic
1016792604 6:148081085-148081107 CTGAGGGAGTTGGGCAGAGTTGG + Intergenic
1017446338 6:154510298-154510320 CTGTGGCAGCTGGAGGGAGAGGG - Exonic
1017712813 6:157185113-157185135 CTCTGTCAGTGGGGAGGAGAGGG - Intronic
1018043349 6:159944454-159944476 CTGGAAGAATTGGGAGGAGAAGG + Intergenic
1018243288 6:161799441-161799463 CTCTGGCAGATGGGGGGAGATGG - Intronic
1018429725 6:163713473-163713495 AGGTGGGGGTAGGGAGGAGAGGG - Intergenic
1018668829 6:166163216-166163238 CTGTGGGTGGCAGGAGGAGAAGG - Intronic
1019016866 6:168886282-168886304 CTTGAGGAGGTGGGAGGAGAAGG + Intergenic
1019437362 7:1028896-1028918 CTGGGGGAGATGGGGGGACATGG - Intronic
1019475956 7:1244312-1244334 ATGTGTGAGTTGGGAGGGGCGGG + Intergenic
1019729537 7:2622636-2622658 CAGTAGGAGTTGAGAGGAGGAGG - Intergenic
1020053925 7:5103749-5103771 TTGTAGGAAATGGGAGGAGACGG - Intergenic
1020671987 7:11127572-11127594 CCCTGGGAGTTTGGAGGACAAGG - Intronic
1020899804 7:13990442-13990464 CTGTGGCTGTGGGGAGGAGGAGG + Intronic
1021441707 7:20684927-20684949 CAGGAGGAGATGGGAGGAGAAGG - Intronic
1021541147 7:21760117-21760139 CTGGTGGGGGTGGGAGGAGAAGG + Intronic
1021599491 7:22350679-22350701 GTGTGGGGGTTGGGAGGGAAAGG + Intronic
1021773172 7:24025399-24025421 AGGTGGGAGTTGGGAGGATTAGG + Intergenic
1021990614 7:26137934-26137956 TTGTTGGGGGTGGGAGGAGAAGG + Intergenic
1022050542 7:26664418-26664440 CCATGGGAGCTGGGAGGGGAGGG + Intergenic
1022119814 7:27297383-27297405 CAGAGGGCGATGGGAGGAGACGG - Intergenic
1022444377 7:30457730-30457752 CTGTGGGGTTTGGTGGGAGACGG + Intronic
1022652135 7:32287314-32287336 CTGTGGCTGGAGGGAGGAGATGG - Intronic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023280076 7:38560305-38560327 CTGGGGCGGTTGGGATGAGATGG - Intronic
1023384755 7:39645306-39645328 GTGTGGGAGGTGGGGGCAGAAGG + Intronic
1024527150 7:50358408-50358430 CTGTGGGACGGGGCAGGAGAGGG + Intronic
1024754406 7:52512733-52512755 CTGTGGGTGATGTGATGAGAGGG - Intergenic
1024904332 7:54359344-54359366 TTGTTGAAGATGGGAGGAGATGG - Intergenic
1025245292 7:57312505-57312527 GAGTGGGAGGTGGGAGGTGAGGG + Intergenic
1025940400 7:66072739-66072761 CTGTGGGAGAAGACAGGAGAGGG + Intergenic
1026101867 7:67390380-67390402 CTGGGAGAGTTGTGGGGAGAGGG + Intergenic
1026320371 7:69262721-69262743 TTGTGGGAGATGGGAGTAAATGG - Intergenic
1026391416 7:69906381-69906403 GAGTGGGAAGTGGGAGGAGATGG + Intronic
1027733384 7:81903539-81903561 CTGTGGAACTTGGGAGGACCTGG - Intergenic
1028930592 7:96408881-96408903 TTGTGGTTGTTGGCAGGAGATGG + Intergenic
1029195800 7:98804490-98804512 CTGTGGCAGAGGGGAGGAGGGGG - Intergenic
1029196026 7:98806027-98806049 CAGTGGGAGTTGGAATCAGAGGG + Intergenic
1029513841 7:101013723-101013745 CTGAGGGAGTTGGGGGGACCTGG - Intronic
1029610092 7:101622201-101622223 CTGTGGGAGGTGAGAGGTGGGGG + Intronic
1029712896 7:102309185-102309207 CACTGGGAGTTGGGCAGAGATGG + Intronic
1030654168 7:112147995-112148017 CAGTGGGAGTGTGGAGGAGAGGG - Intronic
1032290262 7:130583341-130583363 CTGTGGGGGGTGGGGGGAGTGGG + Intronic
1032322734 7:130899245-130899267 TTATGGGGGGTGGGAGGAGATGG + Intergenic
1032424076 7:131806494-131806516 CAGTAGGAGTTGGGGAGAGAGGG + Intergenic
1032629692 7:133635319-133635341 TTGTGGGATTTGTGGGGAGAAGG + Intronic
1032806740 7:135362810-135362832 CTGTGGGTGGTGGGCTGAGAGGG + Exonic
1033406423 7:141074199-141074221 CTGGGGGAGGGGGCAGGAGAGGG - Intergenic
1033432106 7:141298993-141299015 CTGCAGGAGATGGGAGTAGAAGG + Intronic
1033506546 7:142008287-142008309 GGGAGGGAGTTGGGAGTAGAAGG + Intronic
1033735452 7:144217415-144217437 CTGTGGCAGTGGAGAGGATATGG + Intergenic
1033747602 7:144333554-144333576 CTGTGGCAGTGGAGAGGATATGG - Intergenic
1033906408 7:146210026-146210048 CTGGGGGAGAAGGGAGGAGGTGG - Intronic
1034362768 7:150515078-150515100 CTGTGGGAGGGGTGAGTAGAAGG + Intronic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035039772 7:155919436-155919458 CTGTGGGATGTGGGAGCAGCAGG + Intergenic
1035487140 7:159234841-159234863 CTCTTGTAGATGGGAGGAGAGGG - Intergenic
1035596741 8:864183-864205 CTAGGGGAGGTGGGAGGACAGGG + Intergenic
1035658546 8:1330129-1330151 CTGTGGGAGTGAGGAGGTGGTGG + Intergenic
1036235397 8:7035472-7035494 GTATGGGGGCTGGGAGGAGAGGG - Intergenic
1036618990 8:10410411-10410433 CTGTGGGAATTATGAGGTGATGG - Intronic
1036630531 8:10511145-10511167 GTGTAGGAGGTGGGAGGAGGGGG - Intergenic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1037270184 8:17118551-17118573 CTGGGGGACTGGGGAGGAAAGGG - Intronic
1037425182 8:18747899-18747921 CGGTGGAAGGTGGGAAGAGAAGG + Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037700692 8:21271645-21271667 CTGTGGGAAAGGGGAGGAGGAGG - Intergenic
1037899351 8:22678434-22678456 CTGGGAGGGTTGGGAGGAGATGG + Intergenic
1038126932 8:24685121-24685143 CTGTGGGGGGTGGGGGGAGGGGG + Intergenic
1038258576 8:25972944-25972966 GGGTGGGAGTTGGGGAGAGAGGG - Intronic
1038426164 8:27465268-27465290 CTGTGGGAATTAGAAGGGGAGGG - Intronic
1038781951 8:30575625-30575647 CTGTGGGAGTTGTGGTGGGATGG - Intergenic
1039588094 8:38723712-38723734 CTGGGGGCGTGGGGAGCAGAGGG - Intergenic
1039674045 8:39640179-39640201 CTGTTGGAGGTTGGAGGAGTGGG - Intronic
1039882548 8:41634079-41634101 CAGTGGGAGGTGGGAGGGGAGGG - Intergenic
1041285693 8:56259190-56259212 CTAAGAGAGTTGGGAGGAAATGG - Intergenic
1041460276 8:58103774-58103796 CTGTGGGAGGCAGGAGGAGAAGG - Intronic
1041698566 8:60763002-60763024 CAGGGGGAGGTGGGAGAAGATGG + Intronic
1042651407 8:71045920-71045942 ACGTGGGAGTCGGGAGGAGATGG + Intergenic
1042702647 8:71633455-71633477 GTGTGTGTGTTGGGGGGAGATGG + Intergenic
1042782374 8:72506124-72506146 CTTTGGGATGTGGGAGGAAATGG - Intergenic
1043064242 8:75546507-75546529 GGGAGGGAGTTGGGAGGAAATGG - Intronic
1043401172 8:79885643-79885665 CTGTGGAAAGTGGGAGGTGAAGG + Intergenic
1043555045 8:81420956-81420978 CTGTGGGACATGGGGGCAGAGGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044944959 8:97381191-97381213 CTGGGGGAGGTGGAAGGACAGGG - Intergenic
1045220249 8:100192078-100192100 CTGTGGGACTTGGGAGCAAGGGG - Intronic
1045414496 8:101952623-101952645 CTGTGGGCTTTGGGAGCTGATGG - Intronic
1045414660 8:101953861-101953883 CTGTGGGCTTTGGGAGCTGATGG + Intronic
1045520158 8:102896477-102896499 CGGGGGGAGTTGGGAGGGAATGG + Intronic
1045815362 8:106271075-106271097 CTGAGGGATTTGGGTGAAGAGGG + Intronic
1046449959 8:114375904-114375926 GTGAGGGAGTGGGGGGGAGAAGG - Intergenic
1046623098 8:116548452-116548474 ATGTGGTTGTTGGGAGGGGAAGG - Intergenic
1047529826 8:125664729-125664751 ATGAGAGAGTTGGGAGGAAAAGG - Intergenic
1047625825 8:126655070-126655092 CTTTGGGAGATGGGGGCAGAAGG + Intergenic
1048070691 8:131017595-131017617 GTGTGGGGGTGGGGAGTAGATGG - Intronic
1048082320 8:131142010-131142032 ATGTGGGAGGAGGGAAGAGAAGG + Intergenic
1048461085 8:134622640-134622662 CCTTGGGAGCTGGGTGGAGAGGG - Intronic
1048938961 8:139380219-139380241 ATGTTGGAGCTGGGAGGAGCAGG + Intergenic
1049039682 8:140103070-140103092 CTGTGGGAGTGGGGAGCGGCAGG - Intronic
1049050091 8:140187922-140187944 CTGTGGGATTTGGGAGGCCAAGG - Intronic
1049133609 8:140872648-140872670 CTGTGGGGATTGGGAAGAGCTGG + Intronic
1049304486 8:141893708-141893730 CTGAGGGGGTGGGGAGGAGCTGG - Intergenic
1049578711 8:143401172-143401194 CTGTGGGAGGTGGGAAAAGGGGG + Intergenic
1049662349 8:143825101-143825123 CTGTGGGGGTCGGGAGATGATGG + Intronic
1049665498 8:143840964-143840986 CTCTGGGAATTGGGAGGCGCGGG + Exonic
1049784321 8:144443419-144443441 CTGTGGGGGTTAGGGGGAGCAGG - Intronic
1049839809 8:144763680-144763702 CTGTGGGGGTAAGGAGGAGAAGG + Intergenic
1050120153 9:2299658-2299680 CTGTGGAAGGTTGGAGGAGAGGG + Intergenic
1050158213 9:2690366-2690388 CTTTGGGGGCTGGGTGGAGAAGG + Intergenic
1050306244 9:4308514-4308536 CTCAGGGAGGAGGGAGGAGAGGG - Intronic
1051184040 9:14439962-14439984 GGGTGGGAATTGGAAGGAGAGGG + Intergenic
1051278852 9:15421940-15421962 CTGGAGGAGTTGGGAGGATCAGG + Intergenic
1051512383 9:17892798-17892820 ATGTGGGAGTGGGGAGGTGATGG - Intergenic
1051745684 9:20292838-20292860 CTTTGGGATTTGGGAGGCCAAGG - Intergenic
1053286245 9:36851216-36851238 CTGGGGATGTTGGGTGGAGATGG + Intronic
1053303655 9:36969189-36969211 CAGCGGGAGTTGTTAGGAGATGG - Intronic
1054151704 9:61611110-61611132 CTATTGGAGCTGTGAGGAGAGGG - Intergenic
1054856875 9:69909980-69910002 CTGTGGGAATTGGGAGGGAATGG - Intergenic
1055856250 9:80691710-80691732 CTGGTGGAGCTGGGAGAAGAGGG + Intergenic
1057020973 9:91697467-91697489 CTGGGGAAGGTGGGTGGAGAGGG + Intronic
1057144731 9:92750113-92750135 CTCTGGGGATTGCGAGGAGATGG - Intronic
1057268843 9:93635919-93635941 CTGGGGAGGTGGGGAGGAGACGG + Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058075459 9:100646028-100646050 CTGTGAGGGGTGGGGGGAGAGGG - Intergenic
1058205410 9:102100016-102100038 CTGTGGCAGTTGGCAACAGAGGG + Intergenic
1058211324 9:102173675-102173697 CTTTGCGAGTTGAGAGAAGAAGG - Intergenic
1058425058 9:104868975-104868997 AGGTGGGAGGAGGGAGGAGAGGG + Intronic
1058471585 9:105284931-105284953 AAGTGGGAGTTGAGAGGAAATGG - Intronic
1059057909 9:111003757-111003779 TTGTGGGAGTTAAGGGGAGATGG + Intronic
1059433640 9:114264217-114264239 GTGTGGGAAGTGGGAGGAGGAGG + Intronic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1060200375 9:121648937-121648959 CGGCGGGAGGTGGGAGCAGATGG + Intronic
1060743275 9:126113448-126113470 ATGTGGGAGTTGGGGGACGATGG + Intergenic
1060757113 9:126222367-126222389 TTGGGAGAGTTGGGAGGGGAAGG - Intergenic
1060863238 9:126973754-126973776 TGCTGGGGGTTGGGAGGAGAGGG - Intronic
1060865672 9:126994186-126994208 CTTTGAGAGTTGAGAGAAGAAGG + Intronic
1060888552 9:127173537-127173559 TTGTTGGTTTTGGGAGGAGAGGG + Intronic
1061078767 9:128357539-128357561 CTGAGGGAGCTGGGAGACGAGGG + Intronic
1062031046 9:134362133-134362155 CTGTGCGGGTTGGGAGGGGATGG + Intronic
1062672911 9:137722496-137722518 CTGGGGGAGTCTGCAGGAGAAGG + Intronic
1062711522 9:137977718-137977740 CTGAGGGAGGAGGGAGGAGTGGG + Intronic
1062729679 9:138102008-138102030 CTGCGGGAGGGGGGAGGAGCTGG - Intronic
1203740325 Un_GL000216v2:172068-172090 GTGTGGGAGTGGGGAGGGGGTGG - Intergenic
1203746837 Un_GL000218v1:44778-44800 GGCTGGGACTTGGGAGGAGAAGG - Intergenic
1203563273 Un_KI270744v1:74702-74724 GGCTGGGACTTGGGAGGAGAAGG + Intergenic
1185912585 X:3998979-3999001 CTGTGGCAGATGGTAGTAGATGG + Intergenic
1186441478 X:9590845-9590867 CTGTGGGGGTGGGGAGGATGGGG + Intronic
1186875873 X:13817209-13817231 CAGTGGGAGTTGGGGGTAGGGGG + Exonic
1187192222 X:17045963-17045985 GTGTGGGGAATGGGAGGAGATGG + Intronic
1187463898 X:19512168-19512190 CTGTGGGGAGTGGGAGGGGAGGG + Intronic
1187548287 X:20275111-20275133 ATGTGGGAGGTGCGAGAAGAAGG - Intergenic
1187668966 X:21649716-21649738 GTGTGGGAGATTGAAGGAGAGGG + Intronic
1188506439 X:30889278-30889300 CTGAGGGAGGAGGGAGGAAAGGG - Intronic
1188515960 X:30986209-30986231 TGGTGGGAGTTGGGAGGAGTAGG + Intergenic
1189474131 X:41335467-41335489 ATGTGTGATTTGAGAGGAGAAGG + Intronic
1189638856 X:43045221-43045243 CTTTGGGATTTGGGAGGAAGTGG - Intergenic
1189921943 X:45910861-45910883 CTGTGTGTGTGGGGAGGGGAGGG + Intergenic
1190262326 X:48805267-48805289 CAGTGGCAGTGGTGAGGAGAGGG + Intronic
1191045343 X:56129987-56130009 CTGTGGGGGTTGGGAGGTTGGGG - Intergenic
1191760925 X:64647336-64647358 CTGTTGGAGCAGTGAGGAGAGGG + Intergenic
1191870023 X:65737988-65738010 CTGTTGGAGGTGGGAATAGAGGG + Intronic
1192166601 X:68830685-68830707 TTGAGGGAGGTGGGTGGAGAAGG + Intronic
1192223143 X:69211022-69211044 CTGTGGCAGCTGGGGGGAGATGG - Intergenic
1192263539 X:69523582-69523604 CTATGGGAACTGGGAGGGGAAGG - Intronic
1192360063 X:70433809-70433831 CAGGGGGAGATGGGAGGAGGTGG + Intergenic
1193091683 X:77500550-77500572 CTGTAGGGGTTGGGGGGTGAGGG + Intergenic
1193313026 X:80030021-80030043 TGGTGGGGGTTGGGAGGGGATGG + Intronic
1193862836 X:86692183-86692205 TTGGTGGAGGTGGGAGGAGATGG + Intronic
1195720862 X:107866770-107866792 CTGTAGTAGTTCGGGGGAGAGGG + Intronic
1195786146 X:108526138-108526160 AACTGGGAGCTGGGAGGAGAAGG + Intronic
1196866715 X:120077332-120077354 CTGAGGGTGTTGGAAGGAGGTGG + Intronic
1196876384 X:120158949-120158971 CTGAGGGTGTTGGAAGGAGGTGG - Intronic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197556787 X:127965072-127965094 CTGTTGGATTTGGGAAGGGATGG - Intergenic
1197616258 X:128695193-128695215 CTAAGGGACTGGGGAGGAGAGGG - Intergenic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1198156057 X:133961906-133961928 CTCTGGGACTTGGGTGGAGAAGG - Intronic
1198267250 X:135021532-135021554 CTCTGGGATTGGGGAGGAAATGG + Exonic
1198842519 X:140873417-140873439 GTGTGGGAGTTGGGCGGGGGGGG + Intergenic
1199027856 X:142961028-142961050 CTACTGGAGTTGTGAGGAGAGGG - Intergenic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1199664093 X:150082853-150082875 CTGGGGGATGTGGGAGCAGAGGG + Intergenic
1199928458 X:152494251-152494273 CTGTTGGAGCTGTGAGAAGAGGG + Intergenic
1200078738 X:153565185-153565207 CTGTGGGTGTCGGGTGCAGACGG - Intronic
1200091544 X:153638390-153638412 CTTTCGGTGCTGGGAGGAGATGG + Intergenic
1200122548 X:153798002-153798024 GTGTGGGGGTGGGGAGGGGAGGG - Intronic
1200218038 X:154377295-154377317 CTGGGGGAGTAATGAGGAGATGG - Intergenic
1201160160 Y:11159792-11159814 AGCTGGGACTTGGGAGGAGAAGG - Intergenic
1201489397 Y:14524606-14524628 CCGTGGCAGTGGGGAGGGGACGG - Intronic