ID: 936663683

View in Genome Browser
Species Human (GRCh38)
Location 2:114570486-114570508
Sequence CACAGTAGGCAGAATGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936663676_936663683 6 Left 936663676 2:114570457-114570479 CCCTTAGGTAGGAGCTTTGGCAA 0: 1
1: 1
2: 3
3: 70
4: 314
Right 936663683 2:114570486-114570508 CACAGTAGGCAGAATGATGGGGG 0: 1
1: 0
2: 1
3: 15
4: 226
936663673_936663683 18 Left 936663673 2:114570445-114570467 CCAACATAAGATCCCTTAGGTAG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 936663683 2:114570486-114570508 CACAGTAGGCAGAATGATGGGGG 0: 1
1: 0
2: 1
3: 15
4: 226
936663677_936663683 5 Left 936663677 2:114570458-114570480 CCTTAGGTAGGAGCTTTGGCAAT 0: 1
1: 0
2: 1
3: 9
4: 163
Right 936663683 2:114570486-114570508 CACAGTAGGCAGAATGATGGGGG 0: 1
1: 0
2: 1
3: 15
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936663683 Original CRISPR CACAGTAGGCAGAATGATGG GGG Intronic
901622707 1:10601545-10601567 CACAGAAGGCTGAATGGGGGAGG + Intronic
902529957 1:17084616-17084638 CACGGGAGGCAGGATGTTGGGGG + Exonic
904901916 1:33864477-33864499 AAGAGTAGGAAGGATGATGGAGG - Exonic
906291472 1:44622302-44622324 CACAGTTTGCAGCATGTTGGAGG + Intronic
906908555 1:49921790-49921812 CAAAGTAGGCAGAATAAGGTGGG - Intronic
910862944 1:91760893-91760915 CACACTATGGAGAATGAAGGAGG + Intronic
911622616 1:100082572-100082594 CACAGTAGGTAGTATGGTTGTGG + Exonic
914048928 1:144115150-144115172 CACAGTTGGCAGATTTATTGTGG - Intergenic
914130256 1:144850298-144850320 CACAGTTGGCAGATTTATTGTGG + Intergenic
915029195 1:152861669-152861691 CACAGAAGCCAGGATGAGGGAGG + Intergenic
915675422 1:157525639-157525661 TGCAGTAGTCAAAATGATGGTGG + Intronic
916403608 1:164475118-164475140 GACAGTGGGCAGAGGGATGGCGG + Intergenic
916696134 1:167238502-167238524 CACAGTAGGAAGACTGTTGAGGG - Intronic
917193245 1:172441133-172441155 CACAATAAGCAGAATGCTAGGGG - Intronic
917615188 1:176735505-176735527 CCCAGCAGGCAGATTGAAGGGGG + Intronic
918485400 1:185024104-185024126 CACAATAGGCAGAAAAAGGGTGG - Intergenic
918543656 1:185658612-185658634 CATGGTAGACAGAATGAGGGTGG - Intergenic
918693886 1:187517813-187517835 CACAGGAGGCAGAATCAAAGTGG + Intergenic
919108443 1:193186122-193186144 CGCAGGAGGCAGACTGTTGGGGG - Exonic
921237089 1:213144181-213144203 TACAGGAGGCAGAATAATGATGG - Intronic
921414540 1:214871026-214871048 CACAGTAGTGAAAATGCTGGTGG - Intergenic
1064721525 10:18234462-18234484 CACAATAGCCAAAAAGATGGAGG + Intronic
1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG + Intronic
1067477352 10:46575813-46575835 CACAGAAGGCAAGATGCTGGGGG + Intergenic
1067617388 10:47765971-47765993 CACAGAAGGCAAGATGCTGGGGG - Intergenic
1068828142 10:61462794-61462816 CACTGCAGACACAATGATGGAGG + Intergenic
1069942847 10:71966689-71966711 CACAGAGGGCATAATGAAGGTGG - Intronic
1070150150 10:73800447-73800469 CACGGTAGGCAGCATGCAGGTGG - Exonic
1071308908 10:84325287-84325309 CACAGAAGGCAGTCTGATGATGG - Intergenic
1079359058 11:19755282-19755304 CACAGCAGCCAAAATGGTGGAGG + Intronic
1081112825 11:39157960-39157982 TACAGTTGGCAGAAGGATTGTGG - Intergenic
1083022981 11:59526171-59526193 CACAGCAGGCAGATTGCTTGTGG - Intergenic
1086149633 11:83594257-83594279 CTCAGTACTCACAATGATGGAGG - Intronic
1087081776 11:94177805-94177827 CACAGAATGCAGAATGAATGTGG - Intronic
1087571185 11:99929245-99929267 CTCAGAAGACAGAAAGATGGGGG - Intronic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1087938474 11:104063703-104063725 CACGGGAGAGAGAATGATGGGGG + Intronic
1089071400 11:115702109-115702131 CTCAGTAGTCATAGTGATGGTGG + Intergenic
1089666492 11:120023550-120023572 CACAGCAGCCAGAAGTATGGAGG - Intergenic
1090479556 11:127056050-127056072 CATATTAGGCAGAAAGAAGGAGG - Intergenic
1091703172 12:2677422-2677444 GACAGCAGGCAGAACCATGGAGG - Intronic
1093246350 12:16742071-16742093 CACAGTTATGAGAATGATGGAGG - Intergenic
1095414457 12:41961075-41961097 CACAGTAGCCACATTGCTGGGGG - Intergenic
1096455020 12:51777705-51777727 CACAGTGTGGAGAATGAAGGAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096877912 12:54644883-54644905 CACAGAAGTCAGAGGGATGGAGG + Intronic
1098742675 12:74194017-74194039 CACAGTGGGCACACTGTTGGAGG - Intergenic
1100761613 12:97813382-97813404 CACAGTAGGGAAAAAGAGGGAGG + Intergenic
1100814288 12:98371108-98371130 CATAGTAGGTAGATTGATGTGGG + Intergenic
1101116183 12:101533781-101533803 CAGAGTAGTGAGAATCATGGAGG + Intergenic
1101202983 12:102456095-102456117 CACAGAAAGCAGAATTTTGGAGG + Intronic
1102281287 12:111620946-111620968 CTCAGTGGGGAGGATGATGGTGG - Intergenic
1102753820 12:115320684-115320706 CAAAGTAGGCTGAATGATGGGGG + Intergenic
1103076698 12:117989044-117989066 GACAGAAAGTAGAATGATGGTGG + Intergenic
1104763589 12:131312828-131312850 CACAGTGGGCAGGATGATGACGG - Intergenic
1104815911 12:131645249-131645271 CACAGTGGGCAGGATGATGACGG + Intergenic
1105356635 13:19665006-19665028 CACAGCAGGCAGAAGGCAGGCGG + Intronic
1105450349 13:20493713-20493735 CACAGTGGGCAGACTGGTTGAGG + Intronic
1107549175 13:41458590-41458612 CGCAGTAGGCCGAGTGGTGGCGG + Intronic
1108251740 13:48574435-48574457 CAAATGAGGAAGAATGATGGGGG - Intergenic
1108593659 13:51932528-51932550 AACAGTAGGGGGAATGAGGGTGG - Intergenic
1109584112 13:64375423-64375445 AAAAGAATGCAGAATGATGGAGG + Intergenic
1111958017 13:94779499-94779521 CACAGTCAGCAGGATGATAGTGG + Intergenic
1114644966 14:24250496-24250518 CTCAGCAGGAGGAATGATGGGGG - Intronic
1115434971 14:33362266-33362288 CACAGAAGGCAGAGTGATGAGGG + Intronic
1117834720 14:59791701-59791723 CACAGTAGAGTGAGTGATGGAGG - Intronic
1120451767 14:84677423-84677445 CATAATAAGCAGAATGATGCTGG - Intergenic
1120526520 14:85583240-85583262 CACAGTATACAAAATGAAGGTGG - Intronic
1121017114 14:90555587-90555609 CACAGTCGGCAGAATGGCGCTGG - Intronic
1121037993 14:90722515-90722537 GACCGATGGCAGAATGATGGTGG - Intronic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1125105627 15:35967888-35967910 CACAGAAGGTAGAAACATGGGGG - Intergenic
1125645297 15:41267427-41267449 CAAAGTAGGCAGATTGCTTGAGG + Intronic
1125840566 15:42797410-42797432 AGCAGGAGGCAGAAAGATGGAGG + Intronic
1126386642 15:48100314-48100336 GACCATAGGCAGCATGATGGAGG + Intergenic
1126808542 15:52378090-52378112 CAGAGGAGGCTGAAAGATGGAGG - Intronic
1129444956 15:75610490-75610512 CACAGCTGACAGGATGATGGGGG + Intronic
1129616410 15:77101797-77101819 CCCAGTAGTCAGCATGGTGGTGG - Exonic
1130056896 15:80533800-80533822 CACAGTGGGCAGAAGCCTGGGGG + Intronic
1132783427 16:1641490-1641512 CACAGCAGGCACAAAGGTGGAGG - Intronic
1133535991 16:6702948-6702970 GACAGAAAGCAGAATGCTGGTGG - Intronic
1135237997 16:20776423-20776445 CACAGTAGGCAAGAAGATTGGGG - Intronic
1136489889 16:30600438-30600460 CACAGCAGGGAGACTCATGGAGG + Intergenic
1136642288 16:31577106-31577128 CTCAGAAGGCAGAAAGATGTGGG + Intergenic
1138275329 16:55730152-55730174 CCCAGTTGGGAGAATTATGGAGG + Intergenic
1138370090 16:56519848-56519870 CACAGGCAGCAGCATGATGGCGG + Exonic
1140023016 16:71257118-71257140 CACAGAAGCCAGATTGATGGAGG + Intergenic
1142008506 16:87701775-87701797 CACAGACGGGAGAAGGATGGCGG - Intronic
1144471402 17:15545360-15545382 GACAGTAGTTGGAATGATGGGGG - Intronic
1144925068 17:18799333-18799355 GACAGTAGTTGGAATGATGGGGG + Intronic
1146397974 17:32483907-32483929 CTAAGTAGGCTGATTGATGGGGG + Intergenic
1146506503 17:33410209-33410231 AACAGTGGGCAAAATGATGAGGG + Intronic
1148783624 17:50134839-50134861 CAGAGACGGCACAATGATGGGGG + Exonic
1149542490 17:57478134-57478156 CACACTGGGCACATTGATGGCGG + Intronic
1149621874 17:58051466-58051488 AACTGGAGGCAGAATGTTGGAGG - Intergenic
1151317447 17:73331959-73331981 CACAGTAGCCTGAATGCTGAAGG + Intergenic
1151444965 17:74157475-74157497 CACAGCAGGCAGAAGGAGGTGGG + Intergenic
1152032353 17:77851776-77851798 GACAGTGGGCAGGAGGATGGCGG - Intergenic
1152483184 17:80570064-80570086 CACAGCAGCCAGAATGAGAGCGG - Intronic
1156595413 18:38542730-38542752 CACATGAAGCAGAATGAGGGAGG - Intergenic
1158714743 18:59868242-59868264 GACAATATGCAGAATAATGGAGG + Intergenic
1158842675 18:61405199-61405221 CACCTAAGGCAGAAAGATGGTGG - Intronic
1159184102 18:64947546-64947568 CACAGTAGGCACACTGATTCTGG + Intergenic
1159718405 18:71853837-71853859 CACAGTACTCAGGATGATGGGGG - Intergenic
1160942441 19:1626768-1626790 AACAGTAGCCATAGTGATGGAGG - Intronic
1161116826 19:2501874-2501896 CACAGAGCGCAGACTGATGGAGG - Intergenic
1162476123 19:10900398-10900420 CACAGAAGGCACACTGCTGGTGG - Intronic
1165429580 19:35764952-35764974 CGCAGTAGGAAGGGTGATGGGGG - Intronic
1166327491 19:42060038-42060060 CACAGCAGCCAGAATGATACGGG + Intronic
1202688379 1_KI270712v1_random:68053-68075 CACAGTTGGCAGATTTATTGTGG - Intergenic
925451453 2:3973044-3973066 CACAGCAGGCAGGAGGGTGGTGG + Intergenic
926442781 2:12907582-12907604 TACAGTAGAAAGAATGGTGGGGG - Intergenic
927534030 2:23837602-23837624 TACAGCAGGCATGATGATGGTGG + Intronic
929759168 2:44791842-44791864 CCCAGGAGTCAGAATGAAGGAGG - Intergenic
933958045 2:87387879-87387901 CACAGTTGGCAGATTTATTGTGG + Intergenic
934242166 2:90279797-90279819 CACAGTTGGCAGATTTATTGTGG + Intergenic
934271006 2:91536891-91536913 CACAGTTGGCAGATTTATTGTGG - Intergenic
935731593 2:106068659-106068681 CACAGAAGGCAAACAGATGGAGG + Intronic
936663683 2:114570486-114570508 CACAGTAGGCAGAATGATGGGGG + Intronic
941633466 2:167909448-167909470 TGCAGTAGGCAGAATAATGACGG - Intergenic
943510527 2:188820625-188820647 CAGAGTAGGCATAATGATCTGGG - Intergenic
947107156 2:226679580-226679602 GACAGTATGCAGCCTGATGGTGG - Intergenic
948550233 2:238766049-238766071 CACAATAGGCAGAAAGGAGGAGG + Intergenic
948706884 2:239800128-239800150 CACTGGAGGCAGAATGGTGTGGG + Exonic
948832789 2:240606454-240606476 GACAGTGGGCAGCAAGATGGTGG - Intronic
1168903830 20:1388722-1388744 CACAGTAGCCAGAAGGAGCGTGG + Intronic
1169475521 20:5928015-5928037 CACAGTTGGCAGCTTAATGGTGG + Intergenic
1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG + Intronic
1173226176 20:41163576-41163598 CACAGTAGGTAGAAACAAGGTGG - Intronic
1174516804 20:51098862-51098884 CACATTCTGTAGAATGATGGAGG + Intergenic
1175004935 20:55671832-55671854 CACAGAAGGGAGAATGTTTGAGG + Intergenic
1175419635 20:58823146-58823168 CTCAGTTGGCAGCAGGATGGAGG - Intergenic
1178491413 21:33054869-33054891 CACATTAGTGAGATTGATGGTGG - Intergenic
1179136565 21:38684879-38684901 CTCACTTGGCAGAAAGATGGTGG + Intergenic
1180281956 22:10708127-10708149 CACAGCAGGCAAAACCATGGGGG + Intergenic
1182423919 22:30262120-30262142 CACATGAGGCAGGATGCTGGTGG + Intergenic
1182533286 22:30979699-30979721 CACATTAGGCAGAAAGCAGGGGG + Intergenic
1183321439 22:37167343-37167365 CTCAGGAGGCAGAGAGATGGTGG - Intronic
1183983407 22:41555724-41555746 CACTGCAGGCAGAAGAATGGGGG - Intergenic
950163714 3:10778583-10778605 CACAGAAGGCAAGATGATCGTGG - Intergenic
952583322 3:34861503-34861525 TACAGTTAACAGAATGATGGCGG - Intergenic
954601892 3:51876597-51876619 CTCAGGAGCCAGACTGATGGAGG - Intergenic
955474928 3:59326796-59326818 GCCAGTAGGCCAAATGATGGCGG - Intergenic
956746059 3:72311697-72311719 CACAGCAGCCAGAATGGAGGAGG + Intergenic
958911940 3:100004080-100004102 CTCAGTAGGCCGAATCAAGGTGG - Intronic
960628636 3:119705419-119705441 CAAATGAGGCAGAATGAAGGAGG - Intronic
960794202 3:121467393-121467415 CACCGTAGACAGAAAGATGGAGG + Intronic
960940877 3:122933096-122933118 AACACTAGGCAGGAAGATGGAGG - Intronic
961010895 3:123435050-123435072 CAGGGCAGGCAGACTGATGGAGG + Intronic
962006401 3:131354212-131354234 CACATTAGGCTGAATCACGGTGG - Intergenic
965330172 3:167362987-167363009 CACAGTAGCCAGCATGTTGGAGG - Intronic
965604497 3:170485103-170485125 CCCAGTGGGCAGAATGTTGAGGG - Intronic
965624057 3:170669378-170669400 CACTATAGTAAGAATGATGGTGG + Intronic
965859283 3:173128264-173128286 TAAAGTAGGCAGAATAAGGGTGG + Intronic
967610977 3:191505806-191505828 CACTGTACCCTGAATGATGGGGG + Intergenic
968726896 4:2251990-2252012 AAAAGTAGGCAGCCTGATGGGGG - Intronic
970939297 4:21612778-21612800 CACAGCAGGCAGCTTGATAGAGG + Intronic
973734217 4:53854596-53854618 CACAGTGGGCAGTTTGGTGGTGG - Intronic
974322216 4:60366063-60366085 CACAGCCGGGAGAATGATGAGGG + Intergenic
976673936 4:87683895-87683917 CACAGTAAGGATAAAGATGGAGG - Intergenic
979428118 4:120593242-120593264 CACAGGAGGAAAAATGATGGAGG + Intergenic
979786230 4:124718399-124718421 CCCAGTGGGCAGGGTGATGGAGG + Intergenic
981316022 4:143340256-143340278 CCCAGTAGGCAAAATGTTTGTGG + Intronic
982081363 4:151793436-151793458 CACAGCTCCCAGAATGATGGTGG + Intergenic
982241467 4:153304031-153304053 CACAGAAGTCAGGATGGTGGGGG + Intronic
982586235 4:157243983-157244005 ATCAGTAGGGAGCATGATGGAGG + Intronic
985516415 5:347648-347670 TACAGTAGGCAAGGTGATGGAGG + Intronic
985950238 5:3217371-3217393 CTCAGCAGGCAGAAAAATGGAGG + Intergenic
989139854 5:38191612-38191634 CACACTAGGGAGGATGGTGGGGG + Intergenic
990341020 5:54823246-54823268 CAGAGTATGCAGAATGGGGGAGG + Intergenic
990380075 5:55214197-55214219 CAAAGTAGGAAGAAAGAAGGGGG - Intergenic
990848696 5:60175918-60175940 GGCAGTAGGAAGAATGATCGTGG - Intronic
990927874 5:61049611-61049633 CACATAAAGCAGAATGGTGGGGG - Intronic
991967608 5:72108039-72108061 CGCAGGAGGCAGAAGGGTGGGGG + Intronic
992160854 5:73999941-73999963 CTCAGTAGGCAGTATGAGGAGGG + Intergenic
995247014 5:109946066-109946088 CAGAGTAGACAGGGTGATGGAGG + Intergenic
997248723 5:132372485-132372507 CACATTGGGCTGAGTGATGGTGG + Intronic
998021127 5:138771413-138771435 CACTGCAGGCTGAGTGATGGGGG - Intronic
998155777 5:139786275-139786297 CACAGGAGGCAGAGAGGTGGGGG + Intergenic
999328774 5:150659200-150659222 CACAGGAGGCAGAAGAATGCAGG - Intronic
999528593 5:152436371-152436393 CACAGGAGAGAGAATGAAGGAGG - Intergenic
999632333 5:153583897-153583919 CACATTAGAAAGAATGTTGGGGG - Intronic
1001538331 5:172516239-172516261 CACAAAAGGCAGAAAAATGGTGG + Intergenic
1001812260 5:174637908-174637930 CCCAGGAGGCAGAATGAGTGGGG - Intergenic
1001990769 5:176113875-176113897 TGCAGTGGGCAGAATGATGAGGG + Intronic
1002226105 5:177724265-177724287 TGCAGTGGGCAGAATGATGAGGG - Intronic
1002985543 6:2187594-2187616 GAAAGTAGGCAGAGTGATGGTGG - Intronic
1003084300 6:3049260-3049282 CAAAGTAGGCAGAAGGGAGGGGG - Intergenic
1005388902 6:25313488-25313510 CATAGTGGGCAGAAAGATGGGGG + Intronic
1005478880 6:26235814-26235836 CACAGTTGCCAAAATGATGTTGG - Intergenic
1005795254 6:29353619-29353641 AACATTAGGTGGAATGATGGAGG + Intergenic
1007825301 6:44595483-44595505 CAAAGTATGCAGCCTGATGGGGG + Intergenic
1009559676 6:65222828-65222850 CACAGTAAGAAGAAACATGGTGG + Intronic
1011593884 6:88997548-88997570 CAGAGTAGGCAAACTGATGTTGG + Intergenic
1013602545 6:111718593-111718615 CACGGTAGGCACAAGGATGGGGG + Intronic
1013835438 6:114329644-114329666 CACAGCAGGAAGTATGAAGGAGG + Intronic
1015384833 6:132610128-132610150 CACAGTGGGCTGAATAAAGGAGG + Intergenic
1016000915 6:139040333-139040355 CACAGAAGGCACAAAGAAGGTGG + Intronic
1016780155 6:147948979-147949001 AACAGGAGACAGAAAGATGGAGG + Intergenic
1017656922 6:156638667-156638689 GACAGAAGGCAGAATGGTGGTGG + Intergenic
1017865783 6:158442050-158442072 TGCAGTAGGGAGAATGAGGGAGG - Intronic
1018040363 6:159916305-159916327 GACAGAAGGTAGAATGGTGGTGG + Exonic
1019878085 7:3833560-3833582 CTCATTAGTCAGAATGATGTAGG + Intronic
1021159894 7:17259859-17259881 CACAGGAGGCAGATTAAAGGAGG + Intergenic
1021275267 7:18642346-18642368 AAAAGTAGGGAGAATGGTGGTGG - Intronic
1023612251 7:41982770-41982792 CACAGTAGGCAGAGCACTGGAGG + Intronic
1023778789 7:43636343-43636365 CACAGGAGGCTCAATGATGGGGG - Intronic
1025014422 7:55427396-55427418 CCCAGTAGGAAGAATGAGGCGGG + Intronic
1027358112 7:77379543-77379565 CACACTGGGAAGAGTGATGGTGG - Intronic
1027552561 7:79617401-79617423 CACAGACTGCAGAATGATTGAGG - Intergenic
1027758379 7:82246583-82246605 CAGAGTAGGGAGAATGTTGAAGG + Intronic
1028718350 7:94000487-94000509 TACAGTAAGGAGAATGATGGAGG + Intronic
1029433003 7:100544305-100544327 CACAGGAGTCAGAATTAAGGTGG + Intronic
1035010523 7:155711678-155711700 CACAGTTGGCAAAATCATCGGGG - Intronic
1036428015 8:8664332-8664354 CACAGTAGGCAGAGTCATTTTGG + Intergenic
1040918592 8:52590191-52590213 CATAGGAGGCAGATTGATGAGGG - Intergenic
1041080942 8:54214350-54214372 CACACTGGGAAGAATGATGATGG - Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1042504272 8:69542911-69542933 CACATTACACAGAATAATGGGGG + Intronic
1042832319 8:73044727-73044749 AACAGAAAGTAGAATGATGGTGG - Intronic
1042993287 8:74665092-74665114 CACAGTAGGAAGAATAAACGAGG - Intronic
1044761509 8:95522467-95522489 GACAGAAGTTAGAATGATGGTGG - Intergenic
1045568432 8:103345176-103345198 AACAGAAGGCAGAATGAGGCAGG - Intergenic
1047142975 8:122162820-122162842 AATAGTTGGCAGAATGTTGGGGG + Intergenic
1050080231 9:1908196-1908218 GACAGAATGTAGAATGATGGTGG - Intergenic
1056280954 9:85040818-85040840 GCCAGTAGGTAGGATGATGGAGG - Intergenic
1057171355 9:92965123-92965145 CACAGTGGGCACAATCACGGTGG - Intronic
1059695958 9:116730716-116730738 CAGAAGAGGCAGAATGATGCAGG + Intronic
1062214153 9:135380023-135380045 CACAGTGGGCATGAGGATGGAGG - Intergenic
1185986805 X:4844380-4844402 CACATCAGGCAGAGAGATGGAGG - Intergenic
1186201406 X:7158605-7158627 CACAGCAGGGGGAATGAGGGAGG + Intergenic
1188660722 X:32754847-32754869 CACAGAAGTCACAATGATAGTGG - Intronic
1190216486 X:48482433-48482455 CACAAAAGGCACAATGATGCGGG - Exonic
1191910213 X:66142488-66142510 CACAGCAAGCATAATGGTGGTGG - Intergenic
1194254059 X:91614397-91614419 CTCAGAAGGCAGAAAGATGTGGG - Intergenic
1197342160 X:125287402-125287424 CACAGTTGGGAGGATGGTGGGGG + Intergenic
1199165893 X:144674810-144674832 GACAGTAGGAAGAATAATTGAGG + Intergenic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic
1199965945 X:152821167-152821189 CACAGTGGGGAGAATCCTGGTGG - Intergenic
1200572847 Y:4853974-4853996 CTCAGAAGGCAGAAAGATGTGGG - Intergenic
1201576424 Y:15466097-15466119 CACAGCAGGGCGAATGAGGGAGG + Intergenic