ID: 936664802

View in Genome Browser
Species Human (GRCh38)
Location 2:114581882-114581904
Sequence ATGTTGTTAACAAGGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936664802_936664804 -3 Left 936664802 2:114581882-114581904 CCAGTTTTCCTTGTTAACAACAT 0: 1
1: 0
2: 0
3: 39
4: 415
Right 936664804 2:114581902-114581924 CATACTGTACCACACCAGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936664802 Original CRISPR ATGTTGTTAACAAGGAAAAC TGG (reversed) Intronic
901767002 1:11508006-11508028 AAGTTGTTAAAAATGTAAACAGG - Intronic
904227725 1:29037833-29037855 ACGTTCTTAAAAAGGCAAACTGG - Intronic
904341084 1:29835202-29835224 ATGTTATTAACAAGAATACCTGG - Intergenic
904454258 1:30637788-30637810 ATGTTATTAACAAGAACACCTGG + Intergenic
904466227 1:30709180-30709202 ATGATGTTAAAAAGGAATAATGG - Intergenic
904985406 1:34543887-34543909 ATGTTAATAATAGGGAAAACTGG + Intergenic
908291697 1:62673757-62673779 ATGTTGTAAAAAAGGAAAGGTGG - Intronic
908781280 1:67692821-67692843 ATGTTTTTAACAAGTAATTCAGG + Intergenic
908813108 1:68004336-68004358 ATATGGCTAACAGGGAAAACTGG - Intergenic
909176148 1:72362655-72362677 ATGTTTTAAACAAGAAACACAGG - Intergenic
910291405 1:85603442-85603464 ATAGTGTTAAGAAGTAAAACAGG - Intergenic
911295056 1:96105075-96105097 CTGGTGTTAACAAGCACAACTGG + Intergenic
911439852 1:97912138-97912160 ATGTTTTAAAAAAGGAAAAGGGG - Intronic
911445914 1:97991578-97991600 ATGGTGTTAACAAAGAGAAGAGG - Intergenic
912225849 1:107733074-107733096 CTGGTGATACCAAGGAAAACAGG + Intronic
912353110 1:109033615-109033637 CTGTTGTTAAGAATGTAAACTGG + Intronic
912697229 1:111850475-111850497 ATATTGTTCACAAGGAAAGGAGG - Intronic
913031822 1:114914661-114914683 AAGATGTCAACAAGGAAAAGAGG - Intronic
913123485 1:115763689-115763711 ATCTTGCAAACAAGGAAACCAGG + Intronic
913365754 1:118036409-118036431 GGGTAGTTAACAAGGATAACTGG + Intronic
914265154 1:146032284-146032306 ATGTTTTTAAAAAGGAAAATAGG + Intergenic
915045952 1:153016806-153016828 ATGTCAATAACAAGAAAAACTGG - Intergenic
916379271 1:164190254-164190276 ATTTTGTTAACATGAAAATCTGG + Intergenic
916828431 1:168466126-168466148 AGCTTGTTAACAAGGAATATTGG - Intergenic
917705535 1:177630335-177630357 ATGTTACTATTAAGGAAAACTGG + Intergenic
918290503 1:183103073-183103095 ATGTTGTGTGCAATGAAAACTGG - Intronic
918822535 1:189273365-189273387 ATGATGACAACAAGGAAAACTGG + Intergenic
918857081 1:189770402-189770424 GTGTTATTAAGAGGGAAAACTGG + Intergenic
919001361 1:191835116-191835138 ATGTTCTTAATAAGAAAAATAGG + Intergenic
919597686 1:199583978-199584000 GTGAGGTTAACAAGGACAACTGG + Intergenic
923016180 1:230128273-230128295 GTGTGGTTATGAAGGAAAACAGG + Intronic
923114764 1:230924734-230924756 CTGGTGTTAGCAAGCAAAACAGG + Intronic
923379948 1:233407276-233407298 ATTTTCTTTACAAGGAAATCAGG + Intergenic
923644116 1:235798363-235798385 ATGTTAATAATAGGGAAAACTGG + Intronic
923791906 1:237118806-237118828 ATATTGTTAATAAGGAGAATAGG - Intronic
923922880 1:238588707-238588729 GTGTTGGTAACAAGGAGAAAAGG - Intergenic
924130720 1:240905271-240905293 ATCATGTTAACAAGGCAGACGGG - Intronic
924496694 1:244597042-244597064 ATGTTCTTGATTAGGAAAACCGG - Intronic
1063782373 10:9340051-9340073 GTGTTGCTAAAAAGGAACACTGG + Intergenic
1064294470 10:14065915-14065937 ATGATGTCAGCAAGGATAACAGG - Intronic
1064727164 10:18292214-18292236 ATCTTGTTTCCAAGGAAAAAAGG - Intronic
1066060396 10:31718949-31718971 CTGCTGATAACCAGGAAAACAGG - Intergenic
1066080350 10:31925427-31925449 AAGTTGTTAATAGGGATAACTGG - Intronic
1066722086 10:38350457-38350479 ATGTTGTAAATGGGGAAAACTGG - Intergenic
1068086730 10:52382444-52382466 ATGTTTTTAATAAGCAAACCAGG + Intergenic
1068678121 10:59789008-59789030 AAGATGTCAACAAGGAAAAGAGG - Exonic
1069218054 10:65846965-65846987 ATGTTGCTCAGAAGGAAAAAAGG + Intergenic
1070015009 10:72518332-72518354 ATTTTTTTAAAAAAGAAAACAGG - Intronic
1070432664 10:76356953-76356975 ATGTTGGTAACAAAGAAAGTTGG + Intronic
1071159887 10:82733491-82733513 ATGATATTAATAAGGAAGACAGG + Intronic
1071751336 10:88480110-88480132 ATGTTATTAAATAGGAAAATAGG - Intronic
1073272900 10:102281679-102281701 ATGTTAATAACAGGGGAAACTGG - Intronic
1073868455 10:107832573-107832595 GCATTGTTAACATGGAAAACAGG + Intergenic
1074129849 10:110564359-110564381 ATGATGTTACCAAGCAAAAAGGG + Intergenic
1075019507 10:118941007-118941029 ACGTTTATAACAGGGAAAACTGG + Intergenic
1075623224 10:123943309-123943331 ATCCTTTTAACAAGGACAACAGG + Intergenic
1075870169 10:125766591-125766613 ATACTGTTTACAAAGAAAACCGG - Exonic
1078016072 11:7616174-7616196 ATGTTCTTAAAAAGAAAAAATGG + Intronic
1078307114 11:10200437-10200459 ATGTTATTAACAATGAAGAATGG + Intronic
1078331392 11:10425389-10425411 TTGGTGATAACCAGGAAAACAGG - Intronic
1080796909 11:35573232-35573254 AAGATGTTAATAATGAAAACTGG - Intergenic
1085674980 11:78507819-78507841 ATTTTTTTAAAAATGAAAACTGG - Intronic
1085872860 11:80370956-80370978 ATGTTTTTACCAATGAAAAAAGG + Intergenic
1086031713 11:82366746-82366768 ATGTTATTAATAGGGCAAACTGG + Intergenic
1086472247 11:87127089-87127111 ATGGTTTTAACAAAGTAAACAGG - Intronic
1086512621 11:87575558-87575580 ATATTGTTAACCTGGAAATCTGG + Intergenic
1086753097 11:90524166-90524188 ATATTGAGCACAAGGAAAACTGG - Intergenic
1087417722 11:97879124-97879146 ATCTTGTTGAGAAGGAAATCTGG + Intergenic
1090200897 11:124855361-124855383 ATGCTTTTAACAAGGTCAACAGG + Intergenic
1090531413 11:127594723-127594745 ATGTTGCTGACAAAGAATACTGG - Intergenic
1090683106 11:129083111-129083133 ATGTGGTAAAAAGGGAAAACTGG + Intronic
1090861844 11:130660997-130661019 ATGTTAATAACAGGGGAAACTGG - Intergenic
1093205127 12:16239558-16239580 ATTTTGATAATATGGAAAACAGG - Intronic
1093530794 12:20160897-20160919 ATGGTGTTACCCAGGCAAACAGG - Intergenic
1093545635 12:20343024-20343046 ATGTTGTTAAAAGGGAAAAAAGG + Intergenic
1094792556 12:33931291-33931313 TTGCTGATACCAAGGAAAACAGG + Intergenic
1095789968 12:46155396-46155418 ATATTGAGAACAATGAAAACAGG - Intergenic
1095947973 12:47764610-47764632 ATGTGGGTAACCAGGAAAGCAGG + Intronic
1097759613 12:63447737-63447759 ATGTTGTTAACCTGAAAAACAGG - Intergenic
1097925869 12:65125619-65125641 ATGTTAATAACAGGGAAAATTGG + Intergenic
1098113432 12:67148591-67148613 ATGTTGATCACAAAGAAAAAAGG + Intergenic
1100628399 12:96360911-96360933 AAGTTGCTAACCAGGAAAATTGG + Intronic
1100928901 12:99584029-99584051 CTGTTGTGAAAAAGGAAAAAGGG - Intronic
1101197111 12:102394927-102394949 ATTTTGTAAACAATGAAAAGGGG - Intergenic
1101694744 12:107114416-107114438 ATGTTAATAATAAGGGAAACTGG + Intergenic
1107288433 13:38823468-38823490 ATGGGGTGAACAAGGAAAGCAGG - Intronic
1107453095 13:40529713-40529735 GTGTTAATAACAGGGAAAACAGG + Intergenic
1107630675 13:42339631-42339653 AAGATATTAATAAGGAAAACTGG - Intergenic
1107719496 13:43232962-43232984 ATATTGTTATAAAGGAAAAATGG - Intronic
1107977162 13:45701235-45701257 AGTTTGTTAACAAGCAAAAGGGG + Intergenic
1108946923 13:56038303-56038325 ATGTTGGTAGTAAGGAAAAGAGG + Intergenic
1109059787 13:57600054-57600076 ATTTTGTTAAAAAATAAAACTGG - Intergenic
1109386799 13:61640363-61640385 ATTTTGTTAACATGGATAAATGG + Intergenic
1110195441 13:72782770-72782792 ATGTTTTAAATAGGGAAAACGGG - Intronic
1110787661 13:79550123-79550145 AAATTTTTAACCAGGAAAACAGG - Intronic
1110928229 13:81182776-81182798 ATGTAATTATCAAGGAAAATTGG - Intergenic
1111572724 13:90108050-90108072 ATTTTCTCAACAAGGAAGACAGG + Intergenic
1112907062 13:104435829-104435851 ATTATGTTTATAAGGAAAACAGG + Intergenic
1113379767 13:109792701-109792723 GTGTTTTGAACAAGGAAAAATGG - Intergenic
1113570281 13:111348887-111348909 AAGTTGTTAAGAAGAAAAAGTGG - Intergenic
1114004877 14:18301587-18301609 TTGCTGTGAACAAGGAAACCTGG + Intergenic
1114140040 14:19899402-19899424 ATGTTGATAACTATGAAACCTGG - Intergenic
1114948753 14:27719756-27719778 ATTTTCTTAACAAGGAAACCTGG + Intergenic
1115126206 14:29997556-29997578 TTGTTGTTAAAAAGAAAAAAAGG + Intronic
1115627377 14:35207541-35207563 ATGTTGATAAAAAGGGAAACAGG - Intronic
1115804791 14:37038790-37038812 ATCTTGGTATCAAGGAAAATGGG - Intronic
1115817017 14:37174562-37174584 AACTTTTTAACAAGGATAACTGG - Intergenic
1116552266 14:46256418-46256440 ATGTAGTTATCAAGGAATATAGG + Intergenic
1117084907 14:52189837-52189859 ATCTTGTTATCCAGGAAAAAGGG + Intergenic
1117229145 14:53697434-53697456 ATGATGTTAAATAAGAAAACAGG + Intergenic
1117283452 14:54263520-54263542 ATGTTGTTAGCAACAAAAATGGG + Intergenic
1117415070 14:55487296-55487318 ATGTTAATAATAAGGGAAACGGG - Intergenic
1118406978 14:65434487-65434509 ATGTTGTTAACCAGAGAAATAGG + Intronic
1118407717 14:65443019-65443041 ATGTTAATAATAGGGAAAACCGG + Intronic
1119218630 14:72888641-72888663 AGGTAGTTAACAAGGAAAGATGG - Intronic
1121635744 14:95452772-95452794 ATGTTATTTACAAGGAAACTTGG + Intronic
1123664096 15:22593688-22593710 ATGTTAGCAACAAGGGAAACTGG + Intergenic
1124019585 15:25907642-25907664 ATTTTGTTAAAAGTGAAAACTGG + Intergenic
1124317927 15:28688126-28688148 ATGTTAGCAACAAGGGAAACTGG + Intergenic
1125176381 15:36826844-36826866 ATGTTGATAATAAGGGAAACTGG + Intergenic
1125221532 15:37342289-37342311 ATGTTATTAAGAGGGAAAATTGG - Intergenic
1125734695 15:41916507-41916529 TTGGTGTGAAAAAGGAAAACTGG + Intronic
1125846239 15:42857129-42857151 ATGTTAATAATAGGGAAAACTGG + Intronic
1126223596 15:46243428-46243450 ATGATGGTAACAAGGAAAATAGG - Intergenic
1130627287 15:85528557-85528579 ATTTTGTGTACAAGGAAAACAGG + Intronic
1130701848 15:86191566-86191588 ATGCTGTTATCAAGAACAACTGG + Intronic
1131812768 15:96189929-96189951 AATTTTTTAAAAAGGAAAACTGG - Intergenic
1132385036 15:101394280-101394302 ACGTTCTTAACAATGAACACCGG - Intronic
1132832875 16:1937901-1937923 ATGTTGTTAATAAAGACAGCAGG + Intergenic
1133369415 16:5236689-5236711 ATGTTAATAACAGGGGAAACAGG + Intergenic
1133764164 16:8824403-8824425 ATGCAGTCAACAAGGAAATCTGG + Intronic
1134358543 16:13507551-13507573 ATGTTATTAAGAAGGAACCCAGG + Intergenic
1135697142 16:24598681-24598703 ATCTTTTCAACAAAGAAAACTGG - Intergenic
1137754478 16:50890437-50890459 ATTTTGTTAAAATGGAGAACAGG + Intergenic
1137807154 16:51318468-51318490 ATGAAGTTGACAAGGATAACAGG + Intergenic
1137914658 16:52416006-52416028 ATATTGTTACCAAGCAAAACAGG + Intergenic
1138966642 16:62092456-62092478 CAGCTGTTAACAAGGAAACCTGG - Intergenic
1142647751 17:1326326-1326348 ATGTTTTTAACAAGAGAAATAGG - Intergenic
1144344371 17:14336729-14336751 ATATTGGGAAAAAGGAAAACAGG + Intronic
1144459178 17:15443929-15443951 ATGTTGTTATCCAGGAGAATGGG + Intronic
1145781244 17:27564932-27564954 ATGTTATTAAAAACAAAAACTGG - Intronic
1146434800 17:32834427-32834449 ATGTTGTTAGCTTGGAGAACTGG - Intronic
1146472044 17:33132349-33132371 ATGATGTTAAGAAATAAAACCGG + Intronic
1149019940 17:51951285-51951307 ATGTTCTTAAAACGGAAATCAGG - Intronic
1149903589 17:60504964-60504986 GGGTTGTTATCAAGGAAAAATGG + Intronic
1152614805 17:81333166-81333188 ATGTTTTTAAAAAGGCAAAAGGG - Intergenic
1154000097 18:10475398-10475420 ATATTGTTAAGTAGGAAAAAAGG + Intronic
1154107853 18:11539386-11539408 ATGTAATCAACAAGGAAATCTGG - Intergenic
1155710429 18:28870413-28870435 ATGCTGTGAACAAAGAAAAGAGG - Intergenic
1156153827 18:34277428-34277450 ATGATGTTAATAAGGCAAAAAGG - Intergenic
1156552841 18:38036295-38036317 TTGTTTCTAAAAAGGAAAACAGG - Intergenic
1158535561 18:58305276-58305298 CTTTTGTGAACAAGGAAAACGGG + Intronic
1158933765 18:62346227-62346249 ATGCTGATGACAAGGCAAACAGG - Intronic
1159119482 18:64152209-64152231 ATTTTCTTAACATGGAGAACTGG - Intergenic
1159170149 18:64755931-64755953 ATGGTGTCAAAAAGCAAAACTGG + Intergenic
1159282556 18:66305716-66305738 ATTATGTTAATAAGGAACACAGG - Intergenic
1159406865 18:68014539-68014561 ATGTTGTTAATAAAGACAGCAGG - Intergenic
1159713311 18:71790910-71790932 ATGTTGGTACCCAGGCAAACAGG - Intergenic
1160377328 18:78422920-78422942 ATGTTAATAACAGGCAAAACTGG + Intergenic
1161059232 19:2206811-2206833 ATGTTGTTAATGATGAACACGGG + Intronic
1164831433 19:31324421-31324443 ATGTTGATATCAAAGAAATCAGG - Intronic
1165003144 19:32781370-32781392 ATGTTGGTGACAATGAACACGGG - Intronic
1167771397 19:51521831-51521853 ATGTGTTTCACAAGGAAAACAGG + Intronic
1167866604 19:52334110-52334132 ATGTTAATAATAGGGAAAACGGG + Intergenic
926943203 2:18159753-18159775 GTGTTGTAAACAAGGATTACTGG + Intronic
926963415 2:18384582-18384604 AAGTTGTTAACAAGAAAAATTGG - Intergenic
927541979 2:23920351-23920373 AAGTTATTAACAAGGTAAATTGG - Intronic
927990708 2:27445038-27445060 AGGCTGCTAACAAGGACAACTGG - Exonic
928429646 2:31206678-31206700 ATTCTGGTAACAAGGAAAAGGGG - Intronic
930502121 2:52234554-52234576 ATCTTGCTAAGAATGAAAACAGG - Intergenic
931060149 2:58519219-58519241 ATTTTGTTAATTAGGAAAAAAGG - Intergenic
931425634 2:62168638-62168660 ATGTTACTAAGAGGGAAAACTGG + Intergenic
932746671 2:74339440-74339462 ATATTGTTAAGTAGGAAAAAGGG + Intronic
933073799 2:77896676-77896698 ATGTTTTTAAATAGGAAAGCAGG - Intergenic
933218360 2:79657085-79657107 AATTTAATAACAAGGAAAACTGG + Intronic
933360851 2:81282398-81282420 ATTCTGTGAACAGGGAAAACTGG - Intergenic
935969773 2:108519507-108519529 ATGTTAATAATAAGGGAAACTGG + Intergenic
936133439 2:109867736-109867758 ATGTTAATAATAAGGGAAACGGG + Intergenic
936211258 2:110503749-110503771 ATGTTAATAATAAGGGAAACGGG - Intergenic
936420396 2:112358315-112358337 ATGTTAATAATAAGGGAAACGGG - Intergenic
936664802 2:114581882-114581904 ATGTTGTTAACAAGGAAAACTGG - Intronic
936753150 2:115671113-115671135 ATTTTATGAACAATGAAAACAGG - Intronic
936824313 2:116562236-116562258 ATGTTGGGCACAAGGAAAAGAGG - Intergenic
937130071 2:119503856-119503878 AAGATGTTAATAGGGAAAACTGG + Intronic
937565925 2:123289236-123289258 ATATTGTAAAAAAGGAAACCTGG + Intergenic
938831493 2:135054052-135054074 ATAAGGTTAACAAGGAAGACGGG + Intronic
939486752 2:142823166-142823188 ATGTTGTTAAGAATGAGAAAGGG + Intergenic
939512297 2:143122492-143122514 ATATTATTAACAAAGAAAAATGG - Intronic
939567551 2:143802465-143802487 TCGTTATTAACAATGAAAACTGG + Intergenic
939602164 2:144205572-144205594 ATTCTGTTAACAAGGAAGAAGGG + Intronic
939614752 2:144349868-144349890 ATGCAGTTTACAAGGAACACTGG + Intergenic
940206765 2:151211397-151211419 ATGTTGATAATAGGGCAAACTGG + Intergenic
942252861 2:174062516-174062538 ATTTTGTTGGCAAGGAAAAGGGG + Intergenic
943460156 2:188163236-188163258 ATGTTGGTAAAAATGTAAACTGG + Intergenic
943561618 2:189470218-189470240 ATTTTGTTAGGAAGTAAAACTGG - Exonic
943801088 2:192058637-192058659 ATATTTTTAACTGGGAAAACAGG - Intronic
944067741 2:195637030-195637052 ATATTATTAACAAAGAAAAAGGG + Intronic
944137530 2:196415180-196415202 ATGTTTTTGACAAAGATAACAGG - Intronic
944342168 2:198614172-198614194 ATATTATTAACAAGGAGTACTGG - Intergenic
944352739 2:198748006-198748028 ATGTTCTTAGTAAGGAAAACTGG + Intergenic
944863499 2:203838474-203838496 ATTTTATTAAAAAGTAAAACAGG + Intergenic
945788264 2:214272157-214272179 ATCATGTTAAAAAGGAAAATTGG - Intronic
945939709 2:215935960-215935982 ATGTTAATAACATGGAAAACTGG + Intergenic
947207750 2:227677490-227677512 TTGATTTTAACAAGGACAACTGG + Intergenic
947541012 2:230978141-230978163 ATGTAGTTAAAAAGTAAAAATGG - Intergenic
947783641 2:232794139-232794161 AGGTTCTTAAGAAGGAAAAGGGG - Intronic
1168759359 20:338851-338873 TTGTTGATAACAATGAAAAATGG - Intergenic
1170351792 20:15449346-15449368 CTGACGTTAACAAGGATAACAGG + Intronic
1170782926 20:19441605-19441627 AAGATGTTAACAGGGAAAACGGG - Intronic
1171904297 20:30888156-30888178 CTGCTGATAACCAGGAAAACAGG - Intergenic
1172577129 20:36018052-36018074 ATGTTAATAACAGGGGAAACTGG - Intronic
1172927932 20:38557287-38557309 ATGTTGATAACAGGGGAAACTGG - Intronic
1173457660 20:43216385-43216407 ATGTTGTAGCCAAAGAAAACAGG + Intergenic
1175039693 20:56036855-56036877 ATGCTGTTAACAAGAAAAATTGG - Intergenic
1176275377 20:64263232-64263254 ATGTTGTAAACAGTGAAAAGGGG + Intronic
1176276696 20:64276098-64276120 ATGATGTTAATAAAGAAAAAAGG - Exonic
1176864623 21:14038938-14038960 ATGATGGTAACAAGGAGAATAGG - Intergenic
1177500216 21:21944778-21944800 ATTTTGTTAACAAGTGAAAGGGG - Intergenic
1177510231 21:22076950-22076972 ATTTTTTTAATGAGGAAAACTGG + Intergenic
1177676477 21:24307754-24307776 GTGTTGCTGTCAAGGAAAACTGG + Intergenic
1180337719 22:11594296-11594318 CTGCTGATAACCAGGAAAACAGG - Intergenic
1180429391 22:15232377-15232399 TTGCTGTGAACAAGGAAACCTGG + Intergenic
1180645737 22:17337341-17337363 GTGTTGTCACCAAGGAAGACAGG - Intergenic
1181552266 22:23647176-23647198 ATGTTCATAACAAGGAAGCCAGG - Intergenic
1182017904 22:27056204-27056226 ATGTTGTGAATAAGGAAATGGGG - Intergenic
1182174165 22:28266271-28266293 ATGTTGTCAGAAGGGAAAACGGG - Intronic
1182941983 22:34285647-34285669 ATCCTGTTAAAAAGGAAAACAGG - Intergenic
1184878055 22:47288028-47288050 ATGATGTCAACAAGGAAATATGG - Intergenic
1184985118 22:48126940-48126962 ATGTTAACAATAAGGAAAACTGG + Intergenic
1185150732 22:49162435-49162457 ATGTTAATAACAGGGAAAACTGG + Intergenic
1185174588 22:49316327-49316349 ATGTTGTTAAAAAGTGAAAATGG - Intergenic
949251848 3:1994683-1994705 ATGTTAATAATAGGGAAAACTGG + Intergenic
950691351 3:14660566-14660588 ATGTTGTTAATATAGAAATCAGG + Intronic
952030007 3:29130589-29130611 ATGATGTTAGCTGGGAAAACTGG + Intergenic
954008425 3:47612643-47612665 ATGTTGTAGGCAAGGAAAATTGG - Intronic
954476887 3:50754857-50754879 ATGTTGTCAAAAGTGAAAACGGG - Intronic
955151695 3:56374009-56374031 ATGATATTATAAAGGAAAACTGG - Intronic
955240735 3:57175820-57175842 ATGTTAATAGTAAGGAAAACTGG - Intergenic
955618951 3:60840479-60840501 ATCTTTCTCACAAGGAAAACTGG - Intronic
955850006 3:63210205-63210227 ATGTAGTTAACAACTAATACTGG - Intergenic
956258018 3:67305045-67305067 ATGTTGTTAGTAAGGACAAAGGG - Intergenic
956838296 3:73113743-73113765 ATGTTAATAACAGGGGAAACTGG + Intergenic
957431558 3:80115570-80115592 AAGATGTTAATAAGGGAAACTGG + Intergenic
958528181 3:95290233-95290255 ATGTTGTTAAGAAAGGAATCTGG + Intergenic
958600557 3:96291034-96291056 ATATTTTCAAAAAGGAAAACAGG + Intergenic
959031567 3:101305548-101305570 ATGTTAATAACAGGGAAAAGTGG + Intronic
959074641 3:101736538-101736560 CTGTTGATAGCCAGGAAAACAGG + Intronic
959226505 3:103595212-103595234 ATGTTTTTAACAAAAAAAAAAGG + Intergenic
959608276 3:108265978-108266000 ATGGTGTAAAAAAAGAAAACGGG + Intergenic
960087852 3:113609573-113609595 ATGTTATTAAGAAGGAAGAAAGG + Intronic
960312168 3:116130221-116130243 ATTTTGTAAATAAGGGAAACAGG - Intronic
960455170 3:117862388-117862410 CTATAGTTACCAAGGAAAACAGG + Intergenic
961952641 3:130766171-130766193 ATGTTGAAAAGAAGAAAAACTGG + Intergenic
962130630 3:132670181-132670203 ATGTTCCTAAGAAGGAAAAAGGG - Exonic
962651020 3:137491104-137491126 ATGTTGTCAATTAGGAAATCTGG + Intergenic
963316454 3:143764013-143764035 ATTTTGTTTACAGGGATAACTGG + Intronic
963729624 3:148958733-148958755 AGGTTGTTAACAATGAAAGGAGG + Intergenic
965759743 3:172063082-172063104 ATGTATTTAACAAGGAAGATAGG - Intronic
966074024 3:175914409-175914431 ATGTTCTTAATGAGGAAACCAGG - Intergenic
966535736 3:181031761-181031783 ATGTTGTTAAAAACCAAAAATGG - Intergenic
966970312 3:185039459-185039481 ACGTTGTTACCAAGAAAAAGGGG + Intronic
967668738 3:192206408-192206430 ACGTTGTTAAGCAGGAAAGCTGG + Intronic
968139728 3:196246000-196246022 ATATTGTTAACAAAGAGAAAAGG + Intronic
969175188 4:5393412-5393434 ATGTTGTTATAAAGAAATACTGG + Intronic
969860266 4:10030215-10030237 ATGTTCTTACCACAGAAAACTGG + Intronic
970259767 4:14212364-14212386 CTGCTGTTACCCAGGAAAACAGG - Intergenic
970352105 4:15212153-15212175 AAGTTTTCAAGAAGGAAAACTGG - Intergenic
970571488 4:17387681-17387703 ATTTTGTAGACAAGGAAACCGGG - Intergenic
970922619 4:21412726-21412748 ATTTTGTTAACCAAGAAAGCTGG - Intronic
971066775 4:23041914-23041936 ATGTTAATAACAGGGAAAACTGG - Intergenic
971091229 4:23347971-23347993 ATTTTGTTTATAAAGAAAACAGG + Intergenic
972128924 4:35805264-35805286 ATGATGGTAACAAGGAGAAAAGG + Intergenic
972295380 4:37732764-37732786 ATGTTGCTAATAGGGGAAACAGG + Intergenic
972326716 4:38023312-38023334 ATTTTTTTAAAAAGGAAAATTGG - Intronic
974297031 4:60013439-60013461 ATGCTGTTAATTAGGAAACCAGG + Intergenic
974873884 4:67678438-67678460 ATGTTGTTAATAAGAGAAACAGG - Exonic
975653038 4:76613672-76613694 ATGTTGATAGCAAGGAAGAGAGG + Intronic
976255092 4:83091808-83091830 ATGTTGAAAGCAGGGAAAACTGG - Intronic
976581649 4:86743590-86743612 CTGTTTCTAACAAAGAAAACAGG + Intronic
976775384 4:88700399-88700421 GTGTTGCTAAAAAGGAAGACCGG + Intronic
977618652 4:99111816-99111838 AGATTGGTAACAAGGAAATCTGG + Intergenic
977735995 4:100416605-100416627 TTCCTGTCAACAAGGAAAACAGG + Intronic
977959285 4:103067336-103067358 ATGATGTTAGCTGGGAAAACTGG + Intronic
978508708 4:109491503-109491525 ATATTTTTAACAAGAAAAAAAGG + Intronic
980412234 4:132436386-132436408 ATATTCATCACAAGGAAAACTGG - Intronic
980484913 4:133444155-133444177 ATGTTGTTAACAAGACAAAATGG - Intergenic
980653649 4:135754212-135754234 ATCTTGCTAACCAGGAGAACAGG - Intergenic
981751903 4:148100613-148100635 CTGTTGTTAGCAATGAAAAATGG + Intronic
984633397 4:182084711-182084733 TTTTTATTTACAAGGAAAACTGG + Intergenic
985194532 4:187414373-187414395 ATGTTAGTAACAGAGAAAACTGG - Intergenic
986947320 5:13038600-13038622 AAGATGTTAATAGGGAAAACTGG + Intergenic
987735627 5:21839245-21839267 ATTTTGTTATTAAGGAAAACAGG - Intronic
987776097 5:22368827-22368849 ATGTTTTTAAAAAGGAATAAAGG - Intronic
988211478 5:28210178-28210200 CTGTTGTTATGAAGGACAACGGG - Intergenic
988451748 5:31350890-31350912 ATGTATTTAAGAAGGAAAACAGG + Intergenic
988570037 5:32356236-32356258 ATGTTGAAAACAAAGAAAAATGG + Intronic
990059111 5:51625259-51625281 ATGTTCTTAAGAAAGAAAAAAGG - Intergenic
990096243 5:52117579-52117601 ATGTCATTAACATGGAAAAATGG + Intergenic
991575918 5:68103062-68103084 CTGTTGATACCCAGGAAAACAGG + Intergenic
991639283 5:68737288-68737310 ATGTTGCTGGCAAGGAAAAGAGG + Intergenic
991702671 5:69330994-69331016 TTTTTTTTAAAAAGGAAAACAGG - Intronic
992412747 5:76522942-76522964 ATGGTGGTAAGAAAGAAAACGGG - Intronic
992977614 5:82137517-82137539 CTGGTGATAACCAGGAAAACAGG - Intronic
994192967 5:96889036-96889058 ATGTTGTCAATAAGGATAAGAGG - Intronic
994926141 5:106119739-106119761 ATGTAATTGACAAGGAAAATTGG + Intergenic
995010432 5:107251724-107251746 TTGTTTTGAACAAGGAAATCTGG - Intergenic
995202193 5:109438648-109438670 ATGTTAATAATAGGGAAAACTGG + Intergenic
995453795 5:112331416-112331438 GTGTTATAAACAAGGAAAGCAGG - Intronic
995725914 5:115180147-115180169 AAGCTGTTAACCAGGAAAAGAGG + Exonic
996847376 5:127914952-127914974 ATGTTCTACACAAGGAAAATAGG + Intergenic
996927120 5:128840975-128840997 ATATAGTAAACAAGAAAAACTGG + Intronic
997167738 5:131679313-131679335 GTGTTGTTGACAAGGAAAGAAGG - Intronic
997373573 5:133381068-133381090 CTGTTGTTTCCAAGGAAAGCTGG + Intronic
997483343 5:134206754-134206776 ATGTTTTTAAAAAGTCAAACAGG - Intronic
997994449 5:138574789-138574811 ATGTTGCTAAGCACGAAAACTGG + Intronic
999522541 5:152365632-152365654 ATGTTAATAACAGAGAAAACTGG - Intergenic
999769138 5:154761852-154761874 ATTCTGTGAATAAGGAAAACAGG - Intronic
999893881 5:156007803-156007825 ATGTTGGGAATAAGGCAAACGGG + Intronic
1000098158 5:157989082-157989104 ATTTTGTTACCAAGCAAAAGGGG + Intergenic
1000319492 5:160122845-160122867 ATGAGGTTGAAAAGGAAAACAGG + Intergenic
1000524512 5:162339882-162339904 ATGTTAATAATAGGGAAAACTGG - Intergenic
1003471295 6:6436589-6436611 ATGTGGTTGACAAAGAAAAAGGG + Intergenic
1003746184 6:9005064-9005086 ATGTCTGTAACAAGGAAAGCAGG - Intergenic
1003913313 6:10762235-10762257 ATGTTGATAATAGGGAAAATCGG + Intronic
1005292056 6:24389540-24389562 CTGTTTTTAAAAAGGAAAATGGG + Intergenic
1006683859 6:35815869-35815891 ATGTGGTTAAAGATGAAAACAGG + Intronic
1008205931 6:48656461-48656483 ATATTTATAATAAGGAAAACAGG + Intergenic
1008326636 6:50189880-50189902 ATATTGATACCAAGGGAAACTGG + Intergenic
1008355619 6:50549150-50549172 CTGTAATTAACAAGGAAAAAAGG - Intergenic
1008618232 6:53246696-53246718 ATGTGGTTCACAATGACAACAGG - Intergenic
1009060719 6:58394650-58394672 CTGTTGTTACCCAGGCAAACAGG + Intergenic
1009205301 6:60794033-60794055 CTTTTATTACCAAGGAAAACGGG - Intergenic
1009307646 6:62110749-62110771 ATCTTTTCAACAAGAAAAACTGG + Intronic
1009310404 6:62144285-62144307 ATTTTGTTAACATCTAAAACAGG - Intronic
1009492809 6:64312719-64312741 CTGGTGATACCAAGGAAAACAGG + Intronic
1009764871 6:68059281-68059303 CTGTGGTTAACAAGCAGAACAGG + Intergenic
1009812061 6:68680921-68680943 GTGTTGTTATAAAGGAATACTGG + Intronic
1010111133 6:72234487-72234509 ATGTTAATAACAAGGTAAACAGG - Intronic
1010205916 6:73322568-73322590 ATGTCATTAACAGGGGAAACTGG + Intergenic
1010260892 6:73815701-73815723 ATCTTGTTAATAAGGAAAAAGGG + Intronic
1010710282 6:79165865-79165887 ATATTAATAATAAGGAAAACTGG + Intergenic
1011268702 6:85553104-85553126 TTATTGCTAACAAGGAGAACAGG - Intronic
1011442424 6:87400818-87400840 ATGGTCTTAATTAGGAAAACAGG - Intergenic
1012743201 6:103047021-103047043 ATGTTGATAATACAGAAAACTGG - Intergenic
1013906738 6:115228854-115228876 ATGTTGTTAATAGGGGAAACTGG - Intergenic
1014880362 6:126716617-126716639 ATCCTGTTAACAGGCAAAACTGG + Intergenic
1015227125 6:130870299-130870321 ATGGTGTTAACATGGAAAAAGGG + Intronic
1016653881 6:146495402-146495424 ATGTTAACAACAAGGGAAACTGG - Intergenic
1017612786 6:156208782-156208804 ATGTTAATAACAGAGAAAACTGG + Intergenic
1018462920 6:164016405-164016427 ATGTAGTTAAAAAGGAAGAAAGG - Intergenic
1018512172 6:164536160-164536182 ATGTTGATAACTTTGAAAACAGG - Intergenic
1020159418 7:5757444-5757466 ATTTTGTTAGGAAGGAAAAAAGG - Intronic
1020475873 7:8593776-8593798 ATATTTTTAACAATGAGAACTGG + Intronic
1020693226 7:11384786-11384808 ATGTTTTTAAGAAGGAAAAGTGG - Intronic
1020716146 7:11676103-11676125 CTGGTGATAACCAGGAAAACAGG + Intronic
1021088551 7:16452895-16452917 ATGCTGATAACAGGGAAAAAAGG - Intergenic
1021267212 7:18539572-18539594 AAGATGGTAACATGGAAAACTGG + Intronic
1023518759 7:41029682-41029704 ATGTTAACAACAGGGAAAACTGG - Intergenic
1023551147 7:41371031-41371053 ATGTTGTTGGAAAGGAAAAAAGG + Intergenic
1024464922 7:49702121-49702143 ATTTTCTAGACAAGGAAAACGGG - Intergenic
1024687541 7:51763151-51763173 ATGACGTTAACAAGAAAAAAGGG - Intergenic
1024864754 7:53892203-53892225 ATGTTGCCAGGAAGGAAAACAGG + Intergenic
1026518215 7:71091267-71091289 ATGCTGCTAACATGGAATACAGG + Intergenic
1028078671 7:86547563-86547585 CTGGTGATAACCAGGAAAACAGG - Intergenic
1028553082 7:92093322-92093344 ATGTTTTTAATAAGGAAGCCTGG - Intronic
1028674272 7:93441233-93441255 ATGTTTTGAACAATCAAAACTGG + Intronic
1029647395 7:101866725-101866747 TTGTTGGTAACAATGAAATCAGG + Intronic
1029817072 7:103107090-103107112 ATGTTGATACCCAGGCAAACAGG + Intronic
1030285352 7:107820941-107820963 TTTTTGTTAACAAGTAAAATTGG - Intergenic
1030640656 7:112002743-112002765 ATTTTGTTAACAAGAAAAGCTGG + Intronic
1031822550 7:126522561-126522583 GTGTTATTAACAAGGAAAAAAGG + Intronic
1032068139 7:128788073-128788095 CTGTTTTTAATATGGAAAACTGG + Intergenic
1032902789 7:136329766-136329788 AAGATGAGAACAAGGAAAACGGG - Intergenic
1032906380 7:136372208-136372230 TTGTTGTTAACAAACAAACCTGG + Intergenic
1033274146 7:139958496-139958518 AAGTTACTAAAAAGGAAAACAGG + Intronic
1033365172 7:140667576-140667598 ATGTTATCAAAAAGGAAACCCGG + Intronic
1034570832 7:151955051-151955073 ATGTTGTTACCGAGCAAAAGAGG + Intergenic
1034972308 7:155426943-155426965 GTGTTGTTGATAAGCAAAACTGG - Intergenic
1035744682 8:1953199-1953221 ATGTTGTGAAGAAGGAAGCCGGG + Intronic
1035744694 8:1953297-1953319 ATGTTGTGAAGAAGGAAGCCGGG + Intronic
1035744700 8:1953346-1953368 ATGTTGTGAAGAAGGAAGCCGGG + Intronic
1036552206 8:9825754-9825776 AAGTTATGAACAAGGAGAACAGG + Intergenic
1036982472 8:13485506-13485528 ATGTTTTTAAAAGGGAATACTGG + Intronic
1037236786 8:16729590-16729612 ATTTAGTTGACAAGGAAAAAGGG + Intergenic
1037426493 8:18761166-18761188 AGGCTGTTAACAAGGTAAAAAGG + Intronic
1038557486 8:28535324-28535346 ATATTAATAACAGGGAAAACTGG - Intronic
1038691625 8:29768894-29768916 ATGTTGTCACCATGGAGAACAGG + Intergenic
1039121728 8:34155578-34155600 ATGTTATTGCCAAGGAACACAGG - Intergenic
1039709189 8:40038612-40038634 CCCTTGTTAACAAGGAAAAGAGG - Intergenic
1040641698 8:49342259-49342281 GTGTAGTTGACATGGAAAACAGG + Intergenic
1040934639 8:52769823-52769845 ATGTTAATAACAGGGGAAACTGG - Intergenic
1041204940 8:55489223-55489245 ATGTTAATAATAAGGGAAACTGG + Intronic
1041294351 8:56339120-56339142 ATGTTATTACCCATGAAAACAGG - Intergenic
1043064314 8:75547601-75547623 GTGTTGTTGACAAGGACAAAAGG + Exonic
1043561904 8:81502829-81502851 ATTTTGAAAACTAGGAAAACAGG + Intergenic
1043588412 8:81796545-81796567 ATTTTGTTAGCAAAGACAACAGG - Intergenic
1045165864 8:99604254-99604276 ATGTTGACAAGAAGGGAAACTGG - Intronic
1045850758 8:106695912-106695934 AAGATGTTAATAAGGGAAACTGG - Intronic
1045937166 8:107693941-107693963 ATATTATTAACAAGGTTAACAGG + Intergenic
1046942197 8:119942074-119942096 AATTTGTTAACATGCAAAACAGG + Intronic
1047585713 8:126269809-126269831 ATGTTAGTAATAAGGGAAACTGG + Intergenic
1050364172 9:4858898-4858920 ATGTTGTTAACAAGAATCCCTGG - Intronic
1051325913 9:15968451-15968473 ATATTTATAACAAGAAAAACCGG + Intronic
1051577121 9:18629185-18629207 ATGTTGTTTACAAGTAAGAGTGG + Intronic
1051702724 9:19841685-19841707 ATATTGGTAACAAGGAAGTCTGG + Intergenic
1052564115 9:30124823-30124845 ATGTTAGTAATAGGGAAAACAGG + Intergenic
1053621413 9:39822870-39822892 ATATTGCTAACAAGGCAAAATGG - Intergenic
1054262750 9:62884567-62884589 ATATTGCTAACAAGGCAAAATGG + Intergenic
1055879113 9:80977665-80977687 ATGTTTTAAAAAAGGAAAAATGG - Intergenic
1056102219 9:83310992-83311014 CTTTTGTAAACAGGGAAAACAGG - Intronic
1056239510 9:84630328-84630350 CTGTTGTGATCATGGAAAACTGG + Intergenic
1056307185 9:85301646-85301668 ATTTTGTTAACAAAGAGAAGAGG + Intergenic
1056748282 9:89323999-89324021 ATGTAGCTAAAAAGGAAAGCAGG - Intronic
1057067231 9:92066713-92066735 GTGATGTTAAAAAGGAAAAGAGG + Intronic
1058376979 9:104333929-104333951 ATGTTGTTAAGAAGCAAAGTAGG + Intergenic
1058543673 9:106038504-106038526 ATTTGGTTAACAAGGAAAGCTGG - Intergenic
1058594106 9:106596694-106596716 ATTTTCTTAACATGGGAAACAGG + Intergenic
1058632509 9:107003683-107003705 TTGTTTTTAATAAGGAAAACTGG + Intronic
1059536189 9:115083279-115083301 ATGTTATTATTAAGGAAAAAAGG + Intronic
1059968025 9:119635667-119635689 ATGCTGTTAAGAAAGAAAATTGG + Intergenic
1186288133 X:8067591-8067613 TTGTTTTTAACAAGGAATCCAGG + Intergenic
1186358114 X:8808634-8808656 ATGTTATTATAAAGGACAACAGG + Intergenic
1186620910 X:11239166-11239188 ATTATGTTAACAGGGCAAACTGG + Intronic
1187664404 X:21588654-21588676 ATCTTGTTAAAAAGAAAACCTGG + Intronic
1187760017 X:22572385-22572407 ATGTTAATAACAGGGGAAACTGG + Intergenic
1188038591 X:25345836-25345858 ATGTTTTAAAGAAGGAAAAGAGG - Intergenic
1188704684 X:33312735-33312757 ATGTTTTTAAACAGAAAAACAGG - Intronic
1188990263 X:36810087-36810109 CTGTTATTAAAAAGGACAACAGG - Intergenic
1189818137 X:44844771-44844793 ATTTTGTTAGTAAAGAAAACCGG + Exonic
1190420481 X:50225481-50225503 ATCTTTTTAAGAAGGAAAAATGG - Intronic
1190714121 X:53089619-53089641 AAACTGTTAATAAGGAAAACTGG - Intergenic
1191020159 X:55851036-55851058 CTGCTGTTACCCAGGAAAACAGG - Intergenic
1191647054 X:63492959-63492981 CTGCTGATAACCAGGAAAACAGG + Intergenic
1192824928 X:74685268-74685290 ATTTTTTTAAAAAAGAAAACAGG - Intergenic
1192894815 X:75431149-75431171 ATGTTAACAACAAGGGAAACTGG + Intronic
1193039086 X:76985740-76985762 ATGTTAATAATAAGGGAAACTGG - Intergenic
1193462932 X:81811470-81811492 ATGGTCTTAACCAGGAAATCTGG + Intergenic
1193665825 X:84315262-84315284 ATGGTGCTAGCTAGGAAAACTGG + Intergenic
1193964641 X:87970335-87970357 ATGTTCTTAACAAAGGAAACAGG + Intergenic
1194392056 X:93331236-93331258 GTGTTGACTACAAGGAAAACAGG - Intergenic
1195016055 X:100781998-100782020 ATGTTAATAACAGGGAAAACTGG - Intergenic
1195057199 X:101157791-101157813 ATGTTCTTAACATGAAAAAATGG - Intronic
1195286205 X:103386710-103386732 ATGTTGTTAACAACAAAGACAGG - Intergenic
1195891401 X:109699551-109699573 ATGTTGTTATCAAGAAATACAGG + Intronic
1195934805 X:110114677-110114699 ATGTTGTTAGCAAGGGAGACTGG + Intronic
1196157680 X:112448966-112448988 AGTATGTTAAAAAGGAAAACTGG + Intergenic
1196617445 X:117783598-117783620 ATGGTGGTAAAAATGAAAACAGG + Intergenic
1197244415 X:124153547-124153569 ATGCAGTCAACAAGGAAATCTGG + Intronic
1197728146 X:129789937-129789959 ATTTTTTTAAAAAGGTAAACTGG + Intronic
1197965869 X:132061103-132061125 TTGTTTTTAACTTGGAAAACAGG + Intergenic
1199344691 X:146724541-146724563 ATGTTGTTCTCAAGGCAAAGAGG - Intergenic
1199452121 X:147989303-147989325 CTGGTGATAACCAGGAAAACAGG - Intronic
1199735576 X:150683141-150683163 ATGTTGATAATAAGGAAACTGGG + Intergenic
1200678305 Y:6177241-6177263 CTGCTGTTACCCAGGAAAACAGG + Intergenic
1201263360 Y:12181694-12181716 CTGTTGATACCCAGGAAAACAGG + Intergenic