ID: 936665149

View in Genome Browser
Species Human (GRCh38)
Location 2:114586243-114586265
Sequence TGCTTGCTTGTTTTTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5589
Summary {0: 3, 1: 29, 2: 589, 3: 1163, 4: 3805}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936665149 Original CRISPR TGCTTGCTTGTTTTTGAGAC AGG (reversed) Intronic