ID: 936666127

View in Genome Browser
Species Human (GRCh38)
Location 2:114597892-114597914
Sequence GTGTGGTCAAAAATGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936666127_936666134 22 Left 936666127 2:114597892-114597914 CCCACCATCATTTTTGACCACAC 0: 1
1: 0
2: 0
3: 8
4: 165
Right 936666134 2:114597937-114597959 ATAATCTGGGAGTTTGTAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 161
936666127_936666132 8 Left 936666127 2:114597892-114597914 CCCACCATCATTTTTGACCACAC 0: 1
1: 0
2: 0
3: 8
4: 165
Right 936666132 2:114597923-114597945 TTGTATGCAGTACAATAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 131
936666127_936666133 9 Left 936666127 2:114597892-114597914 CCCACCATCATTTTTGACCACAC 0: 1
1: 0
2: 0
3: 8
4: 165
Right 936666133 2:114597924-114597946 TGTATGCAGTACAATAATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 183
936666127_936666135 29 Left 936666127 2:114597892-114597914 CCCACCATCATTTTTGACCACAC 0: 1
1: 0
2: 0
3: 8
4: 165
Right 936666135 2:114597944-114597966 GGGAGTTTGTAGAAGGAAAATGG 0: 1
1: 0
2: 0
3: 31
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936666127 Original CRISPR GTGTGGTCAAAAATGATGGT GGG (reversed) Intronic
900093979 1:932937-932959 GTGTGGTCATCAATGAGGGGCGG + Intronic
903566057 1:24266643-24266665 TTGTGGTCAAGAATCAGGGTGGG - Intergenic
907023590 1:51093767-51093789 TTGTGGTCAAAAAAGATACTTGG - Intergenic
910168354 1:84351857-84351879 GTGTGGCCCTACATGATGGTAGG + Intronic
911035047 1:93533591-93533613 GAGTGATCAAAAAGCATGGTTGG + Intronic
912373123 1:109188829-109188851 GGGTGGGCAAATAGGATGGTTGG + Intronic
915723166 1:157998808-157998830 GGGTGGTGAAAAGTGATTGTAGG + Intronic
916540629 1:165750668-165750690 GTGTGGACAAAAATTATAGCAGG + Intronic
917053161 1:170948190-170948212 ATGTGGATTAAAATGATGGTAGG - Intronic
917453482 1:175166480-175166502 CTGTGCTCATAAATGAAGGTCGG - Intronic
918153250 1:181817454-181817476 GTGTGGGCAAAACTCTTGGTGGG - Intergenic
919224232 1:194673997-194674019 GTCTTCTCAAAAATGATGCTGGG - Intergenic
921825059 1:219663210-219663232 ATGTGGACAAAAATGAGGGATGG - Intergenic
922489441 1:226004019-226004041 GTTTGGTCAAACATGATTCTGGG - Intergenic
923663956 1:235982329-235982351 GAGTGGTCAGAGATGAAGGTAGG + Intronic
924061519 1:240180023-240180045 GTTTGGTAAAAGATGATAGTTGG + Intronic
1063067826 10:2626783-2626805 CGATGGTCAAAAATGATGATTGG - Intergenic
1065477567 10:26157325-26157347 TTGTTGTCTAAAATGGTGGTGGG + Exonic
1069115845 10:64505537-64505559 GTGTGATCAACAATGATTATTGG + Intergenic
1070547360 10:77463243-77463265 GGGAGGTAACAAATGATGGTGGG - Intronic
1071114769 10:82205166-82205188 ATGTGGTCAAAACTGATGATGGG - Intronic
1071219078 10:83442661-83442683 GTCTGGTCATATATGATGATAGG - Intergenic
1073935159 10:108622467-108622489 GTGTGGTCCACAAACATGGTGGG - Intergenic
1075743145 10:124707937-124707959 GTTTGGTGGGAAATGATGGTGGG - Intronic
1075819187 10:125291187-125291209 GTGGGGGGAAAAAAGATGGTGGG + Intergenic
1077234688 11:1474537-1474559 GTCTGTTCAAAAATGCTGCTGGG - Intronic
1079273890 11:19015366-19015388 TTGTGGTCAGAAATGATATTTGG + Intergenic
1079468014 11:20750904-20750926 GTGTGATATAAAATAATGGTTGG + Intronic
1080876645 11:36280685-36280707 GTGTGGTCAGAAATGATCTTTGG - Intronic
1082850926 11:57764111-57764133 TTGGGGTAAAAAATGATGATAGG + Intronic
1082941062 11:58706046-58706068 GTGTGGTCCAAGAAGATGCTTGG - Intronic
1086609091 11:88732079-88732101 GAGTGGTCAAAGTTGGTGGTAGG - Intronic
1089617661 11:119704134-119704156 GTGTGCAGGAAAATGATGGTGGG - Intronic
1092027907 12:5258417-5258439 ATCTGGTCAAAAATGATTCTGGG + Intergenic
1092061955 12:5558198-5558220 GAGTGGTCATAAATTGTGGTAGG - Intronic
1092941549 12:13412802-13412824 TTGTGGTCAGAAAAGATAGTTGG - Intergenic
1093360714 12:18223787-18223809 ATTTGCTCTAAAATGATGGTAGG - Intronic
1093410351 12:18857987-18858009 GTCAGGTGAAAGATGATGGTTGG - Intergenic
1094301267 12:28967425-28967447 GTGTGGAGAAAAATGAGGGAGGG - Intergenic
1094334414 12:29332312-29332334 GTCTGGTGAAAACTTATGGTTGG - Intronic
1094351576 12:29531580-29531602 GGATGGTTAAAAATGATTGTGGG + Intronic
1097571789 12:61342364-61342386 GTGTGGTCAAAAAGCAAGGAAGG - Intergenic
1098107012 12:67079164-67079186 GTGTGGCTGGAAATGATGGTGGG + Intergenic
1098108599 12:67097434-67097456 GTGTGGTCAAAAATGAATCCTGG - Intergenic
1098201992 12:68065895-68065917 CTGTGGTCTAAGAAGATGGTTGG + Intergenic
1098856695 12:75660915-75660937 GTCTGGTTAGAAATGATGGTGGG - Intergenic
1100944113 12:99760329-99760351 CTGTGGTCCAAAAATATGGTTGG - Intronic
1101153829 12:101908701-101908723 GTGTGATCAGATATGAGGGTGGG + Intronic
1102862694 12:116350297-116350319 GAGTGTTCAAAGATGAAGGTGGG - Intergenic
1103209854 12:119158026-119158048 GTGAGGGCAAAAATAAAGGTGGG - Exonic
1105742370 13:23340635-23340657 GTGAGGTAAAAACTGAGGGTGGG + Exonic
1109920667 13:69053631-69053653 CTGTGGTCTGAGATGATGGTTGG - Intergenic
1113449000 13:110392711-110392733 CTGTGGTCAAGAATAATTGTTGG + Intronic
1113563981 13:111306947-111306969 CAGTGGTCAAAAATGATGAATGG - Intergenic
1115106960 14:29773121-29773143 GCGTTGTCTAAAATGATAGTTGG - Intronic
1116601999 14:46937709-46937731 GTCTGTTCAATAATGATGCTAGG + Intronic
1117225574 14:53654907-53654929 CTCTGGTGAAAAATGATGATAGG + Intergenic
1120134268 14:80847509-80847531 GTATGGATAAAAATGATAGTAGG + Intronic
1120271957 14:82323907-82323929 TTGTGGTCAGAAAAGATGCTTGG + Intergenic
1122591281 14:102853418-102853440 GTGGGGTAAAAAACGGTGGTGGG - Intronic
1126210466 15:46095393-46095415 GTGAGTACAAAAATGCTGGTCGG + Intergenic
1127169622 15:56287241-56287263 GTGGGGAAAAGAATGATGGTAGG - Intronic
1133579258 16:7127112-7127134 ATGTGGTCATAAATGGTGGCTGG + Intronic
1139762898 16:69201541-69201563 GTGTGTTTAAAATTGAGGGTGGG + Intronic
1144645197 17:16968470-16968492 GTGTTTTCAAAAATGATGCTGGG + Intronic
1145990701 17:29077762-29077784 GTGGGGTCAAGGGTGATGGTGGG + Exonic
1151070657 17:71206973-71206995 GTGGGGTAAAAAATGATGAATGG + Intergenic
1161660659 19:5543985-5544007 GTTTAGAGAAAAATGATGGTGGG + Intergenic
928124367 2:28605631-28605653 GTAGGGTCAAAAAGGAAGGTTGG + Intronic
929286711 2:40143337-40143359 GTGACAGCAAAAATGATGGTAGG + Intronic
929992513 2:46802050-46802072 GCCTGGTCAAAAGTGAAGGTGGG + Intergenic
932085945 2:68761146-68761168 GTCTTTTCAAAAATGATGCTAGG + Intronic
935943398 2:108264960-108264982 GAGTGGTCCATAATGCTGGTGGG - Exonic
936484339 2:112913830-112913852 GTGTGAACAAAATTCATGGTGGG - Exonic
936666127 2:114597892-114597914 GTGTGGTCAAAAATGATGGTGGG - Intronic
941700968 2:168604319-168604341 GTGTGTTCAAAAATATTTGTAGG + Intronic
943143553 2:184013837-184013859 GTGTGGTCAAAAATAATATCTGG - Intergenic
943156595 2:184187429-184187451 CTATGGTCAAAATTGATGTTGGG + Intergenic
943689951 2:190859559-190859581 GTGTGGCCAAAAAAAATGTTGGG + Intergenic
946995611 2:225388038-225388060 CAGTGGTGAAAAATGATGCTGGG + Intergenic
947106097 2:226669289-226669311 GTGTGTTGAAAATAGATGGTAGG + Intergenic
947310897 2:228800570-228800592 GTGTGGTCTGATATGGTGGTGGG - Intergenic
948714794 2:239854110-239854132 CTGGGGTCAAAAATGAGCGTGGG - Intergenic
1169006700 20:2213324-2213346 GTGTGGGCACAAACGAAGGTGGG + Intergenic
1171227048 20:23450700-23450722 TTGTGGTCAAATAGGATTGTAGG - Intronic
1173619136 20:44423406-44423428 GTGTGGTCAGCAGTGATGGAGGG + Intronic
1173707557 20:45123839-45123861 GTGTCCTCAGAAATGATGCTGGG - Exonic
1174538924 20:51274255-51274277 GTGTGGGAAAAGATGGTGGTGGG + Intergenic
1175314618 20:58038729-58038751 GGGTGGTCAAGGATGGTGGTCGG - Intergenic
1177474148 21:21596746-21596768 ATGTGGTCAAAGAATATGGTTGG + Intergenic
1177952679 21:27558618-27558640 GAGTGGTAAAAAATGATGAGAGG + Intergenic
1179808441 21:43854826-43854848 GCGTGGTCAAAAGCGGTGGTGGG - Intergenic
1181895935 22:26107366-26107388 TTGTGGTCACAAATCATGATAGG + Intergenic
1182971031 22:34577121-34577143 GTAATGTCATAAATGATGGTAGG - Intergenic
1183787744 22:40040564-40040586 GTGTGGTCATAAAAAATGATAGG + Exonic
950469948 3:13178373-13178395 GTGTGGTCAAGAGTGAGGATGGG + Intergenic
952414143 3:33075357-33075379 GGCTGGGAAAAAATGATGGTGGG + Intronic
952867757 3:37865992-37866014 GTGTGGTCAATACTGCTGTTTGG - Intronic
954361823 3:50126230-50126252 GTGGGGTCAGAAGGGATGGTGGG + Intergenic
955499764 3:59572152-59572174 TTGTGGTGAAAGATGGTGGTTGG - Intergenic
956054673 3:65286143-65286165 TTGTGGTTAACAATGATGGCTGG - Intergenic
959340958 3:105130242-105130264 CTGTGGTCTAAAAGTATGGTTGG + Intergenic
960916143 3:122696835-122696857 GTGTGGTCAAAAAAGTTAGATGG - Intronic
961609132 3:128122959-128122981 GAATGGTCAAAAAGGATGCTTGG + Intronic
961634777 3:128326361-128326383 GGGTGGGCAAAAGAGATGGTGGG - Intronic
963411580 3:144934516-144934538 TTGTGGTCAAAGAAGATGCTTGG - Intergenic
964182980 3:153909835-153909857 GTGTGGTATCAAATGATTGTGGG + Intergenic
965412035 3:168344313-168344335 TTGGGGTCAAAAATGAGGGACGG - Intergenic
965874989 3:173305787-173305809 GGTTGGTTAAAAATGAAGGTGGG - Intergenic
972172638 4:36365457-36365479 CTGTGGGTAAAAATGAAGGTAGG + Intergenic
972974332 4:44615130-44615152 GTGTTGACAAAAATAATGCTAGG + Intergenic
973129559 4:46633854-46633876 CTGTGGTCCAAAAGTATGGTTGG + Intergenic
975413278 4:74079962-74079984 TGGAGGACAAAAATGATGGTAGG + Intergenic
977053977 4:92165911-92165933 CTGTGTTCAAAGAGGATGGTTGG - Intergenic
977332646 4:95657053-95657075 CTGTGGTCTAAGATTATGGTTGG + Intergenic
978001877 4:103565532-103565554 CTGTGGTCCAAAAGAATGGTTGG - Intergenic
981512142 4:145569201-145569223 CTGTGGTCCAAAATAGTGGTTGG - Intergenic
981767383 4:148266559-148266581 GTGAGGTCCAAGAAGATGGTGGG + Intronic
981990424 4:150913070-150913092 TTGTGGTCAAAAAAGATACTTGG + Intronic
983069179 4:163249057-163249079 ATGTGGTCAAAGTTGGTGGTAGG + Intergenic
984258128 4:177411334-177411356 GTGTGTTAAAAAAAAATGGTCGG - Intergenic
985165160 4:187085853-187085875 GTATGCATAAAAATGATGGTGGG + Intergenic
985217096 4:187665196-187665218 GTGTAGTCATAAACCATGGTGGG - Intergenic
985221401 4:187709492-187709514 GTCTTTTCAAAAATGATGGTAGG + Intergenic
986727516 5:10610323-10610345 GGGTTGTCATAAATGAGGGTAGG + Intronic
989440727 5:41469967-41469989 GTGGGGTCAAAAGTGATATTGGG + Intronic
991173985 5:63664345-63664367 GAATTGTCAAAGATGATGGTTGG + Intergenic
994274487 5:97819745-97819767 TTGTGGTCAGAAAAGATGCTTGG + Intergenic
996173149 5:120321670-120321692 GTGAGGGCTAAAATGATGCTGGG - Intergenic
996456368 5:123687538-123687560 ATTTGGTCAAACATGATTGTGGG - Intergenic
1003348298 6:5292001-5292023 GTGAGGTCAGAAAGGAGGGTTGG + Intronic
1005837785 6:29720615-29720637 GTGTGGCAAAGAATGCTGGTGGG + Intergenic
1005926875 6:30451922-30451944 GGGTGGTCAAAAATGGTGTGTGG + Intergenic
1005931021 6:30484124-30484146 ATATGGTCAAAATTTATGGTCGG + Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1008164100 6:48114245-48114267 GCCTGGTCAATAATGGTGGTAGG + Intergenic
1009770008 6:68133764-68133786 TTGTGGTCAAAGAAGATGCTTGG + Intergenic
1012567194 6:100672593-100672615 GTGTGTTCACAAATGTTGGAAGG + Intronic
1018067080 6:160131708-160131730 GTGTGGTCAAAAAATTGGGTGGG + Intronic
1019111457 6:169719601-169719623 GTGTTCTCAAAAATGGTGCTGGG + Intronic
1023303743 7:38801316-38801338 GTGTGCTCAAAAATGGAGGGGGG + Intronic
1027430467 7:78107088-78107110 GTCTGTTCAAAAATGGTGCTGGG - Intronic
1030385661 7:108864954-108864976 GTGTGGACAATAATGGTAGTAGG - Intergenic
1030881008 7:114879686-114879708 TTGTGGTCAGAAAAGATGTTTGG + Intergenic
1031475226 7:122212983-122213005 GTGTGGTCAGAGATGATGCTGGG - Intergenic
1032546621 7:132749158-132749180 GTGAGGGCAAGAATGATGGGAGG - Intergenic
1032935440 7:136725277-136725299 ATGTGGTAAAATATAATGGTAGG + Intergenic
1033824869 7:145177315-145177337 GTGTACTAAAAAATGATCGTAGG + Intergenic
1034237809 7:149586208-149586230 CTGTAGACAAAAATGCTGGTGGG - Intergenic
1036953828 8:13166138-13166160 ATGTGGTCAAAAAAGATGCCAGG - Intronic
1037022467 8:13990490-13990512 ATTTGGTGAAAAATAATGGTTGG + Intergenic
1037385875 8:18340839-18340861 TTGTGGTCAGAAATGATACTTGG - Intergenic
1038347962 8:26749472-26749494 ATGTGGTCAAAGATGATGCCTGG + Intronic
1040837308 8:51746058-51746080 GTGTCTTAAAAAATAATGGTAGG - Intronic
1046110664 8:109719646-109719668 GTTTGGTCAATAAAGATGGAGGG + Intergenic
1047587273 8:126286502-126286524 GTGTGGTAAAAAAAAATGTTGGG - Intergenic
1048499990 8:134966817-134966839 ATATGGTCAGAAATGATGGAAGG - Intergenic
1048995159 8:139789604-139789626 GTGTGGTCAACAGTGCTGGGGGG + Intronic
1049053685 8:140218654-140218676 GTGTTGTCAAAAATAACAGTGGG + Intronic
1050029022 9:1365647-1365669 GTTTAGTCAAAAATGATAATAGG + Intergenic
1051050265 9:12924108-12924130 GTGTGGTCAAAACAGATCGTTGG + Intergenic
1059618630 9:115978554-115978576 GTGTAGTAAAATATGATGGAAGG + Intergenic
1061928861 9:133821955-133821977 GTGAGGACAAAAATAATGGTCGG - Intronic
1189593515 X:42540444-42540466 TTGTGAACAAAAATGATGATTGG - Intergenic
1189646198 X:43135296-43135318 GTGTTGTAAAAACTGATGCTGGG - Intergenic
1190016661 X:46833365-46833387 TTTTGGTCAAGAGTGATGGTAGG + Intergenic
1190538285 X:51450635-51450657 GTGTTTTCAAAAATGATGCAGGG - Intergenic
1190759270 X:53426219-53426241 GTGTAGTCAAAGACGGTGGTCGG + Intronic
1192064584 X:67868035-67868057 CAGTGGTCCAAAAGGATGGTTGG + Intergenic
1193270152 X:79519250-79519272 GTGTGGTCAATAATGGTCATTGG - Intergenic
1194660080 X:96621172-96621194 GGTTGGTCATAAATGATTGTTGG - Intergenic
1196050581 X:111299566-111299588 GTGTGGGCATAAAGAATGGTGGG - Exonic
1199227208 X:145391653-145391675 GTGTGGTCAGATAGTATGGTTGG + Intergenic
1199415042 X:147572668-147572690 CTGTGGTCCAAAAGTATGGTTGG - Intergenic