ID: 936666389

View in Genome Browser
Species Human (GRCh38)
Location 2:114601476-114601498
Sequence TGTTTTAAAGGGATTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 398}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936666389 Original CRISPR TGTTTTAAAGGGATTGGGGA GGG Intronic
901301304 1:8201658-8201680 TGTGTTCAGGGGTTTGGGGAGGG + Intergenic
901631501 1:10650338-10650360 TGTTTAAAAGGGGATGGGGGAGG - Intronic
902562266 1:17284901-17284923 TTTCTGAAAGGGTTTGGGGAGGG + Intergenic
904174307 1:28615360-28615382 TATTTTAATGGGATTAGGGAGGG - Intronic
905341911 1:37284057-37284079 AGTCCTAAAGGGATTGGGCAGGG - Intergenic
905911625 1:41658951-41658973 TCATTTACAGGGGTTGGGGATGG + Intronic
906027821 1:42689592-42689614 TGTTTTAAAAGGAGTGGGAGGGG + Intronic
906242164 1:44248810-44248832 TGTTTTCCTGGGGTTGGGGAAGG + Intronic
906726940 1:48051057-48051079 AGGGTTAGAGGGATTGGGGAAGG + Intergenic
907897897 1:58709912-58709934 TGATTTCAGGGAATTGGGGAGGG - Intergenic
908443781 1:64182295-64182317 AGAGTTGAAGGGATTGGGGATGG - Intergenic
908521497 1:64947585-64947607 TGTCTTAAGGGGGTTGGGGGAGG - Intronic
908641835 1:66232460-66232482 TGTTTTAAACACATTAGGGAAGG + Intronic
911672054 1:100618660-100618682 TGTTTTAAGATGCTTGGGGAAGG - Intergenic
911822434 1:102438497-102438519 TGCTTTAAAAGCAGTGGGGAAGG + Intergenic
913327031 1:117636337-117636359 TGATTTAGAGGGACTGCGGAAGG + Intergenic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913483484 1:119312069-119312091 CGTTTTAACGGTCTTGGGGAGGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914763981 1:150622083-150622105 TGTTTTATTGGGGTTTGGGAGGG - Intronic
914771663 1:150691633-150691655 TTTTTGTAAGGGATAGGGGAAGG - Intronic
915721014 1:157985660-157985682 TGTTTGAATGTGAATGGGGATGG + Intergenic
915996042 1:160564737-160564759 TGTTTTTCAGGGACTGGGGAAGG + Intronic
916850432 1:168697484-168697506 TGTGTTTAAGTGGTTGGGGATGG + Intronic
916965901 1:169942911-169942933 TTTTTTAAAGGGGTGGGGGGGGG - Intronic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917621019 1:176795959-176795981 TGTTTTAAAGAGAAGGGAGAAGG + Intronic
918371750 1:183868048-183868070 TTTTTAGAAGGGCTTGGGGAAGG + Intronic
918803417 1:189003616-189003638 TGTCTTAAAGGTATTAAGGAAGG + Intergenic
919762091 1:201104353-201104375 GGTTTTCAAGGGATTGGGGAGGG - Intronic
919816032 1:201440147-201440169 TGTATTGAAAGGATGGGGGATGG + Intergenic
919887038 1:201942162-201942184 TGTTAGCAGGGGATTGGGGAGGG - Intronic
919963882 1:202501559-202501581 TGTTTTTAAGGAATTGTTGAAGG + Intronic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921755027 1:218845496-218845518 AGTTTTACAGGGAATAGGGAAGG + Intergenic
922644035 1:227267004-227267026 TGGTTTAAAGTTGTTGGGGAAGG + Intronic
923397202 1:233578589-233578611 TGTCTTAAAGGGATGGAGTAGGG + Intergenic
924530511 1:244889812-244889834 TTTTTTTAAGAGATTGGGGATGG + Intergenic
1063331874 10:5167629-5167651 TGTTGTGAGGGGAGTGGGGAGGG + Intergenic
1063464787 10:6236099-6236121 TGTTTAAAAGGGCGCGGGGAAGG - Intergenic
1063668376 10:8080033-8080055 TGTTTTGAGGGGATTGGGTGTGG + Intergenic
1063794749 10:9500776-9500798 TGTTTTATAAGGCTTGGAGATGG - Intergenic
1064376663 10:14802557-14802579 TTTTTTAAAGGGATTGTAGGGGG + Intergenic
1064828788 10:19438125-19438147 GGTTTTTAAGGGTTGGGGGAGGG - Intronic
1065259048 10:23905749-23905771 TGGTTTAAAGTCATTGGGGATGG - Intronic
1065401598 10:25308720-25308742 TGGTTTTAGGGGATGGGGGAGGG - Intronic
1065498914 10:26359281-26359303 TCTTTTAAAAGGATGGGGGCTGG + Intergenic
1065753104 10:28906593-28906615 TGTTTTACATGGAGTGGGGGCGG - Intergenic
1066084165 10:31960618-31960640 TATTTAAAAGGGAGTCGGGAGGG - Intergenic
1067562747 10:47315237-47315259 TGGCTTACTGGGATTGGGGAGGG + Intergenic
1068916105 10:62433359-62433381 TGTTTTATAAGAATTGGGGCTGG + Intronic
1069083043 10:64108425-64108447 TGTTTTAAATGGAATGGCCAGGG - Intergenic
1069221724 10:65891937-65891959 TATTTTAAAGGGACTGAGAAAGG - Intergenic
1070754981 10:78986400-78986422 TGATTCAAAGGGACTGGGGTGGG + Intergenic
1071885432 10:89944564-89944586 TGTTAAAAAAAGATTGGGGATGG + Intergenic
1071998029 10:91165421-91165443 TGTTTTCCAGGCAGTGGGGAGGG - Intronic
1072052915 10:91724298-91724320 TGTGATGAATGGATTGGGGAGGG - Intergenic
1072601196 10:96931582-96931604 TCTTTTAAAGGAGTTGTGGAAGG - Intronic
1072629152 10:97133787-97133809 TGTGCTGAAGGGTTTGGGGAGGG + Intronic
1072863531 10:99032461-99032483 GGTTTGAAAGGGATGGGGCAGGG - Intronic
1074503614 10:114046568-114046590 TTTTTTAAAGGGAGAGGGGCTGG + Exonic
1075170800 10:120111940-120111962 TATTTTATTGGGAATGGGGAAGG - Intergenic
1075358256 10:121803347-121803369 TGTTTTAAAAGGAGGAGGGAGGG + Intronic
1075686538 10:124368470-124368492 CGTTTTAACAGGGTTGGGGAGGG - Intergenic
1075710604 10:124528657-124528679 GATTTTAAAGGCAGTGGGGAAGG - Intronic
1077371844 11:2185988-2186010 TGTTTGGAAGGGGGTGGGGATGG + Intergenic
1077674864 11:4187129-4187151 TCTTTAAAAGGGAATGGGGAGGG - Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079142498 11:17821608-17821630 TGTTTGTAAGGGAATGAGGAGGG - Intronic
1079590334 11:22175846-22175868 TTTATCAAAGGGCTTGGGGAAGG - Intergenic
1079872116 11:25811403-25811425 TACTTTATAGGGATAGGGGAGGG + Intergenic
1080367002 11:31586364-31586386 CGTTTTACAGGTGTTGGGGAAGG + Intronic
1081643882 11:44776885-44776907 TGTTTTAAAGGGATTGGGTTTGG + Intronic
1081836484 11:46159815-46159837 TGTTTTCAAGGAAGTGGGGGTGG + Intergenic
1081956038 11:47094295-47094317 TGGTTTCCAGGGATTGGGGAAGG + Intronic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082175432 11:49053291-49053313 TGTTCTGAAGGAATGGGGGAGGG + Intergenic
1082733163 11:56824878-56824900 TGTTTTAATGGGAATGGTCAAGG - Intergenic
1082963403 11:58940783-58940805 TATTTTATAGAGATGGGGGAGGG - Intronic
1082991183 11:59208293-59208315 TGTTTTTAAGTGGTTGGGGAGGG - Exonic
1083105704 11:60356635-60356657 TTTTTTTGAGGGAGTGGGGAGGG - Intronic
1083546937 11:63555865-63555887 TGTTTCAAAGGGACAGAGGAAGG + Intronic
1083732880 11:64662483-64662505 TGTTTAAAAGGGGTCGGGGCCGG + Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084443917 11:69192473-69192495 TGTTTTCTAGGGAGTGGGAAAGG + Intergenic
1084841925 11:71859817-71859839 TGGTTTCCAGGGACTGGGGAGGG + Intergenic
1086658923 11:89390998-89391020 TGCTATAAAGAGATGGGGGAAGG + Intronic
1086690322 11:89782777-89782799 TGTTCTGAAGGAATGGGGGAGGG - Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1086715533 11:90057180-90057202 TGTTCTGAAGGAATGGGGGAGGG + Intergenic
1087081038 11:94171315-94171337 TATTTGAAAGTGCTTGGGGAAGG - Intronic
1087540092 11:99505682-99505704 TGTTACATAGGGATTGGGGGAGG - Intronic
1088229702 11:107661221-107661243 AGGTTTAAAGGGCTTGGGTAAGG - Intronic
1088682056 11:112251935-112251957 GGTTTTAAAGGGATTGGGGGTGG - Intronic
1089071661 11:115704754-115704776 TCTTTTATAGGGAGTGGAGATGG + Intergenic
1089249296 11:117145713-117145735 TGTTTCAGAGGGAGTGGGTATGG - Intronic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1090661071 11:128881985-128882007 TGTTTTATTGGGATTTTGGATGG - Intergenic
1090737542 11:129623330-129623352 TGTTTTATAAGCACTGGGGAAGG - Intergenic
1091322310 11:134660452-134660474 TGTTCTTTTGGGATTGGGGAGGG + Intergenic
1091549161 12:1524741-1524763 TGTTTTTAAGAGATGGGGGGGGG + Intergenic
1092792823 12:12084469-12084491 TGTTTTAAAGAGAAAGGGCAGGG - Intronic
1094352798 12:29545341-29545363 TGTTTTAAAGAGATGGAGGCCGG + Intronic
1095175481 12:39087091-39087113 TGTATTATAGGGATGGGGTAGGG + Intergenic
1095621856 12:44265763-44265785 TGTTTTCCAGGGCCTGGGGAAGG - Intronic
1095875513 12:47076410-47076432 TTTTTTAAAGGGGGAGGGGAAGG - Exonic
1096008548 12:48193001-48193023 TGGATGCAAGGGATTGGGGATGG - Intergenic
1098078187 12:66756011-66756033 ATTTTTAAAAGGATGGGGGAAGG - Intronic
1098544994 12:71702088-71702110 TTTTTTAAAGAAACTGGGGAAGG + Exonic
1098915199 12:76250072-76250094 GGTTTTAGGGGGATGGGGGAGGG + Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1099772170 12:87075237-87075259 TGTTTTAAAGGAAGGGGGGAAGG - Intergenic
1100472432 12:94905455-94905477 TTTTTTCAAAGGATTGGTGATGG - Intronic
1102007550 12:109598062-109598084 TGTTTTGAAGGGAAGGGGCAGGG - Exonic
1103103481 12:118201961-118201983 TGGTTGAAAGGGATGGGGAATGG - Intronic
1103127413 12:118435941-118435963 TGTTTAATAGAGATAGGGGATGG + Intergenic
1103368348 12:120399437-120399459 TCTTTTCAAGGGGGTGGGGAAGG - Intergenic
1103650446 12:122427848-122427870 TTTTTTAAAGAAATTGGGGCTGG - Intergenic
1103747140 12:123132681-123132703 TGTTTATCAGGGGTTGGGGAGGG - Intronic
1104904892 12:132207866-132207888 TGTTTTGCAGGGATTGGAAAGGG - Intronic
1106145553 13:27046839-27046861 TGAGTTAAAGAGATGGGGGAAGG + Intergenic
1106288782 13:28341724-28341746 AATTTGAAAGGGATTGGGGGAGG - Intronic
1106773554 13:32986495-32986517 AGTCTTAAAGGGAATGAGGAGGG + Intergenic
1108409352 13:50131153-50131175 GCTTTAAAAGGGATGGGGGATGG - Intronic
1108492384 13:50994258-50994280 TGTTTTAAAGGGTGGTGGGAAGG - Intergenic
1108819933 13:54336033-54336055 TGTTAAAAAGGGCTTGGGGCCGG - Intergenic
1109038594 13:57300171-57300193 TTTTTAACAGGGGTTGGGGAAGG - Intergenic
1110390357 13:74966426-74966448 TTTTTTAAAAGGATCCGGGAGGG + Intergenic
1110879861 13:80558539-80558561 AGTTTTCAATAGATTGGGGAGGG + Intergenic
1111281840 13:86036510-86036532 TGTGTTACTAGGATTGGGGAAGG + Intergenic
1111998225 13:95185979-95186001 TTTTTTAAAGGGAGTGGAGAAGG + Intronic
1112631876 13:101170382-101170404 TGGTTTAACGACATTGGGGAAGG + Intronic
1115105574 14:29757758-29757780 TGGTTTAAAGGGAGTGAGAATGG + Intronic
1115705583 14:35994698-35994720 CCTTTTAAAGGGCTTGAGGAAGG + Intergenic
1115913036 14:38277392-38277414 TATTTTAACAGGATAGGGGATGG - Intergenic
1116441160 14:44954894-44954916 TGTTTTAAAGTTATTTGGAATGG - Intronic
1117332891 14:54731154-54731176 TGTTTCAAAGGAATTGGGAAGGG - Intronic
1117898464 14:60510402-60510424 TGTTTTCAAAGCATTAGGGAGGG - Intronic
1118580002 14:67286318-67286340 TGTCTGTATGGGATTGGGGAAGG + Intronic
1119373444 14:74167706-74167728 TTTTTTATAGAGATGGGGGAGGG + Intronic
1121689920 14:95870511-95870533 TGTTTGAAAGGGATTAGCTATGG - Intergenic
1122323903 14:100871377-100871399 TGTGTCACATGGATTGGGGACGG - Intergenic
1122428818 14:101627189-101627211 TGTTTGAAAGGGCTTGGACAGGG - Intergenic
1124134645 15:27023473-27023495 TGGTTTCCAGGGACTGGGGAAGG - Intronic
1124998891 15:34751741-34751763 TGTTTACTAGGGATGGGGGATGG - Exonic
1127440948 15:59007231-59007253 TGTCTTCAAGGGATGGGGAAAGG - Intronic
1128852814 15:70977723-70977745 TGTTTTAAAGGAAATGGAAATGG - Intronic
1129195704 15:73964980-73965002 TGTGTTAAAGGGTTTCCGGACGG + Intergenic
1129467866 15:75733985-75734007 GGTTTTAAAGGTCATGGGGAGGG + Intergenic
1129620719 15:77142812-77142834 TGTTGTAAGGGGCTGGGGGAAGG + Intronic
1131826585 15:96326486-96326508 TGGTTTAAGGGGTTCGGGGAAGG + Intronic
1131866560 15:96717495-96717517 TGCTTTAAGGGGAGTGGGGCAGG - Intergenic
1134333436 16:13271338-13271360 TGATTTAATGGGCTTGGGGATGG - Intergenic
1138279055 16:55759104-55759126 TGTTTGACAGGGTCTGGGGAAGG - Intergenic
1138289485 16:55834577-55834599 TGTTTGACAGGGTCTGGGGAAGG + Intergenic
1139749731 16:69102318-69102340 TGTTTTTAAGTGATTGGGTGTGG + Intergenic
1140301586 16:73763227-73763249 TGTATTAAAGGCCTTGGAGAAGG + Intergenic
1140523898 16:75606037-75606059 TGTTTTTTAGAGATTGGGGGGGG + Intronic
1140965897 16:79965683-79965705 TGTTTTAGAGGGATGGGGAGTGG + Intergenic
1142065845 16:88062177-88062199 TCTTTTAAAGGCATGGGGGGTGG + Intronic
1142241458 16:88948920-88948942 TGTGTAAAAGGGAATGTGGATGG + Intronic
1143416289 17:6753275-6753297 TTTTTAAATGGGATTGGGGTTGG + Intergenic
1143875756 17:9989558-9989580 TTTTCTAATGGGATTGGGGGAGG + Intronic
1145834174 17:27941325-27941347 TGTGTGACAGGGGTTGGGGAGGG + Intergenic
1147702091 17:42402722-42402744 TGTTTTAAGGGATTGGGGGAGGG - Exonic
1147702092 17:42402723-42402745 TTGTTTTAAGGGATTGGGGGAGG - Exonic
1148564043 17:48622790-48622812 TGTATTCAAGTGAATGGGGAAGG - Exonic
1149067761 17:52500606-52500628 TGTTTTAGAGGGAGAAGGGAAGG - Intergenic
1149546255 17:57505990-57506012 TGTTTTAAAGAGAGTCTGGAGGG - Intronic
1149732352 17:58958877-58958899 ATTTTAAAAGGGATTGGGGCTGG - Intronic
1150347969 17:64419244-64419266 TATTTTAAAGGTGTTGGGGGTGG - Intergenic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1150995958 17:70318169-70318191 TGTTTTTGAAGGATTGGAGAAGG - Intergenic
1151289016 17:73135237-73135259 TCATTTAAAAGGATTGGAGAGGG - Intergenic
1151973740 17:77472328-77472350 TGCTTGAAAGGGTTTGGCGAGGG + Intronic
1153309071 18:3660176-3660198 TTTTTTAAAAGGATTGGGGGTGG + Intronic
1153899931 18:9609256-9609278 TGTTAAATAGGGATTTGGGAGGG - Intronic
1154016885 18:10626817-10626839 TGGTTTAAAGGGATTGCCCAGGG - Intergenic
1154510973 18:15101661-15101683 TGTTTTGAAGTGATTGTGTAGGG - Intergenic
1155283062 18:24260624-24260646 TGGTTTTCAGGGACTGGGGATGG + Intronic
1155294620 18:24373818-24373840 AGTTCTTAAGGGAGTGGGGAGGG - Intronic
1157546424 18:48549829-48549851 TGTTTGCAAGGAAGTGGGGAAGG + Intronic
1157605839 18:48925444-48925466 TGCTTTAAGGGAAATGGGGAAGG - Intronic
1161939371 19:7393347-7393369 TGTTTTGAAGTGATTGGGTTTGG + Intronic
1162905674 19:13822122-13822144 TGTTTTAAAGAGATGGGCCAAGG - Intronic
1164845436 19:31428603-31428625 TTTTTTACAGGGTTGGGGGAGGG + Intergenic
926467688 2:13211854-13211876 TGTTTTAAAGGCACTTGGAATGG - Intergenic
926631981 2:15144828-15144850 TGTTTTGAAGGAATGGGGCAGGG + Intergenic
928745408 2:34408147-34408169 TATGTAAAAGGGATTGGTGATGG + Intergenic
929277056 2:40037277-40037299 TGTTGTAAAGGTGGTGGGGAGGG + Intergenic
929283948 2:40114764-40114786 AGTTTTAAAGTGATTGGGGGAGG + Intronic
929411260 2:41699323-41699345 TATTTAAAAGGGATTTGGGGAGG - Intergenic
930216387 2:48701570-48701592 TATTTTAAAGGGGATGGTGAGGG - Intronic
932359768 2:71094436-71094458 TATTTTAAAGGGATTGTGTCTGG + Intergenic
933283655 2:80360132-80360154 TGTTTTGAAGGGATTGGAAGAGG + Intronic
934032058 2:88056638-88056660 TTTTTTATAGAGATTGGGCAGGG + Intergenic
934458615 2:94197211-94197233 TGTTTTACAGTATTTGGGGAGGG - Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
934587910 2:95520513-95520535 TGTTCTGAAGGAATGGGGGAGGG - Intergenic
934909127 2:98234605-98234627 AGAGTTAAAGGAATTGGGGATGG - Intronic
935136983 2:100314633-100314655 TGTTTTCAAGGACTTGGGGTAGG - Intronic
935319178 2:101868990-101869012 TGATTTAAAGAGTTTTGGGAGGG + Intronic
935702874 2:105827785-105827807 TGTTTACAAGGGGTTGGTGATGG + Intronic
935836053 2:107055047-107055069 TTTTTTAAAGTGATTGTCGATGG + Intergenic
935938568 2:108214295-108214317 TTTCTTATAGGCATTGGGGATGG - Intergenic
936249115 2:110853744-110853766 TGGTTTACAGGCATGGGGGAAGG + Intronic
936666389 2:114601476-114601498 TGTTTTAAAGGGATTGGGGAGGG + Intronic
937495559 2:122415573-122415595 TGTTTTTAAGGAAGTAGGGATGG - Intergenic
937674028 2:124569656-124569678 TGTTGAAAAGGGATTGGCAAAGG - Intronic
938225657 2:129614126-129614148 TGTTGTGAGGGGATTGGGGTGGG + Intergenic
938933241 2:136105657-136105679 TGTTTTAAAAGGTGTAGGGAAGG - Intergenic
939064308 2:137464223-137464245 TGTTTTGAGGGTTTTGGGGAGGG - Intronic
940415914 2:153419518-153419540 TGTTTTTTAGGGATTAGGGAGGG + Intergenic
940761946 2:157748436-157748458 TGTTTAAGAATGATTGGGGAGGG + Intronic
941890395 2:170574939-170574961 ATTATTAAAGGGAGTGGGGAGGG - Intronic
941975367 2:171398522-171398544 AGTTTTTAATGGATAGGGGAGGG + Intronic
941996682 2:171607798-171607820 TTTTTTTAAGAGATTGGGGGGGG - Intergenic
942441294 2:176039550-176039572 TGGGTAAAAGTGATTGGGGAAGG - Intergenic
943063697 2:183064585-183064607 TGATTTAAAACGATGGGGGAAGG - Intergenic
943078793 2:183231417-183231439 TATTTCAAAGGGATTTTGGAAGG + Intergenic
943285852 2:185999128-185999150 TGTGTTACAGGGAATAGGGAGGG - Intergenic
943430396 2:187792802-187792824 TGTTTTAAATTTAGTGGGGATGG + Intergenic
944127597 2:196312102-196312124 TGATTTGAAGGGAGTGGGAAAGG - Intronic
945454508 2:210034536-210034558 TGATTTAAAGGGATGGGGTGGGG + Intronic
947548543 2:231029646-231029668 TTTGTTGAAGGGACTGGGGAGGG - Intergenic
947609561 2:231515258-231515280 TGTTTTTAGGGGATAGGGAAGGG + Intergenic
1169582316 20:7037344-7037366 TGTTTTAGAGAGAGTGGTGAGGG - Intergenic
1170452603 20:16499820-16499842 TCTTTTAAAAGGATTTAGGAAGG - Intronic
1170869764 20:20194896-20194918 TTATTTTAAGGGATTTGGGATGG + Intronic
1171029232 20:21662498-21662520 TATTTTAGAGTGTTTGGGGAAGG + Intergenic
1171381284 20:24736125-24736147 TTTTTTAAAAAGATTGGAGAGGG + Intergenic
1172890433 20:38260422-38260444 TGTTCTGCAGGGAATGGGGAGGG + Intronic
1174217894 20:48931258-48931280 TGTTTAAATGTCATTGGGGAGGG + Intronic
1174374891 20:50119955-50119977 TTTTTTAAATGGCTGGGGGAGGG - Intronic
1175230626 20:57471298-57471320 TGTGTTAAAGGAAATGGTGAGGG - Intergenic
1175406021 20:58729270-58729292 GGTTTCCAAGGGATAGGGGAAGG + Intergenic
1175623704 20:60472954-60472976 TGATTTGCAGGGTTTGGGGAAGG - Intergenic
1175899608 20:62354840-62354862 TGTTTGAGAGGGGCTGGGGAGGG - Intronic
1179607028 21:42523275-42523297 TGTTTTGAGGAGATTGGAGAAGG + Intronic
1180114103 21:45685226-45685248 GGTTTTAAAGGTTGTGGGGAAGG + Intronic
1182762493 22:32734102-32734124 TGCTTTAAAGGGCCTGGGGTGGG + Intronic
1183110280 22:35643772-35643794 TGTGTTGAGGGGATGGGGGATGG - Intergenic
1183698743 22:39437999-39438021 TGTTTTAAGGGGGTTTGAGAAGG - Intergenic
949838501 3:8294676-8294698 TGTTTTTAAGATATTGGGGCTGG - Intergenic
949981400 3:9504020-9504042 TTTTTTTAAGAGATTGGGGGAGG - Intronic
950633820 3:14301417-14301439 TTTTTGAAAGGCATGGGGGAAGG - Intergenic
951273474 3:20656295-20656317 TGTTTTAAAGGCAGAGGGGAAGG - Intergenic
951402976 3:22257684-22257706 TATTTAAAAGGCATTGTGGAGGG - Intronic
952559706 3:34577076-34577098 GATTTTGAAGGGATTGGAGATGG + Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
957150618 3:76481650-76481672 TGGTTTAAAAGGACTGGGGTAGG - Intronic
957310415 3:78511373-78511395 TGTTTTTAAGGGTTTTGGAATGG + Intergenic
958908617 3:99968837-99968859 TGTTTTAAAGTAAATGGGTAGGG + Intronic
959500039 3:107096523-107096545 TGATTGCCAGGGATTGGGGATGG + Intergenic
959693212 3:109221466-109221488 TGTTTTTAAGGACTTGGGGGAGG + Intergenic
959701171 3:109300490-109300512 CATTTTAAAGGGATTGGTAAGGG - Intronic
960090509 3:113633754-113633776 TCTATAAAATGGATTGGGGACGG + Intergenic
960379947 3:116947708-116947730 TGTTTAAAAGGGAGAGGGGAGGG + Intronic
960649686 3:119933061-119933083 TGTTTTGCAGGGGTTGGGGTGGG - Intronic
960852558 3:122071293-122071315 TGGTTTCCAGGGGTTGGGGAGGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962904036 3:139785910-139785932 TGTTTTCAAGGGGGTGTGGATGG + Intergenic
963243495 3:143035008-143035030 TGTTTTAAATGGGTGGGGGGAGG + Intronic
963773516 3:149414892-149414914 AGTTTGAAAGTGATTGAGGAGGG + Intergenic
964349672 3:155790600-155790622 TGCTGCAAAGGGATGGGGGAGGG - Intronic
965314334 3:167172583-167172605 TGTTTTTAAGGGTTTTGGAATGG - Intergenic
965596200 3:170413818-170413840 TTTTTTATAGAGATGGGGGAGGG - Intergenic
967003157 3:185356385-185356407 TTTTTTAAAGGGAGTAAGGAGGG + Intronic
967721517 3:192821022-192821044 TGTTTAAAATGGATTTGTGAGGG - Intronic
969783038 4:9425849-9425871 TGGTTTCCAGGGACTGGGGAGGG + Intergenic
970097107 4:12476716-12476738 TCTTTTGGAGGGGTTGGGGAGGG + Intergenic
970526317 4:16935872-16935894 TGTTTTAAAAGAATGGGCGATGG + Intergenic
971127965 4:23775189-23775211 GGTTTTCAAGGGAATTGGGAGGG - Intronic
971146149 4:23978740-23978762 TTATTTAAAGCGACTGGGGAGGG + Intergenic
971303721 4:25462789-25462811 TGTTTGAAAGGGAGTGGTGTGGG - Intergenic
972696625 4:41452745-41452767 TGATTTTGAGGGATTGAGGAAGG - Intronic
976563006 4:86523283-86523305 TGTATGGCAGGGATTGGGGATGG - Intronic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
976831281 4:89317630-89317652 TGTTTTAAAGAGAAGAGGGATGG + Intergenic
977675445 4:99742163-99742185 TGTGTTTAAGGGATTCAGGAAGG - Intergenic
978036038 4:103996229-103996251 TGTTTTATAGGGATTAGAGGAGG - Intergenic
978325881 4:107553780-107553802 GGTTTTTAAGGGTGTGGGGATGG + Intergenic
978515245 4:109561514-109561536 TGTTTGAAAGAGAATGAGGAAGG + Intronic
978718254 4:111872488-111872510 TGTGTTTAAGGCATTGGGAAAGG + Intergenic
979063850 4:116101494-116101516 TGTGTTTATGGGATTGGGGTTGG - Intergenic
980237228 4:130124213-130124235 TAATCAAAAGGGATTGGGGAAGG - Intergenic
983195321 4:164799981-164800003 TGTTTTAAAGGGGTTGTGTTGGG - Intergenic
983634555 4:169883793-169883815 TGTTTTAAAGGGATAGTGATTGG - Intergenic
984310383 4:178051003-178051025 TGGTGTAAGGGGATGGGGGAGGG - Intergenic
984819197 4:183865307-183865329 GGTTTTAAAGTGACTGGGGTGGG + Intronic
985292374 4:188399805-188399827 TGATTTAAAGGGAAAAGGGAGGG + Intergenic
986436903 5:7743195-7743217 TGGTTTCATGAGATTGGGGAGGG + Intronic
987201615 5:15583329-15583351 TGTTGGAAAGAGATTTGGGAGGG - Intronic
987348800 5:17002862-17002884 TGTTTTTGAGGGAGTGGGGTAGG + Intergenic
987510199 5:18827528-18827550 TGTGTTAAAGGGTTTTGGGGTGG + Intergenic
988965037 5:36407524-36407546 TGGTTTGGAGGTATTGGGGAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989735355 5:44696913-44696935 TGTTTCAAATGGATTTGGAAAGG - Intergenic
990120697 5:52447351-52447373 AGTTTTAAAGGGGTGGAGGATGG + Intergenic
990479026 5:56189489-56189511 TGGTTTCCAGGGACTGGGGATGG - Intronic
991220976 5:64217003-64217025 TGGTTTTCAGGGATTAGGGACGG - Intronic
992152972 5:73924813-73924835 TGGTTGAAAGGGTTTGGGAAGGG - Intronic
993143674 5:84067257-84067279 TGTTGTAAAGGGATTTGGAATGG - Intronic
993969133 5:94395737-94395759 TTTTGTAAATGGATTGGGCATGG - Intronic
994315084 5:98324165-98324187 TTTTTTAAAGGTATTGGGACTGG - Intergenic
994626435 5:102226012-102226034 TGTTGTCAAGGGAGTGGGGAAGG - Intergenic
994888204 5:105593883-105593905 TATTTTAAAAGGATTTGGGAAGG + Intergenic
995128671 5:108606944-108606966 TTTTTTAAAGGGATTTGAGTGGG - Intergenic
995293916 5:110495345-110495367 TGATTTAATTGGACTGGGGAAGG + Intronic
995456511 5:112358303-112358325 TGTTTTTCAGGGATTGGTTATGG + Intronic
996206502 5:120744391-120744413 GGTTGGAAGGGGATTGGGGAAGG + Intergenic
997570605 5:134924395-134924417 TGTTTTAGTGGGGTTGGTGATGG + Intronic
997950684 5:138240377-138240399 GGTTTTAAAGGAATCAGGGAAGG + Intergenic
999024035 5:148205246-148205268 TGTGTCAGAGGGATTGGGAAAGG + Intronic
999036076 5:148351350-148351372 TGTTTTTAAGGCACTGGGAAGGG - Intergenic
999235567 5:150090444-150090466 TGGTGTAAGGGGTTTGGGGAGGG - Intronic
1001947787 5:175795143-175795165 TGTTATAGAGTGATTGGGGGAGG + Intergenic
1002005859 5:176234228-176234250 TGGTTTTCAGGGGTTGGGGAAGG - Intergenic
1002220517 5:177676398-177676420 GGTTTTTCAGGGGTTGGGGAAGG + Intergenic
1002969593 6:2000457-2000479 TGGGTTTTAGGGATTGGGGAGGG - Intronic
1002992533 6:2251015-2251037 TGTTTTCAAAGGATTAGGGATGG - Intergenic
1003684539 6:8288130-8288152 TGATTTCCAGGGGTTGGGGAAGG - Intergenic
1004087821 6:12468805-12468827 AATTTTAAAGGGAATGGGGCAGG - Intergenic
1004609319 6:17224317-17224339 TGTTTTCAAGGGTTTCGGAATGG + Intergenic
1005013093 6:21354612-21354634 TTTATTAAAGGAATTGGAGAAGG + Intergenic
1005705323 6:28445982-28446004 TGTGGTAAAGGGACTGGGGATGG - Intergenic
1005832631 6:29682830-29682852 TCTTTTCTAGGGAGTGGGGAGGG - Intergenic
1006082895 6:31577572-31577594 GGTAATAAAGGGATTGGGGCAGG - Exonic
1006867296 6:37219191-37219213 TGTTTAAAATAGATTGGGGGTGG + Intronic
1008099283 6:47373886-47373908 AGATTAAAAGGGATTGGGGCAGG + Intergenic
1008161934 6:48088741-48088763 TAGTTTAAAGGAATGGGGGATGG + Intergenic
1008738285 6:54574026-54574048 TATTTTAAAGGGATAGGGAAAGG - Intergenic
1010478977 6:76325676-76325698 TGTGTTTAAGGGGTTAGGGAGGG + Intergenic
1010626920 6:78148433-78148455 TGTTTTAAAGGCATTTGAGAGGG - Intergenic
1010787018 6:80015456-80015478 TGTTTTAATAGGACTGAGGAGGG + Intronic
1012067497 6:94566772-94566794 TATTTTAAAGGGATAAGGAAGGG + Intergenic
1012502818 6:99908480-99908502 TGTTTACCAGGGAGTGGGGAAGG + Intergenic
1013273004 6:108560145-108560167 TGTTTTTAAAGGACTCGGGAAGG + Intronic
1013481288 6:110555045-110555067 TGTATTAAAGTAAATGGGGAGGG - Intergenic
1013994907 6:116296931-116296953 TGTTTTGTGGGGATTGGGTAGGG + Intronic
1015000462 6:128208319-128208341 TGTTTTAAAGGGTTGGGAGAGGG - Intronic
1015806397 6:137113439-137113461 TGTATCAAAGGGGTGGGGGATGG - Intergenic
1019531814 7:1507027-1507049 GGGTTGAAAGGGATGGGGGATGG - Intergenic
1019981609 7:4625572-4625594 TTTTTTAAAGAGATGGGGGCTGG - Intergenic
1020108030 7:5431337-5431359 TGTTTTATAGAGATTGGTGGGGG + Intronic
1020719351 7:11721942-11721964 CGTATTAAAGGAATTGGGAAGGG - Intronic
1021677221 7:23093181-23093203 TGTTTGCCAGGGATTGGGGGTGG - Intergenic
1021699889 7:23307827-23307849 TTTATTAAAGGGAGAGGGGATGG - Intronic
1021922712 7:25502712-25502734 TGTTTTTAAGAGATAGGGTATGG + Intergenic
1022208914 7:28189306-28189328 TATTTTCAGGGGGTTGGGGATGG - Intergenic
1022815721 7:33912395-33912417 TGTTTGAAATGGGATGGGGAAGG - Intronic
1023158541 7:37275713-37275735 TGATTTAAAAGCATGGGGGAAGG - Intronic
1024448043 7:49504683-49504705 TGATTTTAAGGGATTAGGGAAGG - Intergenic
1024899677 7:54304570-54304592 TTGTTTCAAGGGATTTGGGAGGG + Intergenic
1026130070 7:67612871-67612893 TGGTTTTCAGGGACTGGGGATGG + Intergenic
1026395332 7:69947107-69947129 GGGTTTAAAGGGATTGAGGGAGG + Intronic
1026527250 7:71165185-71165207 GGTTTTTCAGGGATTGGGAAGGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027168110 7:75850304-75850326 AGTTTTCAAGGGATTGAGGTAGG + Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027663901 7:81020684-81020706 GGTGTTAAAGGGTTTGGTGATGG - Intergenic
1028723656 7:94062140-94062162 TGTTTTGAAGTGAGTGGGGATGG + Intergenic
1029647608 7:101868276-101868298 TGCCGTAAAGGGACTGGGGATGG - Intronic
1029665205 7:101990676-101990698 TGTTTTAAAGAGATGGGGTCTGG - Intronic
1029869954 7:103680294-103680316 TGCTTTAATGGGATGGGGGCTGG + Intronic
1030107742 7:106000708-106000730 TGTTCCAAAGGCATTGGTGAAGG + Intronic
1031429033 7:121643230-121643252 TGTTTTAATGGGTTTGGGGGGGG + Intergenic
1033358444 7:140620336-140620358 TGTTTAAAAGGGGTGGGGGGGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1035622819 8:1047150-1047172 TGTTTTCCAGGGTCTGGGGAAGG - Intergenic
1036836022 8:12068209-12068231 TGCTTTCCAGGGACTGGGGAGGG - Intronic
1036857865 8:12314779-12314801 TGCTTTCCAGGGACTGGGGAGGG - Intergenic
1037619116 8:20547646-20547668 TGTTTGCCAGGGACTGGGGAGGG + Intergenic
1037839075 8:22231493-22231515 TGTTTGAATGGGCATGGGGAAGG - Intronic
1037928010 8:22859844-22859866 TTTTTTAAAAAGATTGGGAAGGG - Intronic
1038029074 8:23621272-23621294 GGTTTTAGAGGGAGTGTGGATGG - Intergenic
1038327174 8:26579958-26579980 TTTTTTAAAGGGTGTGGGGGGGG - Intronic
1038384749 8:27132524-27132546 TGTTTGCAGGGGAATGGGGAGGG - Intergenic
1038904000 8:31876971-31876993 TGTTTTAATGGGTTGGGGAATGG + Intronic
1038972408 8:32650554-32650576 TGTTTGAAAGGGATTGGTCCAGG + Intronic
1039380627 8:37081568-37081590 ACTTTTAAAGGGAATGGGGGAGG - Intergenic
1039435570 8:37557184-37557206 AGTTTTAAAGGGATTGGGGGGGG - Intergenic
1039787503 8:40846890-40846912 TTTTTATAAGGGATTGGGAAGGG - Intronic
1039864561 8:41490096-41490118 TGTGTTTGAGGGTTTGGGGAGGG + Intergenic
1040640420 8:49327873-49327895 TGTTTACTAGGGGTTGGGGATGG - Intergenic
1041358964 8:57030216-57030238 TGTTGTGAAGGGAGTAGGGAGGG - Intergenic
1041497553 8:58503443-58503465 TTTTTTAAAGGGAAAGGGTATGG + Intergenic
1042561243 8:70073186-70073208 TGTTTTTAAGGAATGGGGGTAGG - Intergenic
1043536895 8:81215059-81215081 TGGTTTATAGGGGCTGGGGATGG + Intergenic
1044152204 8:88795289-88795311 TGGTTTTCAGGGATTAGGGATGG + Intergenic
1044430893 8:92104496-92104518 GGGTTTAAAAGGATGGGGGAAGG - Intergenic
1044874331 8:96649357-96649379 TGTTTCAGAAGAATTGGGGAAGG + Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045904038 8:107321453-107321475 CCTTTTAAAGGGAATGGGGTAGG - Intronic
1045910804 8:107407465-107407487 TGTTTTCAAAAGAATGGGGATGG + Intronic
1046038510 8:108873876-108873898 TGTTTTAAAGAGATAGAGGAGGG + Intergenic
1046825364 8:118685033-118685055 TGGTTTCAAGGGGTTAGGGATGG - Intergenic
1046999738 8:120562004-120562026 TGTTTGGATGGGTTTGGGGAGGG - Intronic
1047465792 8:125112721-125112743 GGTTACCAAGGGATTGGGGAAGG + Intronic
1047594488 8:126364672-126364694 TTTTTTGCAGGGACTGGGGAGGG - Intergenic
1047607782 8:126491777-126491799 TTTGTAGAAGGGATTGGGGAAGG + Intergenic
1048374541 8:133811431-133811453 TATTTTAAGGGAATGGGGGAAGG + Intergenic
1048496353 8:134939311-134939333 TGTTTTCAAGGAGGTGGGGAAGG + Intergenic
1048956982 8:139545321-139545343 TATTTTACAGGGACTAGGGAAGG - Intergenic
1049439528 8:142602807-142602829 TGCTTTTAAGGGATTCTGGAGGG + Intergenic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1050377547 9:4988157-4988179 GGTCTAAAAGGGAGTGGGGAAGG - Intronic
1050877940 9:10663925-10663947 TGTTTTGATGGGAGTGGGTATGG + Intergenic
1051326714 9:15979831-15979853 TTTTTTAAAGAGTTTGGGAAGGG + Intronic
1051341308 9:16113396-16113418 TGTTTTAAAGGGCTTAGGGAGGG - Intergenic
1051387263 9:16522547-16522569 TTTTTTACAGGGATGGGGGAGGG + Intronic
1051941883 9:22516496-22516518 TGTTTGATAGTGATTGGGTAGGG + Intergenic
1052256268 9:26460552-26460574 TGTTTTGAAGGGCATCGGGATGG - Intergenic
1052483440 9:29063205-29063227 TGTTTTCAGGGAATTAGGGAAGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053335363 9:37265427-37265449 TGGTTGAACTGGATTGGGGATGG - Intronic
1053362205 9:37496440-37496462 TGTTTTAATGGGAAAGGGGAGGG - Intronic
1055280963 9:74674257-74674279 TGTTTTAGAGGTATTGTGGAAGG - Intronic
1057013993 9:91634167-91634189 TGTGTGAGAGAGATTGGGGAAGG - Intronic
1060288688 9:122279566-122279588 TCTTTTATAGGGAATGGGGAAGG - Intronic
1060734122 9:126055551-126055573 TGCTTTAGAGGGAGGGGGGAGGG - Intergenic
1061282178 9:129603731-129603753 TTTTTTAAAGAGATGGGGGGGGG + Intergenic
1062084223 9:134640734-134640756 TTGTTCAAAGGGAATGGGGATGG + Intergenic
1062553722 9:137104138-137104160 TGTTTTTCAGGGACTGGGGAGGG - Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1187792700 X:22968404-22968426 TGTTTTCAAGGGGGTGGGAATGG - Intergenic
1189678020 X:43483318-43483340 TGTTCTCTAGGGATTTGGGATGG - Intergenic
1189718022 X:43884492-43884514 TTTTTAAAAGGGATGGGGGTGGG + Intergenic
1191077518 X:56470805-56470827 TGTTTGTCAGGGACTGGGGATGG - Intergenic
1192487799 X:71545284-71545306 TTTTTTTAAGGGGTTGGGGTGGG - Intronic
1192698383 X:73442848-73442870 AGTTCCAAAGGGATTGAGGAGGG + Intergenic
1193336815 X:80299351-80299373 ATATTTAATGGGATTGGGGATGG - Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1196207039 X:112952397-112952419 TGTTTCATAGGGATTGGTGAGGG - Intergenic
1196987693 X:121293004-121293026 TGTGTTTATGGGATTGGGGAGGG + Intergenic
1197326367 X:125099175-125099197 GGTTTTAAAAGGAATGGGGGAGG + Intergenic
1197331780 X:125161615-125161637 TGTTTGCCAGGGATTGGGGAAGG + Intergenic
1197881577 X:131172134-131172156 TGTTTTAAAAGGACTAGGGCAGG + Intergenic
1197930152 X:131686408-131686430 TCTTTTAAAGAGATTGCGGAGGG + Intergenic
1198250784 X:134877530-134877552 GGTCATAAAGGGATTTGGGATGG - Intergenic
1198614201 X:138436804-138436826 TGTTTTAATGGGATTTAGGGTGG + Intergenic
1202299528 Y:23397404-23397426 TGTTTTTAAGGAATTGTTGAAGG + Intergenic
1202571281 Y:26273194-26273216 TGTTTTTAAGGAATTGTTGAAGG - Intergenic