ID: 936666649

View in Genome Browser
Species Human (GRCh38)
Location 2:114604465-114604487
Sequence CTGTACACGCAGATGGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936666649_936666656 17 Left 936666649 2:114604465-114604487 CCCTGACCCATCTGCGTGTACAG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 936666656 2:114604505-114604527 ACAATCTACCAAACCATGGATGG 0: 1
1: 0
2: 0
3: 10
4: 107
936666649_936666655 13 Left 936666649 2:114604465-114604487 CCCTGACCCATCTGCGTGTACAG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 936666655 2:114604501-114604523 ATGAACAATCTACCAAACCATGG 0: 1
1: 0
2: 1
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936666649 Original CRISPR CTGTACACGCAGATGGGTCA GGG (reversed) Intronic
901208468 1:7510909-7510931 GTGGACAGGCAGATGGGGCAGGG - Intronic
905913054 1:41666974-41666996 CTGGCCAAGCAGATGGGTGAGGG - Intronic
908923927 1:69230380-69230402 CTGTGAACTCAGATGAGTCAAGG - Intergenic
911102334 1:94104584-94104606 CTGTCCATGCAGCTGGGGCAGGG + Intronic
913594436 1:120359775-120359797 GTGTACACACAGATGGCTGAAGG - Intergenic
914092826 1:144519209-144519231 GTGTACACACAGATGGCTGAAGG + Intergenic
914305702 1:146414664-146414686 GTGTACACACAGATGGCTGAAGG - Intergenic
914596353 1:149158142-149158164 GTGTACACACAGATGGCTGAAGG + Intergenic
915883115 1:159694140-159694162 CTGTACACGCGGAGGGACCAGGG + Intergenic
918338822 1:183549961-183549983 CTGTACACTCAGATTGATTAAGG + Intronic
919786302 1:201260412-201260434 GTGCACACGCAGATGGGTTCTGG + Intergenic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
1071791645 10:88960669-88960691 CTGTACATGCCAATGGGTCATGG - Intronic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1078338956 11:10485546-10485568 CTATGCACGCAGAAGGGACAGGG - Intronic
1080166589 11:29244367-29244389 TTGCAGATGCAGATGGGTCATGG - Intergenic
1090487347 11:127125766-127125788 GTGTACCTGCAGGTGGGTCATGG - Intergenic
1091038523 11:132255420-132255442 CTGTACCCTCAGAAAGGTCAAGG + Intronic
1092878912 12:12872696-12872718 CTGTGGACGCAGATTGGTCATGG + Intergenic
1093821039 12:23617915-23617937 CAGTACACGAAGATGGCTTATGG - Intronic
1095167041 12:38985282-38985304 CTGTCCATGCTGATGGGTGAGGG + Intergenic
1098753009 12:74320181-74320203 CTGTAATCGCAGATCGGTCCTGG + Intergenic
1101490830 12:105208048-105208070 CTGAACACCCAGGAGGGTCAGGG + Intronic
1102217482 12:111171535-111171557 CTGTGCACGCAGATGGCTAGTGG + Intronic
1104757909 12:131280404-131280426 CTGCAGACCCTGATGGGTCAGGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1116213673 14:41981682-41981704 CTGAAGACACAGATAGGTCATGG - Intergenic
1121458339 14:94053940-94053962 GTGTACACACAGACGGGTAATGG - Intronic
1128214073 15:65922412-65922434 CTGTGCACGCAGAGGGGGCATGG + Exonic
1128866781 15:71120360-71120382 CAGTACACTCAGCTGGGTGACGG - Intronic
1132359431 15:101200590-101200612 CTGCACCCCCAGATGGGTCAGGG + Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1146706503 17:35004250-35004272 CTGCAAATGCAGAGGGGTCAGGG - Intronic
1148001450 17:44389887-44389909 CTGTACAGCCAGATGGGGGAAGG - Intergenic
1151155747 17:72122211-72122233 CTGTCCACGGAGATGGGGCAAGG + Intronic
1154428877 18:14293286-14293308 CTGCACACAGAGGTGGGTCATGG - Intergenic
1155632389 18:27908444-27908466 CTGAACATGGAGATGGGCCAGGG - Intergenic
1157616973 18:48992734-48992756 GTCTACACGCAGCTGGGTGAGGG - Intergenic
1165048594 19:33126374-33126396 CTGGAGGCGCAGCTGGGTCAGGG + Intronic
1165806592 19:38584457-38584479 GGGTACAGGCAGAAGGGTCAGGG - Intronic
1166069137 19:40377331-40377353 AGGTACAGGCAGAGGGGTCAGGG + Intronic
1166117395 19:40664088-40664110 AGGCACAGGCAGATGGGTCAGGG + Intergenic
925123510 2:1437771-1437793 CTGAACACAGAGATGGGTCAGGG + Intronic
925603126 2:5629129-5629151 GTGTACACACAGATGGCTGAAGG - Intergenic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
936666649 2:114604465-114604487 CTGTACACGCAGATGGGTCAGGG - Intronic
937499300 2:122461141-122461163 CTGTGGAAGCAGATGCGTCAAGG + Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
941714320 2:168748141-168748163 CTGTACACTCAGATGGCCAATGG + Intronic
942605864 2:177690008-177690030 ATGTACAAGCAGATAGGACACGG - Intronic
949019623 2:241734128-241734150 CTGAACAGGCAGAAGGGACAGGG + Intergenic
1175242595 20:57560785-57560807 CTTAACAGGCAGGTGGGTCAAGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1179416670 21:41203812-41203834 CTGAAGACGGGGATGGGTCAGGG + Intronic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1184461175 22:44639067-44639089 CTGTCCACGCTGATGTCTCATGG - Intergenic
1184518276 22:44976661-44976683 TAGTACAGGCAGATGGGTCTGGG - Intronic
1184918942 22:47592114-47592136 CTGAAAACTCAGATGGGTCGAGG - Intergenic
969517464 4:7655585-7655607 GTGTACACGCCGTTGGCTCATGG + Intronic
977238715 4:94541010-94541032 GTATACACGCAGATGGTACATGG - Intronic
985621153 5:956800-956822 CTGAACACGCACATGGATCTCGG + Intergenic
985787872 5:1909201-1909223 CTGTCCAGGCACATGGGTCTTGG + Intergenic
986059375 5:4173635-4173657 CTGTGCAGGCAGAAGGGACAGGG + Intergenic
992090774 5:73314241-73314263 ATGAACAGGCACATGGGTCAGGG - Intergenic
992727223 5:79620200-79620222 CTGTACGATCAGATGAGTCATGG + Intronic
996228856 5:121035680-121035702 CTGTAAACTAAGATAGGTCAAGG + Intergenic
997140644 5:131376654-131376676 CTCTACTCTCAGATGGGTCCTGG + Intronic
998795324 5:145812077-145812099 CTGAACACGCTGATTGGTCTGGG + Intronic
999977287 5:156924266-156924288 CTAAACATGCAGATGAGTCAAGG + Intronic
1007329377 6:41092900-41092922 CTGTTCACACAGATGGTTCCTGG + Exonic
1010180840 6:73085163-73085185 CAGATCAAGCAGATGGGTCAGGG + Intronic
1021644456 7:22774936-22774958 CTGTACACCTAGCTGGGACATGG - Intergenic
1026321686 7:69273980-69274002 CAGTGCACCCATATGGGTCATGG - Intergenic
1030841490 7:114359333-114359355 CTGCACAGGCAGAGGGCTCATGG + Intronic
1043407530 8:79953225-79953247 CTGTACACGCCCTTGTGTCATGG - Intronic
1048230165 8:132631321-132631343 CTGCACATTCTGATGGGTCAGGG + Intronic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1062278043 9:135739820-135739842 CTGTGCACGCTCCTGGGTCAAGG - Intronic
1198128382 X:133669941-133669963 CTGTTCAGGCAGATTGGTTAGGG + Intronic
1199579316 X:149345523-149345545 CCGTACACACAGAAGGGGCATGG - Intergenic