ID: 936669501

View in Genome Browser
Species Human (GRCh38)
Location 2:114640528-114640550
Sequence ACTTGACCTGAGGCATGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936669501_936669504 1 Left 936669501 2:114640528-114640550 CCTCGTCATGCCTCAGGTCAAGT 0: 1
1: 0
2: 0
3: 3
4: 58
Right 936669504 2:114640552-114640574 AGCCTCCCCTAAGGCTCTAGCGG 0: 1
1: 0
2: 1
3: 12
4: 94
936669501_936669503 -8 Left 936669501 2:114640528-114640550 CCTCGTCATGCCTCAGGTCAAGT 0: 1
1: 0
2: 0
3: 3
4: 58
Right 936669503 2:114640543-114640565 GGTCAAGTCAGCCTCCCCTAAGG 0: 1
1: 0
2: 0
3: 14
4: 106
936669501_936669509 18 Left 936669501 2:114640528-114640550 CCTCGTCATGCCTCAGGTCAAGT 0: 1
1: 0
2: 0
3: 3
4: 58
Right 936669509 2:114640569-114640591 TAGCGGCCATCAGATTGTAGTGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936669501 Original CRISPR ACTTGACCTGAGGCATGACG AGG (reversed) Intronic
900475033 1:2872121-2872143 GCTTCACCTGAGGCCTCACGGGG - Intergenic
904905973 1:33897551-33897573 TCTTGACCTCAGTCATGATGTGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
909622161 1:77681589-77681611 AGTTGACCTGAGGCCGGGCGCGG + Intronic
911268708 1:95774994-95775016 TCTTGACTTGAGGAATGACATGG + Intergenic
911964487 1:104349362-104349384 ACTCAACCTGAGACATGATGAGG + Intergenic
911964493 1:104349411-104349433 ACTCAACCTGAGACATGATGAGG + Intergenic
915406366 1:155662919-155662941 ACTTGAACTGAGGAATTAAGAGG + Intronic
918415060 1:184297911-184297933 ACTTCATCTGGGGCATGAGGTGG - Intergenic
922787193 1:228288764-228288786 ACATAGCCTGAGGCAGGACGGGG + Exonic
924138542 1:240998038-240998060 ATTTTTCCTGAGGCATAACGGGG - Intronic
924910876 1:248511915-248511937 ATTTGCACTGAGGCATGGCGAGG - Intergenic
924913225 1:248536125-248536147 ATTTGCACTGAGGCATGGCGAGG + Intergenic
1070325157 10:75384103-75384125 ACCTGAGCTGAGGCCTGACTTGG - Intergenic
1072085369 10:92073882-92073904 ACTTAACTTTAGGCATGACCTGG - Intronic
1079771294 11:24462844-24462866 TCTTGACCTGATGCATTAGGAGG + Intergenic
1085132355 11:74051656-74051678 ACCTGAACTGAGGAATGAAGGGG - Intronic
1085418144 11:76333482-76333504 GCTGGACCTGAGGAATGAGGAGG - Intergenic
1085825314 11:79840762-79840784 AATTGACCTGGGGTATGACCTGG - Intergenic
1096973013 12:55682397-55682419 ACATGACCAGTGCCATGACGGGG + Intronic
1103010258 12:117452817-117452839 ACTTGACCTGAAGCCTAAAGAGG + Intergenic
1108272742 13:48778150-48778172 ACCAGTCCTGAGGCATGATGTGG - Intergenic
1113971727 13:114196380-114196402 TCTGGACCTGTGGCATGAGGAGG - Intergenic
1126475467 15:49061445-49061467 ACTTGGCTTGATGCATGATGTGG + Intergenic
1135636289 16:24078395-24078417 ACTTAACTTGAGGCAGGAGGTGG + Intronic
1148187890 17:45657736-45657758 GCTTGACCTGAGGGAAAACGAGG - Intergenic
1148444826 17:47731169-47731191 ACTTGACCTGAGGATTAATGTGG + Intergenic
1152630904 17:81410320-81410342 CCTGGGCCTGAGGCATGAGGTGG - Intronic
1159894299 18:73982093-73982115 ACTTGACCTGAGGCCTCTCAGGG - Intergenic
1164386161 19:27772337-27772359 ACTTGACCTTAGATATGATGAGG - Intergenic
1166828526 19:45624575-45624597 ACTTGAGCTGAACCTTGACGAGG + Intronic
928433140 2:31236576-31236598 ACTTCCCCTGAGGCATGAATGGG - Intronic
936669501 2:114640528-114640550 ACTTGACCTGAGGCATGACGAGG - Intronic
937210101 2:120263019-120263041 CCTTGTCCTGAGGAATGAAGGGG - Intronic
942242190 2:173972815-173972837 ACTTGAACTGAAGCATGGGGAGG - Intergenic
1172092775 20:32445833-32445855 TCTGGACCTGAGGCAGGATGGGG + Exonic
1173036769 20:39419133-39419155 CCTTGACCCTAGGCATGACCCGG - Intergenic
1177176843 21:17708661-17708683 TCTTGTCCTGAGGCATGTCATGG + Intergenic
1178928750 21:36798147-36798169 GCTTGACCTGAGGCCCAACGAGG + Intronic
954662664 3:52234417-52234439 ACTTGAGCTGAGGCCTGAAGTGG - Intronic
957042467 3:75346604-75346626 CCGTGACCTGAGGAATAACGTGG - Intergenic
967325672 3:188236423-188236445 ACCTGACCTGAAGCATGCTGGGG + Intronic
967775196 3:193378984-193379006 TCAAGACCTGAGGAATGACGGGG + Intergenic
977957846 4:103051063-103051085 ACATGAGCTGAGGCAGGAAGGGG + Intronic
986310946 5:6550795-6550817 TCTTGCCCTGGGGCATGACATGG - Intergenic
987428194 5:17797283-17797305 ACTTGACTTTAGGCATGAAATGG + Intergenic
988288104 5:29247794-29247816 AATTGCCCTCAGGCATGAAGGGG + Intergenic
999213760 5:149914206-149914228 ACTTGACCAGAGCCTTGATGAGG - Intronic
1003628143 6:7762445-7762467 ACTTTTGCTAAGGCATGACGTGG + Intronic
1006558908 6:34891915-34891937 ACTTGACCTGAGGCCGGGCAAGG - Intronic
1006634834 6:35454554-35454576 ACGTGACCTGAGGCGTGGTGTGG - Intronic
1017304136 6:152897254-152897276 ACTCGACCTGAGAAATGACATGG - Intergenic
1018089403 6:160332677-160332699 ACTTGCCCTGAGGAATGCGGAGG - Intergenic
1023202389 7:37712537-37712559 TCTTGACCTGAGGTATTACCTGG - Intronic
1026928602 7:74210482-74210504 ACCTGACCTGGGGCAAGACCTGG - Intronic
1028964487 7:96786861-96786883 ACTTGACCTGGGGCTTGCCAAGG + Intergenic
1034354631 7:150442947-150442969 ACTTGCCCTGTGCCATGACGTGG + Intergenic
1034953595 7:155317770-155317792 ACTTGACCTGAGGCTTGCAGAGG - Intergenic
1049787806 8:144459440-144459462 ACCTGACGTGAGGCAGGACTCGG + Intronic
1052237088 9:26224122-26224144 ATGTGACCTGAGGCATCACCTGG - Intergenic
1061721265 9:132552881-132552903 GTTTGACATGAGGCATGATGGGG + Intronic
1196648899 X:118148540-118148562 GCTTGACCTGAGGTAAGATGGGG - Intergenic