ID: 936673341

View in Genome Browser
Species Human (GRCh38)
Location 2:114684890-114684912
Sequence GGATCTCCATGGTCTCCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936673341_936673344 -7 Left 936673341 2:114684890-114684912 CCTAGGGGAGACCATGGAGATCC 0: 1
1: 0
2: 2
3: 13
4: 148
Right 936673344 2:114684906-114684928 GAGATCCACTGAAGTGGCTGCGG 0: 1
1: 0
2: 1
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936673341 Original CRISPR GGATCTCCATGGTCTCCCCT AGG (reversed) Intronic
900316676 1:2060578-2060600 GGATTTCCATGATCTGCCCGGGG + Intronic
900435283 1:2628212-2628234 GGCCCTCTAGGGTCTCCCCTGGG - Intronic
902392447 1:16114559-16114581 GGTTCTCCATGGGCCCCTCTCGG + Intergenic
902973233 1:20070389-20070411 GGGTCTCCAGGGTCTGCCCAAGG + Exonic
903178353 1:21593461-21593483 GGACCTCCATGGCCAACCCTGGG - Intergenic
903348058 1:22700336-22700358 TTATCTCCTTGGACTCCCCTTGG + Intergenic
905150325 1:35921997-35922019 GGCTCTGCATGTTCTCCACTTGG + Exonic
905204110 1:36333126-36333148 GAATTTCCTTGGTCTCCTCTTGG - Intergenic
907242564 1:53088859-53088881 GGATCTCACTGCTCTCACCTCGG + Exonic
908408952 1:63843523-63843545 GGATCTTCTTGGTCTCCTCCAGG + Intronic
910403123 1:86856677-86856699 GGAGCTCCATGGTCTTTCATTGG + Intergenic
911065762 1:93786449-93786471 TGCTCTCCATGGTCTCAGCTGGG - Intronic
912516699 1:110220751-110220773 GGCTCTCCATGGCCATCCCTAGG - Intronic
912692952 1:111818441-111818463 GTTTCTCCCTGGCCTCCCCTTGG - Intronic
913287757 1:117242220-117242242 GGTTTTCCATTCTCTCCCCTCGG + Intergenic
913290255 1:117265216-117265238 AGATGTAAATGGTCTCCCCTAGG - Intergenic
915982136 1:160426907-160426929 AGATCCCCAGTGTCTCCCCTGGG + Exonic
917074366 1:171188625-171188647 GGAGCCCCATGCTCTTCCCTGGG + Intronic
917974808 1:180231638-180231660 GGAACTCCTTGGTCTCTCCAGGG - Intronic
920531807 1:206707533-206707555 GAATCCACATGGTCTGCCCTGGG + Intronic
921113853 1:212067558-212067580 GGATTTCCATTGTGTCCTCTGGG + Intronic
921611606 1:217218539-217218561 GGACATTCAGGGTCTCCCCTGGG + Intergenic
1065468568 10:26052528-26052550 GGCTCTCCCTGGTGTGCCCTAGG - Intronic
1067222127 10:44351956-44351978 GGAACCCCATGCTCTCACCTGGG - Intergenic
1069695758 10:70384103-70384125 AGATCTCCATAGTTTTCCCTGGG - Intergenic
1069942192 10:71963874-71963896 GGATCTTCCTGCTCCCCCCTGGG - Intergenic
1076329152 10:129652297-129652319 GGAACTCCAGCGTCTCCGCTCGG - Intronic
1076381523 10:130027316-130027338 GGCTGGCCGTGGTCTCCCCTCGG - Intergenic
1077041200 11:524248-524270 GGATCTCCATCGTCTTCCCTCGG - Intergenic
1077058499 11:607553-607575 GGATCTCAATGCTCTGCCCGTGG - Exonic
1079210886 11:18459774-18459796 GTATCTCCTTGGGCTCCTCTAGG + Intronic
1081398503 11:42615209-42615231 GGGTCTCTATGGACTCCCATAGG + Intergenic
1083953099 11:65967555-65967577 TGATGTCCATGTTCTCCACTCGG - Exonic
1086949436 11:92876517-92876539 GGAGCTCCTTGGTCTTTCCTTGG + Intronic
1087321134 11:96660288-96660310 TGATCTTCATGGTCTCCTCTAGG + Intergenic
1088158042 11:106833038-106833060 AGATCTCCATTCTCTCTCCTAGG + Intronic
1090486085 11:127113262-127113284 GGATCTCCTGGGTCTGACCTGGG + Intergenic
1091802768 12:3334799-3334821 TGATCTCCATGCTCTCCCTAAGG + Intergenic
1095957325 12:47814152-47814174 GGCTCTCCAGAGTCTCTCCTGGG - Intronic
1102277884 12:111597877-111597899 GGATCTCCAGGGTCCAGCCTGGG + Intronic
1102493402 12:113302911-113302933 GGATGTCCATGGTGTACCGTTGG - Intronic
1102768225 12:115451529-115451551 GCATCTCTATCTTCTCCCCTGGG - Intergenic
1106335284 13:28778035-28778057 AGAGGTGCATGGTCTCCCCTGGG + Intergenic
1109226459 13:59701839-59701861 AGATCTGCAAGGTCTTCCCTGGG + Intronic
1109381424 13:61566418-61566440 CCATCTCAATGGTCTCCCATTGG - Intergenic
1111896524 13:94149260-94149282 GTATCTCCATTGTGTCCTCTTGG - Intronic
1113891990 13:113740968-113740990 TGAGCTCCACGGTCTCTCCTGGG - Intergenic
1115709375 14:36033517-36033539 GGTGCTCCATGTTCTGCCCTGGG + Intergenic
1116209397 14:41914095-41914117 GGATCTCTATTGTATCCCATTGG + Intergenic
1122853726 14:104549886-104549908 GGCTGTCATTGGTCTCCCCTAGG - Intronic
1125930485 15:43596156-43596178 GAATCTTCATGGTGGCCCCTGGG - Intronic
1125943653 15:43695988-43696010 GAATCTTCATGGTGGCCCCTGGG - Intronic
1126420567 15:48468045-48468067 GTATCTCCATTGTCTCCTCGAGG + Exonic
1128384368 15:67136818-67136840 GGATCTCCATCCTCTGCCCTTGG - Intronic
1130448151 15:84023756-84023778 TGATCTCTATGGTCTCTTCTAGG - Intronic
1133200323 16:4200311-4200333 GGCTCTCCTTGGTGTCGCCTGGG - Intronic
1137053854 16:35734352-35734374 GGTGCCCCATGGTCTCCGCTTGG + Intergenic
1139479360 16:67220610-67220632 GGCTCTGCATGTTCTCCCCGGGG + Intronic
1140100999 16:71916565-71916587 GGATCTCCATGGCCTCCACGAGG - Exonic
1140299167 16:73739546-73739568 GGAGCTCCATGGGCACACCTTGG + Intergenic
1141360770 16:83393195-83393217 GCATTTCCATGGGCACCCCTTGG - Intronic
1141555380 16:84833767-84833789 GGGTCTCCGTCGTCTCCCATGGG + Intronic
1142803848 17:2361510-2361532 GTATCTCCCTGGCCTGCCCTTGG + Intronic
1144055002 17:11532825-11532847 TGATCTCCAGGGTCTCCCTGAGG + Intronic
1144198163 17:12915756-12915778 TGATCTCCATGGCTTCCCCTGGG - Intronic
1144514975 17:15911085-15911107 GGATCTCCCTGGTGGCCCCAGGG + Intergenic
1144669863 17:17126824-17126846 CGATCTCCTTGGTCTCCGCCCGG - Exonic
1147251506 17:39155169-39155191 GGATCTCCATCTTGTCTCCTGGG + Intergenic
1152374285 17:79911015-79911037 GGCTCTCCCTGGTCTGCCCGTGG + Intergenic
1152580978 17:81165554-81165576 GGCTTTCCATGGCCTCTCCTGGG - Intronic
1152636928 17:81434062-81434084 GGGTCTCCCGGGACTCCCCTGGG + Intronic
1156978407 18:43254428-43254450 AAACCTCCATGGTCTCCTCTAGG - Intergenic
1157096831 18:44693287-44693309 GGCTCACCATGGTCACCCCCAGG - Intronic
1157691292 18:49684096-49684118 GGATCTGGATTGTCTGCCCTTGG + Intergenic
1160957008 19:1698495-1698517 GGAACCCCATGGTGCCCCCTGGG + Intergenic
1161076934 19:2290375-2290397 GGATCTCCAGCGTCCCCCCGGGG + Exonic
1162568541 19:11457540-11457562 GGGCTTCCATTGTCTCCCCTTGG + Intronic
1162586283 19:11560703-11560725 GGATCTCTAGGATATCCCCTAGG + Intronic
1164386900 19:27779369-27779391 CAATCTCCCTGGTCTCACCTGGG + Intergenic
1164387012 19:27780606-27780628 CGATCTCCCTGGTCTTGCCTGGG + Intergenic
1164792725 19:31001981-31002003 GGCTGTCCTTGGCCTCCCCTTGG + Intergenic
1166281649 19:41798211-41798233 AGAACCCCATGGTCTCCCCATGG + Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
926294774 2:11561103-11561125 GGATTTCCATGGCCACCCCTAGG + Intronic
927145365 2:20162085-20162107 GGAGCTGCAGGGTCTCCCTTTGG + Intergenic
930029466 2:47049416-47049438 GGATCTCCAGGGGCTACCCCTGG + Intronic
931257326 2:60584923-60584945 GGCTCCCCTTGGGCTCCCCTTGG + Intergenic
932718353 2:74120118-74120140 GGACCTCCAGGTTCTTCCCTGGG + Intergenic
934129343 2:88932465-88932487 GGATTTGCATGTTGTCCCCTAGG - Intergenic
934224659 2:90121678-90121700 GGATTTGCATGCTGTCCCCTAGG + Intergenic
936673341 2:114684890-114684912 GGATCTCCATGGTCTCCCCTAGG - Intronic
937121973 2:119446794-119446816 GGATCTCCATAGCGTCCTCTGGG + Exonic
938401463 2:130995803-130995825 AGATCTCCACTGTCACCCCTTGG + Intronic
941898365 2:170653520-170653542 GGAACTCCTGGGTCTCCACTGGG - Exonic
947167881 2:227280955-227280977 GGAAGTCCTTGGGCTCCCCTGGG - Exonic
947366240 2:229397511-229397533 GGAAGTCCATGCTCTCCACTCGG - Intronic
948095681 2:235332379-235332401 GACTTTACATGGTCTCCCCTGGG - Intergenic
1171400170 20:24868144-24868166 TGAGCTCCAAGGTGTCCCCTGGG + Intergenic
1171989757 20:31686839-31686861 TGGTCTCCATGGGCTTCCCTTGG - Intronic
1172774303 20:37398179-37398201 GGGTCTCCACAGTCTCCCATAGG - Intronic
1172875809 20:38163839-38163861 GTATCTCCAGGGTCTTCCATGGG - Intronic
1173610433 20:44363499-44363521 GGATGCCCAGGGTCTCCTCTTGG + Intronic
1175333273 20:58179026-58179048 GGCTCTCCAGGGACTCCCCCTGG + Intergenic
1176106440 20:63391782-63391804 GGGTCTCCATTTCCTCCCCTTGG - Intergenic
1178976850 21:37227697-37227719 CCATCTACATGGTCTTCCCTAGG - Exonic
1179774083 21:43648456-43648478 GGAGCGCCATTGCCTCCCCTGGG - Intronic
1180049292 21:45324054-45324076 GGATCTGCACCGTCTCCCCTGGG + Intergenic
1181329627 22:22079844-22079866 AGCTCTCCATGGGCTCCCCAGGG - Intergenic
1181577075 22:23802012-23802034 GTCTCTCCAGGTTCTCCCCTGGG + Intronic
1183594063 22:38799248-38799270 GGGTCTCCATGGTCTCATCAAGG + Intergenic
1183656962 22:39191777-39191799 GGATGTCTATGCTCTCCACTCGG - Intergenic
1184427180 22:44417795-44417817 GTATCTCCTTGGGCTCCTCTTGG + Intergenic
951400811 3:22229790-22229812 GGGTCTCTGAGGTCTCCCCTTGG + Intronic
952580765 3:34831236-34831258 GAACATCCATGGTCTCCACTTGG - Intergenic
953627165 3:44580615-44580637 CGATCTCCTTGGTCTCCGCCCGG + Intronic
954132931 3:48569385-48569407 GGGTCCCCATTGTCTCCCCGAGG + Exonic
954135796 3:48581574-48581596 CGGTCTCCAGGGTCTCCCTTGGG + Exonic
955240748 3:57175992-57176014 GTATCTCCTTAGGCTCCCCTTGG + Intergenic
955617764 3:60826812-60826834 AGATGTCCATGGTGTACCCTTGG - Intronic
959822503 3:110753134-110753156 GGCTTTCCATGGTAGCCCCTGGG - Intergenic
960592515 3:119379334-119379356 GGACCTCAGTGGTCTCCTCTAGG + Intronic
968932715 4:3590502-3590524 GGCTCTCCATGATGTCCCCAAGG + Intronic
969676704 4:8618397-8618419 CCATCTCCCTGGCCTCCCCTTGG + Intronic
974385425 4:61198858-61198880 GGACATCCATGAACTCCCCTGGG - Intergenic
983301598 4:165933337-165933359 GGTTCTCTCTGGCCTCCCCTGGG + Intronic
983779068 4:171645087-171645109 GGGTATCCAAGGGCTCCCCTTGG + Intergenic
985761144 5:1749530-1749552 GGCTCTGCGTGGTCTCCCCGTGG - Intergenic
987244417 5:16034069-16034091 GGATCTCCTTGGACTACCTTAGG + Intergenic
992209577 5:74464719-74464741 ATATCTCAATGGTCTCCACTGGG + Intergenic
995477781 5:112564904-112564926 CTATTTCCATGGTGTCCCCTGGG - Intergenic
995902284 5:117084034-117084056 TGATCTCTATAGTCTCCCTTAGG - Intergenic
995986722 5:118185205-118185227 TTATCTCCATGGTGTACCCTAGG + Intergenic
996888701 5:128390294-128390316 GGATCTCAATGGTCTCCCAGAGG - Intronic
997476289 5:134144457-134144479 GGATCTCCATGGTCTTCCTTGGG + Intronic
999514414 5:152286367-152286389 GTATGTCCATGCCCTCCCCTTGG - Intergenic
1001455509 5:171857071-171857093 GCCTCTCCATAGTCTCTCCTGGG - Intergenic
1010730799 6:79389092-79389114 GGAGCTCCAGGGTCTCCTCTTGG + Intergenic
1023754638 7:43405288-43405310 GGATCTCCAAGATCACCCCTAGG + Intronic
1030434704 7:109502067-109502089 GGAAGTCCATGTTCTCCCCTTGG + Intergenic
1032801983 7:135324295-135324317 GGATGCCCATGGGCTCCCTTAGG - Intergenic
1035383008 7:158452415-158452437 GCAGGTCCATGGTCTCCACTGGG - Intronic
1035664270 8:1369295-1369317 GGATTCCCAAGGCCTCCCCTTGG + Intergenic
1035813410 8:2512840-2512862 GAGTCTCCAGGGTCTCCCCCAGG - Intergenic
1037899279 8:22678122-22678144 GCAGCTCCATGTCCTCCCCTAGG + Intergenic
1037965141 8:23128186-23128208 GGCTCTCCAGGTTCCCCCCTTGG + Intergenic
1037973498 8:23192098-23192120 GGCTCTCCAGGTTCTCTCCTTGG - Intronic
1040314133 8:46252014-46252036 GGAGCCCCCTGGGCTCCCCTGGG + Intergenic
1040598311 8:48861111-48861133 GGATACCCAGGGTCTACCCTGGG - Intergenic
1041012267 8:53557002-53557024 TGTTCTCCATGGTTCCCCCTTGG - Intergenic
1048855734 8:138685251-138685273 GGAGCACCAGGATCTCCCCTGGG + Exonic
1051834887 9:21324646-21324668 GGATCTCCTTGATCTCCTATAGG + Intergenic
1052199100 9:25756487-25756509 GTTTCTCCATGGCCTTCCCTTGG + Intergenic
1054457410 9:65441393-65441415 GGCTCTCCATGATGTCCCCAAGG - Intergenic
1057258328 9:93568593-93568615 CGCTCTCCATGGATTCCCCTTGG - Intergenic
1058152539 9:101478505-101478527 TCATATCCATGGTCTCCCCTTGG + Intronic
1058193919 9:101951511-101951533 GGGTCTCTGAGGTCTCCCCTTGG + Intergenic
1059867324 9:118530141-118530163 GGATTTCCATTTTCTTCCCTTGG - Intergenic
1060302934 9:122386441-122386463 CAATCTTGATGGTCTCCCCTGGG - Exonic
1061847427 9:133395486-133395508 GGCTCTCCCTGGTCTCCTCCTGG + Intronic
1187256870 X:17651285-17651307 GGATTTCCATGCTCTTTCCTTGG - Intronic
1193234552 X:79090982-79091004 GGATCTCCATTGTCTCCCTAAGG - Intergenic
1194732147 X:97467756-97467778 GTATCCCCATGGTCTCTGCTAGG - Intronic
1195751513 X:108164915-108164937 GGAATTCCTTGGTCTCCCTTAGG + Exonic
1199417336 X:147600220-147600242 GCATCTCCATGCTCTTCCATAGG + Intergenic