ID: 936676235

View in Genome Browser
Species Human (GRCh38)
Location 2:114718733-114718755
Sequence ACATGTATGCTAAATTTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936676234_936676235 5 Left 936676234 2:114718705-114718727 CCTCAGGTTGTAATCAGTAGATG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 936676235 2:114718733-114718755 ACATGTATGCTAAATTTGTAAGG 0: 1
1: 0
2: 0
3: 18
4: 214
936676233_936676235 9 Left 936676233 2:114718701-114718723 CCAGCCTCAGGTTGTAATCAGTA 0: 1
1: 0
2: 0
3: 5
4: 128
Right 936676235 2:114718733-114718755 ACATGTATGCTAAATTTGTAAGG 0: 1
1: 0
2: 0
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936676235 Original CRISPR ACATGTATGCTAAATTTGTA AGG Intronic
906620899 1:47277810-47277832 ACATGTATGGCAAAGTTGTATGG - Intronic
906878222 1:49561322-49561344 ACATGTACCCTAAAGTTTTAGGG + Intronic
908130556 1:61071034-61071056 ACATGTATGGTATATTTGGGAGG + Intronic
908429980 1:64046911-64046933 ACCTGTATGCTAACTTTGCAAGG - Intronic
911762513 1:101632504-101632526 GCATTTATGCTCAATTTATAAGG + Intergenic
912113091 1:106367911-106367933 AAATGTATGCAAGATTAGTATGG + Intergenic
914408297 1:147399908-147399930 ACATATATGCTAAAATTTTATGG - Intergenic
914738706 1:150444608-150444630 ACATGTATGGTTAATTGGTATGG + Intronic
916162181 1:161928548-161928570 AGATGGCTGCTAAATTTGGATGG - Intronic
919051892 1:192521896-192521918 ACATTTATGCCAAAATTGGAAGG + Intergenic
919458537 1:197848262-197848284 ACATCTATTGTAAATCTGTATGG - Intergenic
921426299 1:215004825-215004847 ACATGTGGGCTAAATTTGGTGGG + Intergenic
922895638 1:229097846-229097868 ACACGTATGCAAAAGTTGTTCGG - Intergenic
922997035 1:229972432-229972454 ACATGTGTGGTATATGTGTATGG - Intergenic
923433405 1:233946289-233946311 ACATGTATCCTGAATTTGTGGGG - Intronic
924296844 1:242596193-242596215 ATATGTATTCCAAAATTGTATGG + Intergenic
1065205454 10:23353436-23353458 ACATCTAGGCTAAAAATGTAAGG + Intergenic
1065298341 10:24298074-24298096 AAATATATGCTAAATTTTTCAGG + Intronic
1067284921 10:44900580-44900602 ACATGCATGTTAACTTTTTATGG + Intergenic
1068304538 10:55189230-55189252 AAATGAATGCTAAATTTGGAAGG - Intronic
1069147343 10:64910802-64910824 ACTTATATTCTAATTTTGTAAGG - Intergenic
1069261763 10:66407160-66407182 GCATGTATTCTAACCTTGTAGGG + Intronic
1073504911 10:103976853-103976875 ATATGTATTCTTAATATGTATGG + Intronic
1075465221 10:122646001-122646023 ACCTGTCTGCTTAATTTGAAAGG - Intergenic
1078048157 11:7937000-7937022 ACATTAATTCTAAATGTGTATGG - Intergenic
1079869469 11:25779737-25779759 GCATGTATTCTAATTTTATATGG + Intergenic
1080095471 11:28400753-28400775 AAATGTTTGCTAAATTTAGATGG + Intergenic
1086787617 11:90990049-90990071 ACAAGAATACTAAATTAGTAGGG + Intergenic
1090563718 11:127963240-127963262 TCATGTATGCAACATTTGTGTGG - Intergenic
1092518141 12:9237559-9237581 ACATTTGTGCTAAATTTCTATGG + Intergenic
1096479360 12:51927962-51927984 AAATTTATTCTAAATTTATATGG + Intergenic
1098742885 12:74197357-74197379 AAATTTATGCTAAATGTATAAGG - Intergenic
1099460792 12:82918488-82918510 AGACATATGTTAAATTTGTAAGG + Intronic
1102638522 12:114345850-114345872 ACATGTGTGATAAAATTGCATGG + Intergenic
1103230817 12:119328866-119328888 ACATGTATTTTTAATTTTTAAGG + Intergenic
1106281891 13:28281554-28281576 ACATGTGTGTAAAATTCGTAAGG - Intronic
1106306712 13:28517867-28517889 ACATACATGCTAAACATGTATGG + Intergenic
1107288348 13:38822646-38822668 ACATGCATGCTAGGTTTGTTGGG - Intronic
1107814818 13:44234954-44234976 ATCTTTATCCTAAATTTGTAAGG + Intergenic
1109981122 13:69909046-69909068 ACATGTATACTAAATATATGAGG - Intronic
1110500433 13:76221283-76221305 GCATGTATGGCAAATTTTTAAGG + Intergenic
1110659212 13:78038902-78038924 ACATGTATACTATATCTGTTGGG - Intergenic
1111108202 13:83673546-83673568 ACATGTATGTTATACTTATATGG - Intergenic
1112679473 13:101746043-101746065 ATATGTATGGTTAATATGTATGG + Intronic
1114769171 14:25409249-25409271 ACATGTATCTTAAATTTTTCGGG - Intergenic
1114927219 14:27419114-27419136 ACATGTTTACTAAATATGTCAGG - Intergenic
1115442065 14:33447213-33447235 ACTTGTAAGCTAAGTTTTTATGG + Intronic
1115959664 14:38821305-38821327 ACATGGATGATAAGTTAGTATGG + Intergenic
1119143504 14:72289285-72289307 GAATGAATGCTAACTTTGTAGGG - Intronic
1120384421 14:83826392-83826414 CCATGTAGGCAAAATTTGAAGGG - Intergenic
1122261352 14:100524917-100524939 ATATGTCTGCAAAATTTGAAAGG + Intronic
1125712249 15:41796407-41796429 ACATCTATGCTTATTTTGCAAGG - Intronic
1126307359 15:47275252-47275274 ATATGTATTCTATATTTGTGTGG - Intronic
1127351795 15:58160596-58160618 ACATGTTAAATAAATTTGTATGG + Intronic
1127423698 15:58834443-58834465 AATTGTATGCTAAAACTGTATGG + Intronic
1127743151 15:61934517-61934539 ACATATATGCTAAATATATATGG - Intronic
1131625644 15:94117249-94117271 ACGTGTGTGTTATATTTGTATGG - Intergenic
1135637144 16:24087770-24087792 ACATGCATGCTATCTTTTTATGG + Intronic
1136695256 16:32074538-32074560 TTATATATTCTAAATTTGTATGG + Intergenic
1136795755 16:33017795-33017817 TTATATATTCTAAATTTGTATGG + Intergenic
1136874163 16:33836585-33836607 TTATATATTCTAAATTTGTATGG - Intergenic
1137574723 16:49591471-49591493 CCAAGTATGCTAAAATAGTATGG + Intronic
1138281777 16:55777690-55777712 CCATCCATGCTAAATATGTAGGG + Intergenic
1138287093 16:55818725-55818747 CCATCCATGCTAAATATGTAGGG - Intronic
1139124929 16:64066473-64066495 ACATGCATGCAAAGTTTTTAGGG - Intergenic
1140596628 16:76423375-76423397 ACCTGTGTACTAAATTTGTGGGG - Intronic
1140856531 16:78982694-78982716 ACATGTATGCTTATTTAGTGAGG + Intronic
1143062601 17:4214928-4214950 ACATGTATTATACTTTTGTAAGG + Intronic
1143960945 17:10719081-10719103 ATATAACTGCTAAATTTGTATGG - Intronic
1149698539 17:58636145-58636167 TCATGTTTGCTTAAGTTGTAGGG - Intronic
1150198724 17:63330523-63330545 ACTTGTATTTTAAATTGGTATGG - Intronic
1151052690 17:70996339-70996361 ACATGCATGATAAAATTGCAAGG - Intergenic
1151858550 17:76740472-76740494 AGTTGTAGGCTAAGTTTGTAGGG + Intronic
1153059215 18:978624-978646 ACATGTATGCTAGGCTTTTAAGG - Intergenic
1153059510 18:980764-980786 ACATGTATGCTAGGCTTTTAAGG - Intergenic
1155113513 18:22739742-22739764 ACATGTATGCAAATCTTTTATGG - Intergenic
1155405529 18:25482937-25482959 ACATTTATACTAAATTTGGGTGG + Intergenic
1157457813 18:47852496-47852518 ACATGAGTGCTATGTTTGTAAGG + Intronic
1157949720 18:52021586-52021608 ACATGTGTGCAAAGTTTATATGG + Intergenic
1158183324 18:54742876-54742898 ACATAGATGCAAAATTTGCAAGG - Intronic
1159779814 18:72647914-72647936 ACATTTATGCTTAATTTGAGGGG - Intergenic
1160326036 18:77949218-77949240 ACATGAATGCTAAAATTATATGG - Intergenic
1161295174 19:3516027-3516049 ACATGCATGCTGAGTTTCTAAGG + Intronic
1164730874 19:30503646-30503668 ACATGTCTGCTGACTTTGCAAGG - Intronic
925216653 2:2101984-2102006 AAATGTGTGCTTAATTTGTTCGG - Intronic
925839712 2:7979957-7979979 ATATGTAAGCTAAATTTGGTTGG + Intergenic
926856136 2:17257963-17257985 ACATATATGCTGAATTTTTCTGG - Intergenic
928968211 2:36998562-36998584 ACGTGCATGAGAAATTTGTAAGG + Intronic
929474874 2:42235993-42236015 ACATGTATTGTAACTTTTTAGGG - Intronic
931007962 2:57874164-57874186 ACATATTTGGTAAATTTTTAAGG - Intergenic
931192973 2:60023473-60023495 TCATGGATGATAAATTTGAAAGG + Intergenic
932781719 2:74562712-74562734 ACATGTATGCTGAATGTGGTAGG - Intronic
932914550 2:75841868-75841890 ACATGTATGCTAACTTAGGAGGG + Intergenic
934151718 2:89153697-89153719 ATATGTATATTTAATTTGTAAGG - Intergenic
934215542 2:90028209-90028231 ATATGTATATTTAATTTGTAAGG + Intergenic
935785715 2:106546893-106546915 ACATGTATCTTAAGTTTCTAAGG + Intergenic
936038774 2:109132729-109132751 TAATGTATGCTAAATTTCTCAGG + Intronic
936676235 2:114718733-114718755 ACATGTATGCTAAATTTGTAAGG + Intronic
938675282 2:133627097-133627119 ACATGTATTTCAAATTTTTATGG - Intergenic
938868351 2:135448053-135448075 ATATGTATGCTAAATTACAAAGG + Intronic
939726292 2:145725482-145725504 ACTTGTCTCCTAAAATTGTATGG - Intergenic
939933703 2:148262438-148262460 AAATGTATGCTAATATTATATGG - Intronic
940961941 2:159796308-159796330 ATATGTATGCTAATGTTATAGGG - Intronic
942532488 2:176926685-176926707 ATTTATATGCTAAATTTATAGGG + Intergenic
942767739 2:179476944-179476966 AGATGTATGCCAAATTTATGAGG + Intronic
942853783 2:180522386-180522408 ACATGAAGGCCAAATATGTATGG - Intergenic
943154553 2:184157593-184157615 AAATGTAGGCTATATTTGTAGGG + Intergenic
944323154 2:198372382-198372404 ACATGTGTTCTAAATGTGTTTGG - Intronic
944786957 2:203081425-203081447 ACATTTATGGGATATTTGTAAGG + Intronic
945413855 2:209546207-209546229 ACATATATTTTAAATGTGTATGG + Intronic
945842003 2:214898162-214898184 TCATGTATGCTAAATGTGAATGG + Intergenic
946860404 2:223995647-223995669 TCATGTATGCTGAATTTGCCAGG + Intronic
948831747 2:240601699-240601721 ACATTTATATGAAATTTGTATGG - Intronic
1171565972 20:26187947-26187969 AAATGTATTATAATTTTGTATGG - Intergenic
1177076463 21:16581611-16581633 AAAAATATGCTAATTTTGTAGGG - Intergenic
1177926904 21:27228195-27228217 ACATAAATGCTAAATTTCTTGGG - Intergenic
1178223771 21:30690594-30690616 ACAGATATGCTAAATTTAAAGGG - Intergenic
1183036583 22:35145132-35145154 ACATATATGTTAAATTTTTCTGG + Intergenic
1184055910 22:42049195-42049217 ACATGTTGGCTATATTTGTGCGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
951790066 3:26471037-26471059 ACAATTATGCAAAATATGTAGGG - Intergenic
952463132 3:33550605-33550627 ACATCTCTGCTACATGTGTATGG - Intronic
952516848 3:34113139-34113161 ATGTGTAGGCTAGATTTGTAAGG - Intergenic
953574624 3:44103175-44103197 AGATGTTTGCTAAATATGTATGG + Intergenic
955358954 3:58256175-58256197 AGATGTTTGCTGAAGTTGTAAGG - Intronic
957288573 3:78248344-78248366 ACATATATTCTAAAATTGTATGG + Intergenic
958592284 3:96173379-96173401 ATATATATTCTAAAATTGTATGG + Intergenic
959425938 3:106188633-106188655 ACGTATATAATAAATTTGTAAGG + Intergenic
960549563 3:118959639-118959661 ATAGGTATCCTAAATTTTTAGGG + Intronic
960885972 3:122394941-122394963 GGATGTATGCTAAAAATGTAAGG + Intronic
961398666 3:126617374-126617396 CCAGGAATGCTAAATTTGCAAGG - Intronic
962418504 3:135205821-135205843 ACATGTATGCTAAAATGGCTAGG - Intronic
962955271 3:140260178-140260200 ACATTTATTTTAATTTTGTATGG - Intronic
965438961 3:168689863-168689885 ACAAGGAAGATAAATTTGTAAGG - Intergenic
965775493 3:172225970-172225992 ATATGTATGCCAAATTTACATGG - Intronic
965851038 3:173024081-173024103 ACATGTATGCACAATAGGTATGG + Intronic
965954159 3:174348270-174348292 ACATGAATGGTAAATGAGTAAGG + Intergenic
966674999 3:182575845-182575867 TCAGGTATGTGAAATTTGTAAGG - Intergenic
966954084 3:184855361-184855383 ATATGCATGCTAAATATTTAGGG - Intronic
970091169 4:12409761-12409783 ACATGTCTGTTAAGTTTTTAGGG + Intergenic
971759108 4:30741547-30741569 TAAAGTATGCTAAAATTGTAAGG + Intronic
971897238 4:32613426-32613448 ATATTTTTGATAAATTTGTAGGG + Intergenic
972958820 4:44426122-44426144 AAATGTATGATACATTTGTAAGG + Intronic
972998307 4:44911686-44911708 ACACATATGATAAAGTTGTATGG + Intergenic
974236156 4:59184177-59184199 ACAAGTATCCTAAATATATAGGG + Intergenic
975442706 4:74431223-74431245 ACATGTGTGCTAAAATTACATGG - Intergenic
975756392 4:77575863-77575885 ACATATATTCCAAAATTGTATGG + Intronic
976025727 4:80686075-80686097 ACATGTATGCTATACTTGGTTGG - Intronic
977532465 4:98216429-98216451 ACATTTGAGCTAAATTTGAAAGG + Intergenic
977760167 4:100724784-100724806 ACAGATATGGTAAATATGTAAGG + Intronic
978667966 4:111209464-111209486 ATATGTATGTTGAATCTGTATGG + Intergenic
980864574 4:138540095-138540117 ACATGTATTCTAAACTTTTGAGG + Intergenic
982741934 4:159066545-159066567 ACATATATCCTATATATGTATGG + Intergenic
983695426 4:170522888-170522910 ACATATATGTTAAATGTGCATGG - Intergenic
983951408 4:173646888-173646910 ACATTTATGGTAACTTTGTATGG + Intergenic
987296781 5:16560232-16560254 ACGTTTATGCTAAATTTTGAAGG + Intronic
987841950 5:23233577-23233599 ATATATATTCTAAAATTGTATGG - Intergenic
989307870 5:39978250-39978272 AAATGTACACTAAATTTATATGG + Intergenic
989421508 5:41245233-41245255 ACATGGCTGTTAAATTTTTAAGG - Intronic
989692063 5:44156409-44156431 ACATATCTGCCAAAATTGTATGG + Intergenic
990196986 5:53328752-53328774 ACATCTATGTCAAATTTTTATGG + Intergenic
990258705 5:53998445-53998467 AAAGGTATGCTAAATTTGAGCGG - Intronic
990272003 5:54152296-54152318 ACGTGTATGCTAGATATGAAGGG - Intronic
990417876 5:55603801-55603823 ACATGTATGATAGATTTACATGG - Intergenic
991117149 5:62967593-62967615 ACATGTATGTTAAAATTGCCAGG - Intergenic
991507617 5:67341936-67341958 CCATGTATGCTAATTATGTGGGG + Intergenic
993615062 5:90100954-90100976 AAATGTATGCTCTAGTTGTATGG + Intergenic
994071334 5:95606120-95606142 AAACTTATTCTAAATTTGTATGG - Intergenic
994326774 5:98456800-98456822 ACATTTATTCTTAATTTTTATGG - Intergenic
994905330 5:105834113-105834135 ACATGTTTTCTAAATTTAAATGG + Intergenic
995616986 5:113975789-113975811 CAAGGTATGCTAAATATGTAGGG - Intergenic
999104383 5:149057623-149057645 GCATGTATGCTAAAATCGGAAGG - Intronic
999191730 5:149752986-149753008 ACATATATGCGATGTTTGTATGG - Intronic
1000203268 5:159032740-159032762 TCATGAATGTTAAATTTTTAAGG - Intronic
1000399285 5:160808769-160808791 AAATGTATGCTCACTTTCTAGGG + Intronic
1000573807 5:162950507-162950529 ACATCTATTCTAGATTTTTAGGG - Intergenic
1000818442 5:165954173-165954195 AAATGGGTGCTAAATTTATATGG - Intergenic
1001868492 5:175128712-175128734 AGTTTTATGCTAAATTTATATGG + Intergenic
1002976660 6:2085451-2085473 ATATGACTGCTAAATGTGTAAGG - Intronic
1004702563 6:18092818-18092840 AGATTGATGCTAAATTTGAATGG - Intergenic
1004736456 6:18410847-18410869 ACATGTATCCTAAGTTGATAAGG - Intronic
1005420371 6:25642211-25642233 ACCTCTATGCTAAATTTAAAAGG - Intergenic
1007405952 6:41636617-41636639 ACAGGTGTGCTCATTTTGTAAGG - Intergenic
1008191325 6:48461917-48461939 GAATCTATGATAAATTTGTATGG + Intergenic
1008765921 6:54914935-54914957 ACAAATATGCTAAAACTGTAGGG - Intronic
1009275897 6:61679235-61679257 AAATGTAAGCTAAATTTTGATGG - Intergenic
1009992187 6:70857507-70857529 ACATGTGAGCTAAAATTGTTGGG + Exonic
1010140307 6:72606675-72606697 ACAGCAATTCTAAATTTGTATGG - Intergenic
1012126237 6:95431721-95431743 ACATGTAAGGAATATTTGTACGG + Intergenic
1013308212 6:108869696-108869718 GCATGTAAGCAAAATTTGAATGG + Intronic
1013579241 6:111516246-111516268 GCATGTATTCTTAACTTGTAGGG + Intergenic
1015502496 6:133948849-133948871 AAATGTATGTTAAAGGTGTAGGG + Intergenic
1017257980 6:152355588-152355610 TGATTTATACTAAATTTGTAGGG - Intronic
1020571405 7:9868060-9868082 ACATTTATGCTAATTTCATATGG - Intergenic
1021237970 7:18166497-18166519 ACATGTACTCTACATTTCTATGG - Intronic
1021461336 7:20890461-20890483 ACATGGCTGCCAAATGTGTATGG + Intergenic
1022757333 7:33306835-33306857 ACAGGGATACTAAATTTGAAGGG - Intronic
1022852532 7:34279427-34279449 ATATGTATGCTGAACTTTTAGGG - Intergenic
1024748855 7:52439509-52439531 AAATGTAAGCTAAATGTGAAAGG - Intergenic
1025271499 7:57523959-57523981 AAATGTATTATAACTTTGTATGG + Intergenic
1027688622 7:81311384-81311406 CCATCTATGATATATTTGTATGG + Intergenic
1027821210 7:83047330-83047352 AGATGTATGATTAATTTTTAGGG + Intronic
1028246239 7:88481238-88481260 ACTTCAATGCTAAAATTGTAGGG + Intergenic
1029967473 7:104755105-104755127 ACATCTAGGCTAGATTTGTCTGG + Intronic
1030218176 7:107068098-107068120 AGATGTTTTCTAAATTTGTGGGG - Intronic
1031421577 7:121558181-121558203 GGATGTATGCTAAAATTGAAAGG - Intergenic
1033662900 7:143415018-143415040 ACATGTATCCTTAAATTGCATGG - Intergenic
1035854188 8:2956368-2956390 GCATGTATGCAAACTTTATAAGG - Intronic
1036722975 8:11194956-11194978 ACATTTATGGTAAATTTTCAAGG - Intronic
1037605143 8:20431927-20431949 ACATGTAGGATGAATTTGGAAGG - Intergenic
1038836033 8:31124736-31124758 ACATGTGTGCTGAATTTTTAAGG + Intronic
1039013378 8:33120569-33120591 GCAAGTCTGCTATATTTGTAGGG - Intergenic
1039091835 8:33838680-33838702 ACATAGATGCTAAATTTCAAAGG + Intergenic
1040605440 8:48927140-48927162 ACATGTTTGGTAAACTTGTAAGG + Intergenic
1042209695 8:66367463-66367485 TAATGTATGCTCAATTTATATGG - Intergenic
1042729386 8:71914824-71914846 TCATTAATGCTATATTTGTAAGG + Intronic
1043238959 8:77906704-77906726 ATATGTAAGCAAAATTTTTAGGG + Intergenic
1044014517 8:87034770-87034792 ACAAATATACTAAATTTGTCTGG - Intronic
1045153583 8:99438446-99438468 GCCTGTGTGCAAAATTTGTAAGG - Intronic
1045694854 8:104797418-104797440 ACATGTATCCTAAGATTGAAGGG - Intronic
1046239826 8:111476021-111476043 ACATGAATGCCACATATGTAAGG + Intergenic
1046401105 8:113704278-113704300 GCATGTATGCCTAAATTGTAGGG + Intergenic
1051392769 9:16583930-16583952 CCATTTATGCTAATTTTCTATGG - Intronic
1052088597 9:24298233-24298255 ACATGTGTACAAAATTTTTAAGG + Intergenic
1056419036 9:86405827-86405849 CAAGGTATGTTAAATTTGTACGG + Intergenic
1058245447 9:102618465-102618487 ATAGGTATGCTACATATGTATGG - Intergenic
1060612620 9:124982085-124982107 TCATGTGTGCTAATTTTGTCTGG + Intronic
1187622372 X:21072006-21072028 GTATATATGCTAAATTTGCAAGG - Intergenic
1191773705 X:64789296-64789318 AAATGTATGATAAAATTGTTGGG - Intergenic
1195154313 X:102108150-102108172 CCATATTTGCTAAATTAGTATGG + Intergenic
1196334870 X:114520577-114520599 ACATATATACTAAATATGAAGGG + Intergenic
1197525696 X:127559833-127559855 TCAAGCATCCTAAATTTGTAAGG + Intergenic
1201570906 Y:15413357-15413379 ACTTGTATGCAGAATATGTAAGG + Intergenic