ID: 936679282

View in Genome Browser
Species Human (GRCh38)
Location 2:114752107-114752129
Sequence CCCTGACCATTGGCATCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936679282 Original CRISPR CCCTGACCATTGGCATCATT TGG (reversed) Intronic
900171297 1:1270382-1270404 CCCTGGCCATTGACATCCTCAGG - Intronic
902274087 1:15326814-15326836 CACTGACCACAGGCATCGTTCGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
908119141 1:60969176-60969198 CCCTGACCATTCCCTTCATCAGG + Intronic
915957213 1:160231443-160231465 CCATGACCATTTGGATCTTTTGG - Intronic
921253064 1:213315296-213315318 CTCTGTCCATTGGTATGATTTGG + Intergenic
924122589 1:240817409-240817431 GCCTGAAAATTGGCATCATTAGG - Intronic
1064583252 10:16815097-16815119 CCATGACCATGGTCATTATTGGG - Intronic
1072818190 10:98530433-98530455 CCCAGACCATCAGCATCACTGGG - Intronic
1073487843 10:103832150-103832172 GCCTGTCCATTGGAGTCATTAGG - Intronic
1073541263 10:104317775-104317797 CCCTGTTCCTTGGCACCATTAGG - Intronic
1075099587 10:119496672-119496694 TCCTGACTGTTGGCCTCATTAGG + Intergenic
1077893419 11:6436426-6436448 CCTTGACCCGTGGCATCAATTGG - Intronic
1080344722 11:31311687-31311709 CCCTCAAGATTGGCATCTTTAGG - Intronic
1081155263 11:39682072-39682094 CCCTGACCTGTGGAATCTTTTGG + Intergenic
1085269816 11:75263591-75263613 CCCTGACCATGGGCTTCCTGAGG + Intergenic
1089297833 11:117480637-117480659 CCCTGAGGATTGGCATCACCTGG + Intronic
1091479935 12:817472-817494 CTAGGACCATTGGCAGCATTTGG + Intronic
1092448282 12:8578625-8578647 CCCTGAACATTGGCAACTATCGG - Intergenic
1093184115 12:16000132-16000154 TCCTGACAAATGGCACCATTAGG - Intronic
1094332303 12:29307774-29307796 ACCTGAACATTGCCATCATAAGG + Exonic
1097946468 12:65374634-65374656 CCCTAACCATTAGCATTATTAGG - Intronic
1099799795 12:87442761-87442783 CCCTGACCAATGGCTACCTTTGG - Intergenic
1101227553 12:102705022-102705044 CCCTGACCATTAGCATCTTTAGG + Intergenic
1102023784 12:109701557-109701579 CCCTGTCCTTTGGCACCATGAGG - Intergenic
1103408756 12:120695437-120695459 CCCTGACCTTTGTAGTCATTTGG + Intronic
1103944677 12:124519419-124519441 CCCAGACCCTTGTCATCATGTGG - Intronic
1108403489 13:50075762-50075784 CTCTGAACATTGGCAAGATTAGG - Intergenic
1112633365 13:101186230-101186252 CTCTTACCATTTGCATCTTTAGG + Intronic
1114134721 14:19834617-19834639 CCCTGCCCCCTGACATCATTTGG + Intergenic
1117981634 14:61347792-61347814 CCATGAGCATTGACTTCATTCGG + Intronic
1120909181 14:89650261-89650283 GCCTGACCTTTGGCCTCATGGGG + Intergenic
1121888227 14:97563998-97564020 CCTTGAGAATTGGCACCATTTGG - Intergenic
1123577776 15:21690191-21690213 CCCTGCCCCCTGACATCATTTGG + Intergenic
1123614400 15:22132672-22132694 CCCTGCCCCCTGACATCATTTGG + Intergenic
1125752725 15:42040755-42040777 CGCTGAACATTGGAATCATATGG + Intronic
1126783826 15:52160656-52160678 GCCTGACCATTCTTATCATTTGG + Intronic
1127313376 15:57771701-57771723 GGCAGACCATTGGAATCATTTGG - Intronic
1129113326 15:73351075-73351097 CCCTGGCCTTTAGCATCATCTGG + Intronic
1202986645 15_KI270727v1_random:424436-424458 CCCTGCCCCCTGACATCATTTGG + Intergenic
1139471341 16:67179621-67179643 CGCTGCCCTGTGGCATCATTGGG - Intronic
1140808295 16:78553467-78553489 CCCTCACCACTGGCTTTATTGGG - Intronic
1141711728 16:85703537-85703559 CCCTGACCACGGGCTTCACTGGG - Intronic
1141893321 16:86942421-86942443 GGTTGCCCATTGGCATCATTTGG - Intergenic
1142788740 17:2246317-2246339 CCCTGACCACTGGGATCCTGGGG - Intronic
1144531637 17:16044769-16044791 CCCTGGCCAATGTCAACATTGGG + Intronic
1144534938 17:16079059-16079081 ACCAGAGCATTGGCATCACTGGG - Intronic
1146252553 17:31362041-31362063 CCCAGACCAGCAGCATCATTTGG + Intronic
1146516769 17:33495657-33495679 GCCTGGCCTTTGGCACCATTAGG - Intronic
1146997918 17:37337003-37337025 CCTGGACCATTGGCATCACCTGG + Intronic
1149921468 17:60664280-60664302 CCCAGACCAATGGCATTATTAGG + Exonic
1150587160 17:66529447-66529469 CCCTTACCAGTGGCTTCATGAGG - Intronic
1151018100 17:70580430-70580452 CACTGACCATTGATATCATTTGG + Intergenic
1151328225 17:73391737-73391759 CCCTCAAAATAGGCATCATTTGG + Intronic
1151513710 17:74578807-74578829 CCCTGCCCAGTGGGATCATCTGG - Intergenic
1151626179 17:75277303-75277325 CTCTGACCCTTGCCATCACTGGG - Intronic
1155360499 18:24995179-24995201 CACAGACCACTGGCATCTTTTGG - Intergenic
1157321451 18:46637754-46637776 CCCTCACCCTTGCCAACATTTGG - Intronic
925663090 2:6223415-6223437 CCCTGACAATTGGCACTACTGGG + Intergenic
928306222 2:30172367-30172389 CCATGGCCAGTGGCATCACTTGG + Intergenic
931047342 2:58370499-58370521 CCCACAGCATTGGCATCATCTGG - Intergenic
931704630 2:64937284-64937306 CCCTGGTCACTGGCATCACTGGG + Intergenic
936679282 2:114752107-114752129 CCCTGACCATTGGCATCATTTGG - Intronic
938452171 2:131431182-131431204 CCCTGACTATTCTCATCATAAGG - Intergenic
938712932 2:133991041-133991063 CCAGCAGCATTGGCATCATTTGG - Intergenic
941072332 2:160969092-160969114 CCTGCACCATTGGCATCACTGGG - Intergenic
1170041207 20:12041529-12041551 CACTGACCAGTAGCATCATCTGG - Intergenic
1176885150 21:14246323-14246345 CCCATACCATAGGCACCATTAGG + Intergenic
1177697868 21:24596776-24596798 CCCGGACCATTGCCAGCAATAGG - Intergenic
1183065703 22:35361282-35361304 CCCTGGCCTTTGGCATCAGACGG - Intergenic
1184712126 22:46257239-46257261 TCCTGGCCACTGGCATAATTCGG - Exonic
950533025 3:13563974-13563996 CCCTTCCCATTGGCATCGTTGGG - Intronic
951061161 3:18208700-18208722 CCCTGAGCACTGGCAACATGGGG + Intronic
952529563 3:34249283-34249305 CCAGGAGCATTGGCATCATCTGG + Intergenic
956901229 3:73718049-73718071 CCATCAGCATTGGCATCATGTGG + Intergenic
960675640 3:120192316-120192338 TCCTGACCATTATCCTCATTGGG - Intronic
964366009 3:155951325-155951347 CCCTGACCATTAGGATCCTCAGG - Intergenic
967220285 3:187242738-187242760 ACCTGACCATTGGCCACACTGGG - Intronic
968941312 4:3640265-3640287 CCCTGAGCACTGGCACCCTTCGG - Intergenic
969127971 4:4968158-4968180 CTCTCTCCATTGGCATCAGTGGG + Intergenic
972287066 4:37659424-37659446 CTCTGACCATTGGGGTCAGTTGG - Intronic
973815681 4:54616987-54617009 CCCTTACCATTGGCACCATCAGG - Intergenic
975834720 4:78410340-78410362 CCCTGTCCATTGGAGTTATTTGG + Intronic
980373003 4:131903373-131903395 TCCTAACCATTGGCAGCATAGGG + Intergenic
985577033 5:678284-678306 CCTTGCCCACTGCCATCATTGGG + Intronic
985591953 5:770337-770359 CCTTGCCCACTGCCATCATTGGG + Intergenic
989505864 5:42227198-42227220 CACAGACCATTGGCATTATAAGG - Intergenic
995530910 5:113091161-113091183 CCCAGACCAGTGGCACCTTTGGG + Intronic
1003017840 6:2482334-2482356 TCCTGACCATTGGATTCCTTAGG - Intergenic
1003524931 6:6889692-6889714 CCATTACCATAGACATCATTGGG - Intergenic
1003661773 6:8068945-8068967 TCCTGACCATTTTCACCATTTGG - Intronic
1005332686 6:24764950-24764972 CCCTGGCCATTGGCCTTCTTGGG - Intergenic
1006223793 6:32519116-32519138 CCCTGACCTGTGACATCATGGGG + Intronic
1012692931 6:102338044-102338066 CCCTGACCATTGCCATCATAGGG - Intergenic
1013937410 6:115615035-115615057 CTCTAATAATTGGCATCATTAGG + Intergenic
1014835798 6:126159039-126159061 CTCTGCCCTTTGGCATCAGTGGG - Intergenic
1014883416 6:126749989-126750011 CCCTGTCCATTGGCTTCTATTGG - Intergenic
1015461793 6:133500084-133500106 CCAGCACCATTGGCATCATCTGG - Intronic
1016644625 6:146392058-146392080 CCTTGACTATTGTCCTCATTAGG + Intronic
1017060436 6:150479400-150479422 CTCTGAGCATTGGACTCATTTGG + Intergenic
1019315334 7:381555-381577 CCCTGACCACTTGCATGCTTTGG - Intergenic
1020084598 7:5303615-5303637 CCCTGACCTGTGGCATCGTGTGG - Exonic
1022574849 7:31487587-31487609 CCCTTATCATTGGTATCATGAGG - Intergenic
1022663086 7:32384876-32384898 CCAGCACCATTGGCATCATGTGG - Intergenic
1026658191 7:72275681-72275703 GCCTGAGCATTGGCAGCCTTGGG - Intronic
1032553095 7:132804079-132804101 CCCTGTCCCTTGGCTACATTGGG - Intronic
1037745634 8:21641971-21641993 CCCTGACTATTGGCACAATGTGG + Intergenic
1037829723 8:22180277-22180299 CCCTGAACCTTGGCATCCTCTGG - Intronic
1040765848 8:50910137-50910159 CCTTGACCAATGGCATTCTTTGG + Intergenic
1041247991 8:55906958-55906980 CCCTGATCCTTGCCAGCATTTGG - Intronic
1043317672 8:78941596-78941618 CCCACACCAATGGCCTCATTGGG - Intergenic
1044912948 8:97081306-97081328 CCCTGATCATTGTAGTCATTTGG + Intronic
1045186454 8:99843303-99843325 TCCTGATCAATGCCATCATTTGG - Intronic
1049129883 8:140828954-140828976 CACAGACCATTGGCATGAGTGGG - Intronic
1049552800 8:143268171-143268193 ACCTGACCCTTCCCATCATTAGG + Intronic
1051368114 9:16335626-16335648 CCTTGACCATTGACATGGTTAGG - Intergenic
1053492366 9:38518535-38518557 CCCTGATGATTGGTACCATTGGG - Intergenic
1053683869 9:40503898-40503920 CCATGAAGATTGGCTTCATTTGG + Intergenic
1053933843 9:43132184-43132206 CCATGAAGATTGGCTTCATTTGG + Intergenic
1054279852 9:63121054-63121076 CCATGAAGATTGGCTTCATTTGG - Intergenic
1054296965 9:63339364-63339386 CCATGAAGATTGGCTTCATTTGG + Intergenic
1054394983 9:64643870-64643892 CCATGAAGATTGGCTTCATTTGG + Intergenic
1054429630 9:65149070-65149092 CCATGAAGATTGGCTTCATTTGG + Intergenic
1054500752 9:65872461-65872483 CCATGAAGATTGGCTTCATTTGG - Intergenic
1056115299 9:83435450-83435472 CCCTGACCACTGGCCTCACTAGG + Intronic
1057576981 9:96250536-96250558 CCCTGACCTTTGGAGTCATTAGG - Intronic
1059218546 9:112590095-112590117 CCCTGACCATTGGCATCACCTGG + Intronic
1061993994 9:134174926-134174948 CCTTGACCATTGGCAGCTGTTGG + Intergenic
1189039229 X:37524844-37524866 CCCTCACCATGTGCAGCATTTGG + Intronic
1189536508 X:41940715-41940737 CTCTAAGCATTGGCTTCATTTGG - Intergenic
1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG + Exonic
1197210793 X:123826647-123826669 CGCTAACCCTTGGCATCCTTTGG - Intergenic
1199527657 X:148810535-148810557 CTCTGGCCATTGGCATCATAAGG + Intronic