ID: 936680087

View in Genome Browser
Species Human (GRCh38)
Location 2:114760096-114760118
Sequence TCCAGCTGGTCTCCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936680082_936680087 -9 Left 936680082 2:114760082-114760104 CCTGTAGAAGTCCCTCCAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 143
Right 936680087 2:114760096-114760118 TCCAGCTGGTCTCCACAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 272
936680081_936680087 5 Left 936680081 2:114760068-114760090 CCATAAACGCTAATCCTGTAGAA 0: 1
1: 0
2: 0
3: 0
4: 75
Right 936680087 2:114760096-114760118 TCCAGCTGGTCTCCACAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 272
936680080_936680087 30 Left 936680080 2:114760043-114760065 CCTAATCTGAGCTATCATATCTC 0: 1
1: 0
2: 1
3: 73
4: 1206
Right 936680087 2:114760096-114760118 TCCAGCTGGTCTCCACAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936680087 Original CRISPR TCCAGCTGGTCTCCACAGGC AGG Intronic
900314069 1:2048443-2048465 TCCAGCAGATCTCTGCAGGCAGG + Intergenic
901637514 1:10677179-10677201 TCCAGCCGCTCTGCTCAGGCTGG + Intronic
901957346 1:12796168-12796190 TCCAGCTGGTCTCAAACTGCTGG + Exonic
902204148 1:14854986-14855008 TCCAGCCCGCCTCCACAGCCAGG - Intronic
902238163 1:15070929-15070951 TCCAGTTGGACTCCACTGGGCGG + Intronic
902471696 1:16651424-16651446 TGAAGCTGGTCTTCAGAGGCAGG + Intergenic
902487114 1:16756020-16756042 TGAAGCTGGTCTTCAGAGGCAGG - Intronic
902647072 1:17806994-17807016 TGCAGGTGGCCTCCACAAGCTGG - Intronic
902817384 1:18924062-18924084 GCCAGCTGCTGTCCACATGCGGG - Intronic
903698977 1:25232279-25232301 CCCCGCCGGTCCCCACAGGCTGG + Intronic
904773125 1:32892154-32892176 TCCATCAGGTCTCCCCTGGCTGG - Intronic
906000062 1:42417180-42417202 TCTAGCTGCTCTGCTCAGGCTGG - Exonic
906700424 1:47853422-47853444 CCCAGCAGGTCTCCACAGGGTGG + Intronic
906700550 1:47854351-47854373 TTCAGCTGATCTCCAGAGTCTGG + Intronic
907161454 1:52373252-52373274 TCCTGCTGGGCTCCACAAGCAGG + Exonic
910259912 1:85284580-85284602 GGCAGCTCCTCTCCACAGGCAGG - Intergenic
912435978 1:109661306-109661328 TCCAGCTGCGCTGCACAGCCTGG - Exonic
912437920 1:109674888-109674910 TCCAGCTGCGCTGCACAGCCTGG - Exonic
912440431 1:109693347-109693369 TCCAGCTGCGCTGCACAGCCTGG - Exonic
912723100 1:112036345-112036367 ACCAGCAGGTACCCACAGGCAGG + Intergenic
914029811 1:143947775-143947797 TCCTGCCTGGCTCCACAGGCAGG - Intronic
914159638 1:145120175-145120197 TCCTGCCTGGCTCCACAGGCAGG + Intergenic
914912495 1:151799149-151799171 TGAAGCTGGACTTCACAGGCAGG - Intergenic
915106957 1:153540753-153540775 CCCAGCTGGTCTCCAGACTCTGG + Intronic
916272528 1:162958535-162958557 TCCAGCTGCTCTTCACCTGCGGG + Intergenic
916877362 1:168983725-168983747 TCTTACTGGTCTCCACAGCCAGG + Intergenic
919538181 1:198814441-198814463 TCCAGCTGGTCTCTCCATTCAGG + Intergenic
919930150 1:202215804-202215826 TGTAGCTGGTCTCCCCAGACAGG - Intronic
920096909 1:203492308-203492330 TCCATCTTCTCTCCACAGCCTGG - Intergenic
920297915 1:204970611-204970633 TCCAGCTGCTCCCTACTGGCTGG + Exonic
920377999 1:205519579-205519601 ACCAGCTGTTCTCCACCCGCAGG - Intronic
920604785 1:207371320-207371342 GCCAGCTGGTCTCCTGAGTCAGG - Intergenic
921118953 1:212120055-212120077 TTGAGCTGGTTTCCAAAGGCAGG + Intergenic
921222435 1:212982617-212982639 TCTGGCTGGGCCCCACAGGCAGG + Intronic
921546696 1:216482407-216482429 TCCAGGTGGGCTCCCCTGGCTGG - Intergenic
921625415 1:217373366-217373388 GGCAGCTCCTCTCCACAGGCAGG - Intergenic
922570234 1:226630317-226630339 TGCACCTGCTCTCCACAGGCTGG - Intergenic
922807873 1:228399980-228400002 TTCTGCTGGGCTCCAGAGGCCGG + Intronic
923499715 1:234554780-234554802 TCCAGCTGTACTGCCCAGGCTGG - Intergenic
924426181 1:243952363-243952385 TCCACCATGTCTCAACAGGCTGG - Intergenic
924608092 1:245552260-245552282 TGCAGCTGGAGTCCAAAGGCGGG + Intronic
924726914 1:246679592-246679614 TGCAGCTGGTCTCCAGGGGCAGG - Intergenic
1064055503 10:12093922-12093944 GCCAGCTGGTCTCCAAAGCTGGG + Intronic
1065313672 10:24441018-24441040 TGCAGCTGGGCTCCAGAGGCAGG - Intronic
1066481802 10:35803310-35803332 TCCCACTGGTCTCCATAGGCAGG + Intergenic
1067030288 10:42875183-42875205 TCCCGCTTCTCTCCGCAGGCAGG + Intergenic
1068520132 10:58068664-58068686 TCCAGGTGATCTTCTCAGGCTGG - Intergenic
1068779081 10:60900037-60900059 TCCAGGAGGGCACCACAGGCAGG - Intronic
1072424662 10:95320033-95320055 TCCAGCCAGTCTCCACTGTCTGG - Intronic
1073183312 10:101599797-101599819 ACCAGCTGGGCTCCTCAGGCTGG + Intronic
1075668574 10:124247801-124247823 TCCACCTGGAGTCCACAGGCTGG + Intergenic
1077512374 11:2975059-2975081 TCCAGCTGGTTTCCCCAGTCAGG - Intronic
1079370982 11:19852014-19852036 TGCAGGTGGCCTCCACAAGCTGG + Intronic
1083129692 11:60613481-60613503 TGCACCTGGTCTCCACTTGCAGG - Intergenic
1084038685 11:66529357-66529379 TCCTGCTCATCTCCACAGGGAGG - Intronic
1084489964 11:69472859-69472881 TCCAGCTGGTCTTCAGCAGCTGG + Intergenic
1085136644 11:74095925-74095947 TCCAGCAGGACTCCTCAGTCTGG + Intronic
1087902781 11:103661325-103661347 TTCAGCTGGAGTCCAAAGGCAGG - Intergenic
1088541565 11:110919039-110919061 AGAAGCTGGTCTCCAGAGGCAGG + Intergenic
1088785359 11:113176866-113176888 GCCAGCTTTTCTCAACAGGCTGG - Intronic
1088934867 11:114389731-114389753 ACCAGCTGGTCTCCAACTGCTGG + Intergenic
1091283003 11:134392578-134392600 TCCAGCTGGTCTCAACCTACTGG + Intronic
1093266611 12:17011170-17011192 TCCAGCTGGGCTCCTGAGTCTGG + Intergenic
1093575463 12:20722743-20722765 TCTAGCTGGGAGCCACAGGCAGG - Intronic
1093653823 12:21673918-21673940 GCCAGCTGGGCTCCTCAGTCTGG - Intronic
1093793805 12:23286380-23286402 GCCAGCTGGTCTCCTGAGTCTGG + Intergenic
1093924075 12:24891206-24891228 TCCATGTGGTCTCCTCAGGATGG - Intronic
1093970294 12:25369826-25369848 TCCAGCTGGGCTCCTGAGTCTGG + Intergenic
1093973041 12:25391889-25391911 TCCAGCTGGGCTCCTGAGTCTGG + Intergenic
1095968191 12:47883345-47883367 TACACCCGGTCTCCACAGACAGG - Intronic
1097055127 12:56244567-56244589 CCCAGCCAGCCTCCACAGGCAGG + Intronic
1097500363 12:60393263-60393285 TCCAGCTACTCTGCACAGCCAGG - Intergenic
1097684232 12:62676926-62676948 TCCAGGTGGAGTCCACAGCCTGG + Intronic
1104927076 12:132319368-132319390 TCCACCCGATGTCCACAGGCAGG - Intronic
1105035955 12:132921178-132921200 TCCAGCTGGTCTCAAACGCCTGG + Intronic
1107652656 13:42560152-42560174 GCCAGCTGGGCTCCTCAGCCTGG + Intergenic
1107886123 13:44875393-44875415 CCCAGCTGGGCTCCACATGTAGG - Intergenic
1107997199 13:45872697-45872719 TCCAGATGGTCTCTGCAGGGAGG - Intergenic
1108469375 13:50753218-50753240 TCCAGCTGGGCTCCTGAGTCTGG - Intronic
1109037643 13:57286499-57286521 TCCAGCTGGGCTCCTGAGTCGGG - Intergenic
1109512461 13:63396960-63396982 TCCAGCTGCTGCACACAGGCAGG - Intergenic
1109562809 13:64075609-64075631 AACAGCTGGTTTCCATAGGCAGG + Intergenic
1109829872 13:67772848-67772870 CCCAGCTGGGCTCCTCAGTCTGG - Intergenic
1111591124 13:90349075-90349097 GCCAGCTGGGCTCCAGAGTCTGG + Intergenic
1114168640 14:20248410-20248432 TCCAGCTGGTCTCCAACTCCTGG - Intergenic
1114946862 14:27693215-27693237 TCCAGCTGGTCTCCTCCAGCAGG - Intergenic
1118251368 14:64164709-64164731 TCTATGTGGTCTCCTCAGGCGGG + Intronic
1119040447 14:71269747-71269769 TCGAGATGGGCTCCACAGCCTGG - Intergenic
1121995724 14:98601458-98601480 TACACCTGGTGCCCACAGGCAGG - Intergenic
1122280713 14:100620688-100620710 TCCTGCTGGCCTCCAAAGCCCGG - Intergenic
1122386066 14:101349140-101349162 TCCAGGTGGAGTCCACAGTCTGG - Intergenic
1122794913 14:104201274-104201296 TCCAGCTGGTCATGCCAGGCAGG + Intergenic
1126101156 15:45119079-45119101 TCCAGGTGGCCTCCACGGGGAGG + Intronic
1126187506 15:45844821-45844843 TGCACCAGGTATCCACAGGCAGG + Intergenic
1126990732 15:54373457-54373479 TCCGGCTGCTCTGCACAGCCAGG + Intronic
1127321564 15:57851717-57851739 TCAAGCTGGTGTCTAGAGGCAGG + Intergenic
1128233919 15:66054219-66054241 GCCAGCTGCTCTCCACTGGCTGG + Intronic
1128439466 15:67690991-67691013 TCAAGTTGGTATGCACAGGCAGG - Intronic
1128818522 15:70631421-70631443 TCCACCTGTCCTCTACAGGCAGG - Intergenic
1129056115 15:72821731-72821753 TCAAGCTGGTCTCCACGGTCTGG + Intergenic
1130253799 15:82316582-82316604 CCAAGCTGGCATCCACAGGCTGG - Intergenic
1130995363 15:88900488-88900510 TCCTGAGGGTGTCCACAGGCAGG + Intronic
1131423858 15:92329570-92329592 TCCCGCCAGTCTCCACAGTCAGG + Intergenic
1131892104 15:96984085-96984107 GCCAGCTGGGCTCCTCAGGCTGG - Intergenic
1132331470 15:101015056-101015078 GGCGGCTGGTCTCCAGAGGCTGG - Intronic
1133475701 16:6119696-6119718 TCCACAGGGTATCCACAGGCTGG + Intronic
1133868222 16:9663824-9663846 TGCAGCTGGTGTGAACAGGCTGG + Intergenic
1133871791 16:9695472-9695494 TCCCTCTGGTATCCACAGCCTGG - Intergenic
1136991129 16:35152004-35152026 TCCATCCACTCTCCACAGGCTGG + Intergenic
1137580170 16:49628727-49628749 TACAGCTGGTTTCCACACACAGG + Intronic
1139147999 16:64345620-64345642 TCCAGGTGGAGTCCACAGCCTGG + Intergenic
1139428630 16:66899312-66899334 TCCACCTGCTCCCCAAAGGCCGG + Intergenic
1139672562 16:68501746-68501768 CCCAGAGGGACTCCACAGGCAGG + Intergenic
1141699620 16:85636417-85636439 TCCAGCTGGTCACCCCTGTCAGG + Intronic
1142505749 17:362043-362065 GCCAGCTGGGCTCCTCAGTCTGG + Intronic
1142604320 17:1073273-1073295 TCCACCTGGTCTCCACACTGGGG - Intronic
1143509259 17:7386543-7386565 TTCCTCTTGTCTCCACAGGCCGG + Exonic
1144179872 17:12741827-12741849 CCCAGCTGGTCCCGGCAGGCTGG + Intronic
1144609518 17:16697437-16697459 TCCAGCTGCTCTCCATATGAGGG - Intronic
1144903253 17:18618114-18618136 TCCAGCTGCTCTCCATATGAGGG + Intergenic
1144927814 17:18827871-18827893 TCCAGCTGCTCTCCATATGAGGG - Intergenic
1145129319 17:20328638-20328660 TCCAGCTGCTCTCCATATGAGGG - Intergenic
1146279410 17:31535659-31535681 TCCAGCTGTTCTCACCAGCCTGG + Exonic
1147129823 17:38400713-38400735 TCCTGCTGGTCTCCACTCACTGG + Exonic
1149081639 17:52665434-52665456 TCAGGCTTGTCTCCAAAGGCTGG - Intergenic
1150521163 17:65867237-65867259 TCCAGCTGCTGTGCACAGGCCGG - Intronic
1151258506 17:72898423-72898445 CCCAGCTGGTCCCCAGAGGAGGG + Intronic
1151328834 17:73394902-73394924 CCCAGCTGTCCTCCAGAGGCAGG + Intronic
1151717712 17:75839938-75839960 TCCACCTGCTCCCCTCAGGCGGG - Exonic
1152126456 17:78450187-78450209 TGCATCTGGGCTCCACAGCCAGG - Intronic
1154389279 18:13922777-13922799 CCCTGCAGGTCACCACAGGCTGG - Intergenic
1155817158 18:30327114-30327136 TTCAGCTGGAATCCAAAGGCAGG - Intergenic
1156123402 18:33873271-33873293 TCCAGCTGGTCTCCTGGAGCAGG + Intronic
1156493576 18:37511234-37511256 ATCAGCTGCCCTCCACAGGCAGG + Intronic
1157585956 18:48801274-48801296 CCCATATGGTCTCCAGAGGCAGG + Intronic
1158626508 18:59076395-59076417 GCCTGCTGGTCTGTACAGGCTGG + Intergenic
1160575700 18:79852680-79852702 TCCAGCTCATCTCCAGAGGGTGG - Intergenic
1161081492 19:2312763-2312785 TCCTGCTGGTTTTCCCAGGCAGG + Intronic
1163840011 19:19601747-19601769 TGCAGGTGGCCTCAACAGGCTGG + Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1167999183 19:53431513-53431535 TCCAGCAGGTCGCCCCTGGCTGG + Intergenic
1168540055 19:57202646-57202668 TCCAGGTGGTCCCCCCAGGAAGG + Intronic
1202704094 1_KI270713v1_random:8219-8241 TGAAGCTGGTCTTCAGAGGCAGG + Intergenic
925112867 2:1351646-1351668 TCCAGCCGGGCTCAACAGCCTGG + Intronic
926090355 2:10044934-10044956 TCAAGCTGGTCTCGAAAGCCCGG - Intronic
927982135 2:27380736-27380758 ACCAGCTGGTCTCCGTAGGGGGG - Intronic
928790730 2:34949422-34949444 TCCTGCTGTTCTACAGAGGCTGG + Intergenic
929137937 2:38642981-38643003 GCCAGCTGGGCTCCCGAGGCGGG - Intergenic
929972527 2:46595047-46595069 TCAGGCTGGTCTCCACAGTTAGG + Intronic
931069340 2:58626845-58626867 TCCAGCTGTTGTATACAGGCAGG + Intergenic
931075475 2:58706756-58706778 TCCAGCTGGGCTACCCAGGATGG + Intergenic
932073500 2:68643563-68643585 GCCAGCTGGGCTGCAGAGGCCGG - Intergenic
932074565 2:68651021-68651043 TCCAGAAGGTCTCAACAGCCAGG + Intronic
933139896 2:78779446-78779468 GCCAGCTGGGCTCCTCAGTCAGG + Intergenic
934855617 2:97727581-97727603 TCCAGGGGCTCTCCCCAGGCTGG + Intronic
934952362 2:98585616-98585638 GCCAGCTCGTCCGCACAGGCAGG + Intronic
935581087 2:104756401-104756423 TCCAGCTGGGATCCTCAGCCAGG + Intergenic
935698905 2:105793418-105793440 TTCAGCTGGTCTGGTCAGGCAGG + Intronic
936091344 2:109503406-109503428 TCCAGGTGGTCACCACACGGCGG + Intronic
936680087 2:114760096-114760118 TCCAGCTGGTCTCCACAGGCAGG + Intronic
937265552 2:120612716-120612738 TCGAGCTGGTCTTCATAGGTGGG + Intergenic
939852681 2:147319531-147319553 TCCAGCTTGCTGCCACAGGCTGG + Intergenic
940215173 2:151296393-151296415 TCCAGCTGGGCTCCTGAGTCTGG + Intergenic
942540270 2:177008300-177008322 GCCAGCTGGTCTCCTGAGTCTGG + Intergenic
948627511 2:239278075-239278097 TCCAGGTGGCCTCCACCAGCGGG - Intronic
948676488 2:239600050-239600072 TCCTGCTGGACTCCACAGCCTGG + Intergenic
948823817 2:240564680-240564702 TCCAGGTGCCCTCCACAGCCAGG - Intronic
1170523684 20:17215308-17215330 CCCACCTGGTCTGCAGAGGCAGG + Intergenic
1171395171 20:24828526-24828548 TCCCTCTGGCCTCCACAGCCAGG + Intergenic
1171982440 20:31637687-31637709 TGCAGAGGGTCTCCAGAGGCAGG + Intergenic
1172799281 20:37564824-37564846 TCTACCTGGGCTGCACAGGCTGG + Intergenic
1172854572 20:37992135-37992157 ACCAGCTGGTCACCACCTGCTGG + Intronic
1174505670 20:51015946-51015968 TGCAGGTGGCCTCCAAAGGCTGG + Intronic
1175814390 20:61875963-61875985 AGCAGCTCGTTTCCACAGGCTGG + Intronic
1177182129 21:17755920-17755942 TCCAGCTGGTCTCCAACTCCTGG + Intergenic
1178695334 21:34787921-34787943 TCCAGCTGCCCTGCTCAGGCTGG + Exonic
1180088711 21:45523165-45523187 CCCAGCTGTTCTCCCCATGCTGG + Intronic
1180226128 21:46393541-46393563 ACCAGGTGGTCTCCCCCGGCGGG - Intronic
1180979590 22:19872349-19872371 GCCAGCAGGTCTCATCAGGCTGG + Intergenic
1183858325 22:40651867-40651889 TCCAGCCGGGCTCCACAGCATGG - Intergenic
1184396593 22:44245615-44245637 TCCAGCTGCCATCCCCAGGCAGG - Exonic
1184687057 22:46101005-46101027 CCCAGGTGGCCTCCACATGCAGG + Intronic
1185202568 22:49517151-49517173 TCCAGGTGGGCTCCCCATGCAGG + Intronic
1185207017 22:49545764-49545786 GTCAGCCTGTCTCCACAGGCAGG + Intronic
1185241397 22:49749445-49749467 TCCAGTTGGTGTCCCCAGGAGGG - Intergenic
949908124 3:8876064-8876086 TCCAGCTGCTATCCAAAGACTGG + Intronic
950020036 3:9780545-9780567 GCTGGCTGGTCCCCACAGGCTGG - Exonic
950303838 3:11903615-11903637 TGCATCTGTTCTCCCCAGGCGGG + Intergenic
950493909 3:13322397-13322419 TCCACCAGGCCTGCACAGGCTGG + Intronic
950506010 3:13395040-13395062 GTCACCTGGTCTCCACAGACTGG - Intronic
951119642 3:18910297-18910319 TGAAGCTGGTCTTCAGAGGCAGG - Intergenic
951323122 3:21271539-21271561 GCCAGCTGGGCTCCTCAGTCAGG - Intergenic
952959401 3:38580166-38580188 AGCAGCTGCTCTCCACAGCCAGG + Intronic
953003658 3:38957853-38957875 TTCACCTGGTCTCCACAGATTGG - Intergenic
953997428 3:47530839-47530861 TCGAGCTGGTCTCCAATGCCTGG + Intergenic
957056088 3:75444345-75444367 GCCAGCTGGTCTCCTGAGTCTGG - Intergenic
960046470 3:113203599-113203621 TCCAGCTCAACTCCCCAGGCTGG - Intergenic
962628134 3:137248152-137248174 TACAACTGGTCTCCCCAGGGAGG + Intergenic
966548894 3:181182929-181182951 TCCAGCTGGGCTCCTGAGTCTGG - Intergenic
968194647 3:196696072-196696094 GCCAGCTGGGATCCAGAGGCGGG + Intronic
968317438 3:197736650-197736672 CCCACCTGCTCTCCTCAGGCAGG + Exonic
969457163 4:7306689-7306711 TCCAGTTGCTGTCCAGAGGCTGG + Intronic
969573543 4:8023937-8023959 GCCAGCTGGTGGCCACGGGCAGG + Intronic
974027343 4:56745332-56745354 TCTAGCTGGTTTACAGAGGCTGG + Intergenic
975302866 4:72811764-72811786 TGCAGCTGGCCTCCAGAAGCTGG + Intergenic
978646459 4:110938235-110938257 TTCATCTGGTCTCCAAAGTCTGG + Intergenic
981151997 4:141389788-141389810 TGCAGGTGGTCTCTACAAGCTGG - Intergenic
981258429 4:142691013-142691035 GTCAGCTGGTCATCACAGGCTGG - Intronic
982357592 4:154487980-154488002 TCCAGCTGTGTTCCCCAGGCTGG - Intronic
983012831 4:162569583-162569605 TTCAGCTGGAGTCCAAAGGCAGG + Intergenic
985175429 4:187195063-187195085 TGCAGCTGGTCTCCAGTGCCAGG + Intergenic
985523437 5:389826-389848 TCCAGCTCGTCTTCTCAGGTTGG - Intronic
986121226 5:4837984-4838006 TCCAGCTGGGCTCCTGAGTCTGG + Intergenic
986337724 5:6767652-6767674 ACCAGCAGGTCTGGACAGGCGGG + Intergenic
987036845 5:14027686-14027708 TGCAGCGGGGCTCCACAGGCAGG - Intergenic
987347359 5:16990891-16990913 GCCAGCTGGGCTCCTCAGTCTGG - Intergenic
987392198 5:17386902-17386924 CCCACATGGTCTCCAGAGGCTGG + Intergenic
987560224 5:19510721-19510743 TCCACCTGGTCTCTCCAGGTAGG - Intronic
988142987 5:27267162-27267184 GCCAGCTGGGCTCCTCAGTCAGG - Intergenic
992187963 5:74262099-74262121 TCCAGATGGACTGCACATGCTGG - Intergenic
993618026 5:90136869-90136891 TCCAGGTGGAGTCCACAGCCTGG - Intergenic
993681328 5:90881916-90881938 TCAAGCTGGTCTCCACCTCCTGG + Intronic
993703322 5:91143536-91143558 GGTAGCTTGTCTCCACAGGCAGG + Intronic
993830396 5:92749964-92749986 TTCAGCTAGTCTCCAAAGGAAGG - Intergenic
994082283 5:95720251-95720273 GCCAGCTGGGCTGCTCAGGCTGG - Intronic
995941326 5:117588394-117588416 GCCAGCTGGTCTCCAAAGTCAGG + Intergenic
996908249 5:128626697-128626719 ACCAGCTGGGCTCCACAGTGAGG + Intronic
999754506 5:154654072-154654094 TCCATCTGGTCCCCCCAGGGAGG - Intergenic
1000266315 5:159641353-159641375 GGTAGCTGCTCTCCACAGGCAGG - Intergenic
1000831692 5:166110172-166110194 TCCAGCTTGAGTCCAAAGGCAGG + Intergenic
1001062666 5:168506384-168506406 TCCAGCTTGCCTCCACAAACTGG + Intronic
1003244338 6:4371303-4371325 TCCACCTCCTCTCCCCAGGCAGG + Intergenic
1004483159 6:16040299-16040321 GCCAGCTGGGCTCCTCAGTCAGG - Intergenic
1004511730 6:16288705-16288727 GCCAGCTGGGCTCCTCAGTCTGG + Intronic
1004883775 6:20032760-20032782 GCCAGCTGGGCTCCAGAGTCTGG + Intergenic
1005706817 6:28463347-28463369 CCCAGCTGGTGTCCCCAAGCTGG - Intergenic
1006940757 6:37750769-37750791 TGCAGCTGGGCACCAGAGGCTGG + Intergenic
1009243339 6:61204810-61204832 GGCAGCTCCTCTCCACAGGCAGG + Intergenic
1010277877 6:73990576-73990598 GCCAGCTGGGCTCCAGAGTCTGG - Intergenic
1010617468 6:78030253-78030275 GCCAGCTGGGCTCCTGAGGCTGG + Intergenic
1012851069 6:104446736-104446758 GCCAGCTGGGCTCCTCAGTCTGG + Intergenic
1012983187 6:105851319-105851341 TCCAGATGGCTTCCTCAGGCAGG + Intergenic
1013467882 6:110433488-110433510 TCCTCCTTGTCTCCACAAGCAGG - Intronic
1013533986 6:111046794-111046816 TCCAGCTGCTCTCCACAGCCTGG + Intergenic
1016172857 6:141041534-141041556 ACCAGCTGGGCTCCTCAGTCAGG - Intergenic
1019003709 6:168778289-168778311 TGCAGCTGGACTCCACTGCCTGG - Intergenic
1019499718 7:1358830-1358852 CCCAGGTGTTCTCCACAGGACGG - Intergenic
1020842113 7:13231434-13231456 TTCTGCTGGTCTCCAAAGGAGGG - Intergenic
1021927318 7:25546016-25546038 TGCAGATGGTTTCCAGAGGCTGG + Intergenic
1023552733 7:41387515-41387537 TCCAGGTTGTCTCCACATGAGGG - Intergenic
1029435657 7:100562689-100562711 TCCCCTGGGTCTCCACAGGCAGG - Intronic
1029820163 7:103138995-103139017 TCCAGCTGCCTTCCCCAGGCTGG + Intronic
1031489320 7:122368252-122368274 TCTAGCTGGACTCTACAAGCTGG + Intronic
1033455989 7:141503955-141503977 TTCAACTGTTCTCAACAGGCTGG + Intergenic
1034858426 7:154576185-154576207 TCCCGCTGGTCTGCACAGCGTGG + Intronic
1035473579 7:159127324-159127346 TTCAGGTGGATTCCACAGGCGGG + Intronic
1036907625 8:12720403-12720425 TCCAGCTGGAGTCCACTGCCTGG + Intergenic
1037425529 8:18750953-18750975 GCCAGCTGGTCTCCTGAGTCTGG - Intronic
1038967666 8:32593442-32593464 ACAAGCTGGTCTCCACATCCTGG - Intronic
1043013495 8:74909502-74909524 TCCAGCTAGTGCCCACATGCTGG + Intergenic
1043709964 8:83403397-83403419 GCCAGCTGGTCTCCTGAGTCTGG + Intergenic
1044638876 8:94357267-94357289 TCCACCTGGTGACCAGAGGCTGG + Intergenic
1044774915 8:95678001-95678023 TGTAGCTCCTCTCCACAGGCAGG + Intergenic
1046005849 8:108482777-108482799 TCCAGCTGTATTGCACAGGCTGG + Intronic
1048550404 8:135428113-135428135 CCCATCTGGTATCCAGAGGCTGG + Intergenic
1049203611 8:141353273-141353295 ACCAGCAGGGCTCCACAGGGAGG - Intergenic
1049408943 8:142463981-142464003 TGCTGCTGGTGGCCACAGGCTGG + Exonic
1050080954 9:1915396-1915418 TCCGGCTGTTCTCCAGAGGAGGG - Intergenic
1050538657 9:6651367-6651389 TCTCGCTGGGCTCCCCAGGCTGG - Intergenic
1053489448 9:38488044-38488066 TCCAGCGGGTCGCCACACCCAGG + Intergenic
1055452452 9:76443188-76443210 CCGAGCTGGTCTTCACAGACGGG - Intronic
1056515483 9:87345360-87345382 TCTTGCTGTGCTCCACAGGCTGG - Intergenic
1056571513 9:87820793-87820815 TTCAGCTTGTCACCAAAGGCTGG + Intergenic
1057222449 9:93264495-93264517 TCAGGTTGGTCTGCACAGGCAGG - Intronic
1058077730 9:100667755-100667777 TGTAGCTCGTCTCCGCAGGCAGG - Intergenic
1058537671 9:105978714-105978736 TCCAGCTCCTCTCCACAGCTAGG + Intergenic
1060149121 9:121276377-121276399 CTCAGCTGGTCACCACAGGCTGG - Intronic
1061032178 9:128091973-128091995 GCCATCTGGTCTCTCCAGGCAGG - Intronic
1061225985 9:129281270-129281292 CCCAGCTGGTCTCCACCTGGAGG + Intergenic
1061998941 9:134206435-134206457 TGCAGCTGCTGTGCACAGGCAGG - Intergenic
1062264794 9:135682003-135682025 TCCCGCTGGCCTCCACGGGGAGG - Intergenic
1062275694 9:135729437-135729459 TCCTGCTGGGCTCCAGATGCGGG + Intronic
1192208943 X:69115097-69115119 TCCAGATGGTCTGGACAGGCAGG - Intergenic
1192340309 X:70258586-70258608 TGCAGCTGCTATCCTCAGGCAGG + Exonic
1194042219 X:88955808-88955830 TCCAGCTGGTCTCTCCATTCAGG - Intergenic
1195260435 X:103126284-103126306 TTCAACAGGTTTCCACAGGCGGG + Intergenic
1195379575 X:104257597-104257619 TCCAGCTGGTCTCTAACGCCTGG + Intergenic
1195872319 X:109499314-109499336 TCTAGCTGACTTCCACAGGCTGG + Intergenic
1196582766 X:117395130-117395152 GCCAGCTGGTCTCCTGAGTCTGG + Intergenic
1200888748 Y:8299066-8299088 TCCAGCTGGGCTCCTGAGTCTGG + Intergenic
1202266823 Y:23028334-23028356 TCCAGTTGGGTTTCACAGGCCGG - Intergenic
1202419816 Y:24662079-24662101 TCCAGTTGGGTTTCACAGGCCGG - Intergenic
1202450970 Y:25008005-25008027 TCCAGTTGGGTTTCACAGGCCGG + Intergenic