ID: 936683050

View in Genome Browser
Species Human (GRCh38)
Location 2:114797087-114797109
Sequence TGCCCACAAGAATACCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936683050 Original CRISPR TGCCCACAAGAATACCAAAC TGG Intronic
901943109 1:12679001-12679023 TGCCCAAAAGAATTGAAAACAGG - Intergenic
908966294 1:69768276-69768298 TGGCCACATGAATGCCAAACAGG + Intronic
913555112 1:119958336-119958358 TGTCCACAATCATACCAAATAGG + Intronic
919105742 1:193148310-193148332 TGCCAAAAAGAACCCCAAACTGG - Intronic
919123663 1:193371083-193371105 TGCCTGAAAGAACACCAAACAGG + Intergenic
919435956 1:197561361-197561383 AGCCAACAAGAATACCAAAGAGG - Intronic
920209284 1:204316346-204316368 TGCCCACAAGAAACCCAAGTAGG + Intronic
923800332 1:237202980-237203002 TGCCTCCAAGAATGGCAAACAGG - Intronic
924496122 1:244590925-244590947 TACCCACAATAATTCAAAACAGG - Intronic
1063250268 10:4265828-4265850 AGCCAACTAGAATATCAAACAGG - Intergenic
1064192940 10:13223264-13223286 TGCCCAAAAGAATTGAAAACAGG + Intronic
1064719548 10:18215126-18215148 TGCCCCCATGAATACCATACTGG - Intronic
1065701840 10:28433284-28433306 GGCCCACAAGGCTACCTAACTGG - Intergenic
1074018411 10:109559414-109559436 TGCCCCCAAGAATGCAGAACTGG - Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1089343778 11:117777342-117777364 TTCCCCTAAGAAAACCAAACCGG + Intronic
1090900487 11:131026576-131026598 TTCCCACAAGAAAAGCAATCTGG - Intergenic
1091767628 12:3132255-3132277 TGCTCAAAAGAATTGCAAACAGG - Intronic
1092752244 12:11729564-11729586 TGCCAACAGTCATACCAAACAGG - Intronic
1092932981 12:13334695-13334717 TGCCCACCAGAATTATAAACAGG + Intergenic
1093721660 12:22449889-22449911 TGCCTATAAGAACAACAAACAGG + Exonic
1093725616 12:22504936-22504958 TGACCACAAAAATAAGAAACGGG + Intronic
1093845861 12:23970766-23970788 TACCCAAAAGAATTGCAAACAGG - Intergenic
1095332781 12:40989011-40989033 TGGCTCCAAGAATAACAAACAGG + Intronic
1101549767 12:105751040-105751062 TGCTGAGAAGAATAACAAACTGG + Intergenic
1106293441 13:28387936-28387958 TCCCCACAAAAATTGCAAACAGG + Intronic
1107694209 13:42984786-42984808 TTCCCTCAAGCATAACAAACTGG + Intronic
1112221384 13:97494784-97494806 TGCCCACAAGAAAATCCTACGGG + Intergenic
1115626882 14:35202337-35202359 TGCCCTCAATAATAAAAAACAGG - Intronic
1116016362 14:39411892-39411914 TGACCACAATAATATAAAACTGG - Intronic
1119887139 14:78152583-78152605 TGCCCACACCAACACCAAAGTGG - Intergenic
1119952449 14:78759149-78759171 TGCCCACAAGAGTTACTAACTGG + Intronic
1120150926 14:81032744-81032766 TGCCACCAAGAATTCCAAATTGG + Intronic
1120195192 14:81474340-81474362 TGCACAAGAGAATACTAAACAGG + Exonic
1120514749 14:85457407-85457429 TGCCCAAGAGAATAACACACTGG + Intergenic
1121028066 14:90631293-90631315 TGCCCAAAAGAATTGAAAACAGG - Intronic
1124335312 15:28851267-28851289 TGACCACAAGAATAGAAACCAGG - Intergenic
1124419317 15:29505876-29505898 TGCCAACAAGAAAACAAAACTGG + Intronic
1127543362 15:59965481-59965503 TGCCACCAAGAATTCCAAATGGG + Intergenic
1131705992 15:94996942-94996964 TGCCCAAAAGAATTGAAAACAGG + Intergenic
1138055753 16:53831438-53831460 GGCTCACAAGAAGACCAAAGGGG + Intronic
1144520745 17:15950945-15950967 TGCCCACAAGGCTAGCACACTGG - Intronic
1147469084 17:40640507-40640529 TGCGCACAACAATACCATACAGG + Intronic
1150880806 17:69025071-69025093 TGCTATCAAGAATACCAAATAGG + Intronic
1154030066 18:10745826-10745848 TGCCCACTGGAATTCCCAACTGG + Intronic
1156135678 18:34034433-34034455 TCCACACAAGAAAACCAAAAGGG + Intronic
1157320972 18:46634083-46634105 TGCCCAAAAGAATTGAAAACAGG + Intronic
1159264954 18:66068824-66068846 TGACCACAATAGTACCTAACTGG - Intergenic
1159450863 18:68600143-68600165 TGCCCCCAGGAATACCATATGGG - Intergenic
1165477883 19:36042280-36042302 TACCCAAAAGAACACAAAACAGG + Intronic
1168082884 19:54023240-54023262 TACCCAAAAGAATTCCAAGCAGG - Intergenic
927604695 2:24476445-24476467 TGCTCACCATAATACCTAACAGG - Intergenic
930700111 2:54451188-54451210 TGCCCAAAAGAATGGAAAACAGG - Intergenic
932001816 2:67892229-67892251 TGCCCAAAAGAAAACCAGAGGGG + Intergenic
932377446 2:71250440-71250462 TGCCAACAAGAGAACAAAACTGG - Intergenic
932420213 2:71597058-71597080 TGGCCACAAGAAGACCAAATGGG - Intronic
935318246 2:101859168-101859190 TGCCCACAGCAAAACCAAAATGG - Intronic
936683050 2:114797087-114797109 TGCCCACAAGAATACCAAACTGG + Intronic
939277819 2:140023482-140023504 TGGCCCCAAGAATGCAAAACAGG - Intergenic
940623850 2:156148391-156148413 TGCCAGGAAGAATACCACACTGG + Intergenic
948774532 2:240276876-240276898 TTCCCACAGAAACACCAAACTGG + Intergenic
949047761 2:241879930-241879952 TGCCCACAGGAGTAGCATACAGG - Intergenic
1168991368 20:2098643-2098665 TTCCCATAAGAATTCCAAACTGG - Intergenic
1170479339 20:16749875-16749897 TGCCCAGAAGAATAGCAATCAGG - Intronic
1172194223 20:33081182-33081204 TTCCAACAAAAACACCAAACTGG - Intronic
1173807882 20:45937989-45938011 TGCCCACAACAAGACCACAAAGG - Intronic
1177526403 21:22296915-22296937 TGCACACAATAATACCTCACTGG + Intergenic
1178285130 21:31319288-31319310 TGCCCAAAAGAATTGAAAACGGG - Intronic
1179101480 21:38358840-38358862 TCCACACAAGAAGAGCAAACAGG - Intergenic
1179104766 21:38389009-38389031 TGCACCAAAGAAGACCAAACTGG - Intronic
949376058 3:3391711-3391733 AGGCCACAGGAATACCAAGCAGG - Intergenic
950225006 3:11226223-11226245 TGCCCACGAGATAAGCAAACAGG - Intronic
952985966 3:38783628-38783650 TGCCCATAAAAACCCCAAACCGG - Intronic
955541142 3:59977474-59977496 TGGCCACAATAATAGCAAAAAGG + Intronic
956481789 3:69680469-69680491 TGCCCAAAAGAATTAAAAACAGG + Intergenic
960866337 3:122203464-122203486 TGCCCACAAGAATTCAATACAGG - Intronic
962961296 3:140313857-140313879 TGCCCTCAATATTCCCAAACTGG - Intronic
970311916 4:14792130-14792152 AGCCAACAAGAATAAGAAACAGG + Intergenic
971354523 4:25883113-25883135 TGCCAGTAAGAATGCCAAACAGG + Intronic
971725113 4:30302120-30302142 TGCCCACAAGAAATCCTGACAGG - Intergenic
976330875 4:83829806-83829828 TGCCCACCACAATACCAGGCGGG + Intergenic
980078330 4:128317890-128317912 TGCCCACCAGAATACCCTAAAGG + Intergenic
982721939 4:158868705-158868727 TGCCTACAAGACTGCCAGACCGG + Exonic
982833161 4:160088884-160088906 TGTCCACAAGTATACACAACTGG + Intergenic
983840983 4:172456316-172456338 TGCCAACAAGGAAACAAAACTGG + Intronic
983890991 4:173030054-173030076 TGCCCATAAGAAAACAAAATTGG + Intronic
984143028 4:176026228-176026250 TGCCCAAAAGAATTAAAAACAGG + Intergenic
987537260 5:19205765-19205787 TCCCCTCAAGAATACCCAATTGG + Intergenic
989237758 5:39169339-39169361 TTCCCAGACGAATACTAAACCGG + Intronic
990086349 5:51982892-51982914 TGCCCATGAGAATACAAGACTGG - Intergenic
991400926 5:66250837-66250859 TGAGCACAAAAATACCAATCTGG + Intergenic
995018728 5:107343051-107343073 TGACTATAAGAAGACCAAACTGG + Intergenic
998699073 5:144676827-144676849 TGCCCCAAAGAATTGCAAACAGG + Intergenic
1000893031 5:166821626-166821648 TGTACCCAAGAATAACAAACAGG - Intergenic
1002078892 5:176726288-176726310 TGCCCTCAAGCATAATAAACAGG + Intergenic
1002445012 5:179285343-179285365 TGCCGACAAGAATGCCTCACGGG + Intronic
1003744958 6:8990343-8990365 TGCCTAGAAGAATACCTGACAGG - Intergenic
1013713821 6:112933686-112933708 TGCCAATCAGAAGACCAAACTGG - Intergenic
1014113505 6:117646695-117646717 TGCCAACAAGGAAACAAAACTGG + Intergenic
1019657289 7:2202634-2202656 TGCCCCAAAGAAAACCAAACCGG + Intronic
1021995984 7:26178782-26178804 TGCCCACAAGCATGGCAAACAGG + Intronic
1022556572 7:31304031-31304053 TGCCCAAAAGAATTAAAAACAGG - Intergenic
1024457614 7:49627218-49627240 TGTCCAAAAGAATACCAGAATGG - Intergenic
1024519217 7:50288821-50288843 TACCCAAAAGAATTCAAAACAGG + Intergenic
1025067202 7:55867616-55867638 TGCCCAAAAGAATAGAAAGCAGG - Intergenic
1035334632 7:158119856-158119878 TGCCCAAAAGAATTGAAAACAGG + Intronic
1036651637 8:10647827-10647849 TGCCCAGAAGAATTGAAAACAGG - Intronic
1037265212 8:17051557-17051579 TACCAGCAAAAATACCAAACAGG + Intronic
1041804382 8:61834204-61834226 TGCCCACATCAATATCAAGCTGG + Intergenic
1042717992 8:71795756-71795778 TGACCATCAGAATACCAAAGTGG + Intergenic
1053023530 9:34711975-34711997 TGCCCACAAGAAAAGCTAACGGG - Intergenic
1057136240 9:92690244-92690266 AGCTCAAAAGAATACCAAGCAGG - Intergenic
1057718209 9:97512229-97512251 TGCCCACCAGAATGGCTAACAGG + Intronic
1058515966 9:105776270-105776292 TGGCCAAATGAATATCAAACTGG + Exonic
1058703062 9:107616621-107616643 TGCCCACAAGGATGCCACAGAGG - Intergenic
1060353969 9:122886391-122886413 TACCCAAAAGAATAGAAAACAGG - Intronic
1060718856 9:125960445-125960467 TGGCCACAGTAATACCAAAACGG - Intronic
1060868697 9:127021766-127021788 TGCTCACAAGATTAACAAACTGG - Intronic
1062249543 9:135587372-135587394 TGCCCTCAGGAATAACACACTGG + Intergenic
1189907020 X:45771624-45771646 TTCACACAAGAGTAGCAAACAGG + Intergenic
1193976859 X:88131296-88131318 TGCCCACAAGAATAGCAATTTGG + Intergenic
1195203322 X:102571031-102571053 TGCCCACTAGAATACAAAGTAGG - Intergenic
1198296995 X:135296480-135296502 TGCCCACAAGAGTGCTGAACTGG - Intronic
1198794640 X:140382631-140382653 TGCCCACAGGAAAGCCAAACTGG + Intergenic
1200767605 Y:7093630-7093652 TGCCCACAGGAAAAACAAATGGG - Intergenic