ID: 936685352

View in Genome Browser
Species Human (GRCh38)
Location 2:114821076-114821098
Sequence AGAGGGAACTTCAAGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 963
Summary {0: 1, 1: 2, 2: 19, 3: 162, 4: 779}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936685342_936685352 17 Left 936685342 2:114821036-114821058 CCTGGTACACAGACAGAGGGAGG 0: 1
1: 4
2: 83
3: 153
4: 357
Right 936685352 2:114821076-114821098 AGAGGGAACTTCAAGTGCCAAGG 0: 1
1: 2
2: 19
3: 162
4: 779
936685349_936685352 -9 Left 936685349 2:114821062-114821084 CCTCCAAAGCCAAAAGAGGGAAC 0: 1
1: 0
2: 6
3: 26
4: 257
Right 936685352 2:114821076-114821098 AGAGGGAACTTCAAGTGCCAAGG 0: 1
1: 2
2: 19
3: 162
4: 779
936685341_936685352 18 Left 936685341 2:114821035-114821057 CCCTGGTACACAGACAGAGGGAG 0: 1
1: 1
2: 18
3: 104
4: 329
Right 936685352 2:114821076-114821098 AGAGGGAACTTCAAGTGCCAAGG 0: 1
1: 2
2: 19
3: 162
4: 779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936685352 Original CRISPR AGAGGGAACTTCAAGTGCCA AGG Intronic
900735624 1:4297826-4297848 AGTGGGGACGTCAAGTGCCCAGG + Intergenic
900827689 1:4939860-4939882 AGAGGCAACATCATGTGCTAAGG + Intergenic
901119735 1:6881427-6881449 AGAGGGAACTGCAAAAGCAAAGG + Intronic
901227108 1:7620051-7620073 AGAGGGAACTTCAAAGGCCTGGG - Intronic
901259354 1:7860327-7860349 AGATGGAACAGCGAGTGCCAAGG + Intergenic
901259777 1:7862839-7862861 AGAGGGAACAGCCAGTGCAAAGG - Intergenic
901677193 1:10892415-10892437 AGAGGCACCTGCAAGTGCAAAGG - Intergenic
901793844 1:11669001-11669023 TGTGGGAATTGCAAGTGCCAAGG - Intronic
901874578 1:12160023-12160045 AGAGGGAACTGCCAGTGCGAAGG + Intergenic
902154836 1:14476911-14476933 AGAGGGAACATGAGGTGCAAAGG - Intergenic
902205614 1:14866133-14866155 AGAGGGAACAGCAGGTGCAAAGG - Intronic
902229205 1:15016758-15016780 AGAGGGAAGGGCAAGTGCAAAGG - Intronic
902247998 1:15134444-15134466 AGAGGGAACAGCAAATGCAAAGG + Intergenic
902278937 1:15360346-15360368 AGAGGGAACTGCATGTGCTAAGG + Intronic
902433517 1:16381971-16381993 AGAGGGAACAGCAAATGCTAAGG + Intronic
902516831 1:16993984-16994006 AGAGGGAATCACATGTGCCAAGG - Intronic
902535045 1:17114809-17114831 AGAGGGAACAGCAACTGCAAAGG + Intronic
902539914 1:17147093-17147115 AGAGGGAACTGCATATGCAAAGG + Intergenic
902569883 1:17340514-17340536 AGAGGGAACGGCAAGTGCGTGGG + Intronic
902606144 1:17570422-17570444 AGTGGGAACAGCAAGTGCAAAGG + Intronic
902862008 1:19253298-19253320 AGAGGGAACCTGAAGTGAAAAGG + Intronic
903043648 1:20550754-20550776 AGAGGGAACCCCCAGTGGCAAGG + Intergenic
903063446 1:20685462-20685484 AGAGGGGATAGCAAGTGCCAAGG - Intronic
903299821 1:22370806-22370828 AGAGGGGACTGCAAGTGCAAAGG + Intergenic
903586425 1:24419042-24419064 AAAGGGAACATTAAGGGCCAGGG + Intronic
903682302 1:25105086-25105108 AGAGGGAACAGCATGTGCAAAGG - Intergenic
903772535 1:25772895-25772917 AGAGGGGACAGCAAGTGCAAAGG - Intronic
903790531 1:25889902-25889924 AAAGGGAACTGCTAGTGCCAAGG - Intronic
903853691 1:26322962-26322984 AGAGGGAACAGCCAGTGCAAAGG - Intronic
903960244 1:27052538-27052560 AAAGGGAAATTGAAGAGCCAAGG + Intergenic
904046086 1:27609318-27609340 AGAGGGAACAGCATGTGCAAAGG - Intergenic
904202567 1:28830827-28830849 AGAGGGAACAGCAAGGGCAAAGG + Intronic
904311250 1:29631014-29631036 AGAAGGAACTACAAGAACCAAGG - Intergenic
904362654 1:29987088-29987110 AGAGGGAACTGCAAGTGCAAAGG + Intergenic
904377692 1:30092054-30092076 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
904380555 1:30107662-30107684 AGAGGGAAGAGCAAGTGCAAAGG - Intergenic
904596561 1:31649983-31650005 AGAGGGAACAGCACGTGCCAAGG - Intergenic
904725184 1:32541367-32541389 AAAGGGAACGGCAAGTGCAAAGG - Intronic
904732388 1:32604537-32604559 AGAAGGAACATCATGTGCTAAGG - Exonic
904914899 1:33962677-33962699 AGAGGGAGCTGCAAGTACAAAGG - Intronic
905260616 1:36715624-36715646 AGAGGGAACAGCCAGTGCAAAGG - Intergenic
905398727 1:37685833-37685855 AGAGGAAACATCAAATGCAAAGG - Intronic
905451745 1:38061466-38061488 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
905527335 1:38649055-38649077 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
905574488 1:39032847-39032869 AGAGGAAACAGCAAGTGCAAAGG + Intronic
905799789 1:40835821-40835843 AGAGGGAACAGCAAGTGCCAAGG + Intronic
905937307 1:41834866-41834888 AGAGAGAACAGCAAGTGCAATGG + Intronic
906113009 1:43337168-43337190 AGAGGGCATTTCCAGTTCCAGGG + Intergenic
906447775 1:45918291-45918313 GGAGGCAACATGAAGTGCCAGGG + Intronic
906716596 1:47974313-47974335 AGAAGGAACAGCACGTGCCAAGG - Intronic
906815361 1:48873283-48873305 AGAGGGAACAACATGTGCAAAGG - Intronic
907058160 1:51391557-51391579 AGAGGGAACAGCTAGTGCAAAGG + Intronic
907324981 1:53631819-53631841 AGAGGGAACAGCCAGTGCCAAGG + Intronic
907462671 1:54614551-54614573 AGAGGGAACAGCATGTGCAAAGG + Intronic
907549329 1:55291027-55291049 AGAGGGAAACACATGTGCCATGG + Intergenic
907586397 1:55621525-55621547 AAAGGGAACTGCAGGTGCCAAGG - Intergenic
907701304 1:56790913-56790935 AGAGGGAATGGCAAGTGCAAAGG + Intronic
907866608 1:58405159-58405181 AGAGGAAACAGCAAGTGCAAAGG - Intronic
907885662 1:58590453-58590475 AGAGGGAACAACACGTGCAAAGG + Intergenic
908508118 1:64826440-64826462 ACAGGGAACAGCAAGTGCAAAGG + Intronic
908545025 1:65153825-65153847 AGAAGGAACAGCAAGTGCAAAGG + Intronic
908550674 1:65205953-65205975 AGAGGGAACAGTAAGTGCAAGGG - Intronic
908791514 1:67787310-67787332 AGAGGGAACAGCTTGTGCCAAGG + Intronic
908794726 1:67819801-67819823 AGAGGGAACAGCCAGTGCAAAGG - Intronic
908807329 1:67945046-67945068 AGAGGGAAGAGCAAGTGCAAAGG - Intergenic
909265452 1:73552084-73552106 AGAGGGAAAAGCAAGTGCAAAGG - Intergenic
910219034 1:84871775-84871797 AGAGGGAATGGCAAGTGCAAAGG - Intronic
910589121 1:88910508-88910530 AGAGGGAACTGCAAAGGCAAAGG + Intergenic
911147257 1:94564749-94564771 AGAGGGAACAGCAGGTGCCAAGG - Intergenic
911164043 1:94709364-94709386 AGAGGGAACAGCCAATGCCAAGG - Intergenic
911429775 1:97770074-97770096 AGAAGGAACTGCAAATGCAAAGG + Intronic
911662082 1:100512040-100512062 AGAGTGGACTGCAAGTGCTAGGG - Intronic
912641399 1:111349274-111349296 AGAAGGAACAGCAAGTGCAAAGG + Intronic
912720571 1:112016489-112016511 AGAGGGAACAGCAATTGCAAAGG - Intergenic
913223786 1:116680818-116680840 AGAGGGAACTGCAAGTTGCAAGG + Intergenic
913336548 1:117713964-117713986 ATAGGGAAGTTCAAGTGCAGGGG + Intergenic
913454273 1:119015096-119015118 AGAGGGAACATCAAATGCAAAGG - Intergenic
914792636 1:150892120-150892142 AGTGAGATCTGCAAGTGCCAGGG + Intergenic
915592393 1:156878182-156878204 AGAGGGAACTGGAAGTACAAAGG - Intronic
916036875 1:160930019-160930041 AGAGGGAATAGCAACTGCCAAGG - Intergenic
916239384 1:162623794-162623816 AGAGGGGGCAGCAAGTGCCAAGG + Intergenic
916611075 1:166392359-166392381 AGAGGGAAGAGCCAGTGCCAAGG + Intergenic
916623154 1:166523920-166523942 AGAGGGAACAGAAAGTGCAAAGG + Intergenic
917576848 1:176331666-176331688 AGAGAAAACTTTAAGTGTCATGG + Intergenic
918095318 1:181329550-181329572 AGAGGGAACAGCATGTGCAAAGG - Intergenic
918338646 1:183548158-183548180 TAAGGGAACTTCAAGTGCCAGGG - Intronic
918551717 1:185749892-185749914 AGAGGGAACTGCAAGGGCAATGG - Intronic
919516575 1:198532757-198532779 AGAGGGAACAGCAAGTGCAGAGG + Intronic
919685678 1:200481579-200481601 AGAGGGAACAGGAAGTGCAAAGG + Intergenic
920033772 1:203052505-203052527 AGAGGGAACTCCTAGTCTCAGGG + Intronic
920216667 1:204365994-204366016 AGGGGGAACAGCAAGCGCCAAGG + Intronic
920757978 1:208753363-208753385 AGAGGGAATAGCAAGGGCCAAGG + Intergenic
922022668 1:221720029-221720051 AGAGGGAACAGCAAATGCAAAGG - Intronic
922421604 1:225464244-225464266 TGAGGGCACTTCACGTTCCAGGG + Intergenic
922542125 1:226427505-226427527 AGAGGGAACAGCAAGAGCTAAGG - Intergenic
923664692 1:235989808-235989830 AGGGGGAACTGCAAGTGCAAAGG + Intronic
924101575 1:240608818-240608840 AGAGGGCACTTCAAGTTGGAGGG + Intronic
1062894397 10:1091847-1091869 AGGGGGAAGGTGAAGTGCCAGGG + Intronic
1064379903 10:14832241-14832263 AGAAGGAACAGCAAGTACCAAGG + Intronic
1064970657 10:21063159-21063181 AGAGGGCCATTTAAGTGCCAGGG - Intronic
1065200508 10:23308581-23308603 AGAGGGAACTCCAAGTACAAAGG - Intronic
1065915928 10:30355014-30355036 AGAGAGAACTGCATGTGCAAAGG + Intronic
1067559508 10:47295108-47295130 AGTGGGATTGTCAAGTGCCATGG - Intergenic
1069347994 10:67492736-67492758 AGAGGGAACAGCAAGTACTAAGG + Intronic
1069785984 10:70988238-70988260 AGAAGGAACTACAAGTGCAGAGG - Intergenic
1069862128 10:71478361-71478383 AGAGGGAACTGCAGGTGCAAAGG - Intronic
1070116812 10:73536749-73536771 TGAGGGAACTTCAGCTGCCTTGG + Intronic
1070345751 10:75540269-75540291 AGAGGGAACAGCAAGTGAAAAGG + Intronic
1070395101 10:76005479-76005501 AGCTGGAACTACATGTGCCAAGG - Intronic
1070794861 10:79210576-79210598 AGAGGGAACTGCTAATGCAAAGG + Intronic
1070829559 10:79410096-79410118 AGAGGGAACAGCAAGTGCAGAGG - Intronic
1071482829 10:86078059-86078081 AGAGGGAACTGGCAGTGCCAGGG + Intronic
1071589830 10:86862328-86862350 ATAGGGATCTGCACGTGCCAGGG + Intronic
1072612588 10:97028534-97028556 AGAGGGAACAGCATGTGCAAAGG - Intronic
1072744810 10:97932641-97932663 AGAGGGAACAGCAAGTACGAAGG + Intronic
1072800552 10:98389615-98389637 AGAGGGAAGGTCAGGTGCAAAGG - Intronic
1073426430 10:103458143-103458165 AGAGGGACCTTGATCTGCCAGGG + Intronic
1073474005 10:103741192-103741214 AGAGGAAACTACAACAGCCAAGG + Intronic
1073489238 10:103841698-103841720 AGAGGGAACAACAGGTGCCAAGG - Intronic
1074098987 10:110338736-110338758 AGAGGGAACTGCAAATACAAAGG + Intergenic
1074256760 10:111810787-111810809 AGAGGGCACAGCAAGTGCAAAGG + Intergenic
1074298267 10:112210833-112210855 AGAGGGAACATCATGAGCCTGGG + Intronic
1074727652 10:116329381-116329403 AGAGGAAACAGCAAGTGCAAAGG - Intronic
1074779446 10:116790517-116790539 AAAGGGAACAGCAAGTGCAAAGG - Intergenic
1075067414 10:119298800-119298822 AGAGGGAACAGCATGTGCAAAGG - Intronic
1075552122 10:123400434-123400456 AGAGGGAAAGGCAAGTGCAAGGG - Intergenic
1075997688 10:126891796-126891818 TGAGGGAACAGCAAGTGCAAAGG - Intergenic
1077200734 11:1306285-1306307 AGAGGGAGCTTCAGGGGCCCGGG - Intronic
1077976827 11:7255217-7255239 AGAGGGAACAGCAAGCGCAAAGG + Intronic
1078179560 11:8999730-8999752 AGAAGGAACAGCAAGTGCAAAGG - Intronic
1079122731 11:17696839-17696861 AGAGGGAACAGCAGGTGCAAAGG - Intergenic
1079160045 11:17983892-17983914 AGAGGGAATATCAGGTGCAAAGG + Intronic
1080046862 11:27817946-27817968 AGAGGGAAGAGCAAGTGCAAAGG - Intergenic
1080469208 11:32528693-32528715 AGAGGGAACAGCATGTGCAAAGG - Intergenic
1080469320 11:32529740-32529762 AGAGGGAACAGCATGTGCAAAGG + Intergenic
1080634832 11:34114618-34114640 AGTGGGAACAGCAAGTGCCGAGG - Intronic
1080771273 11:35344383-35344405 AGAAGGAACAGCAAGTGCAAAGG + Intronic
1081541075 11:44035025-44035047 AGAGGGAATGCCAAGTGCAAAGG - Intergenic
1081583554 11:44369039-44369061 AGAGGGAATTGCAGGTGCAAAGG + Intergenic
1081693107 11:45091811-45091833 AGAAGGAACAGCAGGTGCCAAGG + Intergenic
1082009955 11:47442969-47442991 AGAGGGAACAGCCAGTGCAAAGG + Intronic
1082893485 11:58164867-58164889 AGAGGGAACAGCAAATGCAAGGG - Intronic
1083227062 11:61291900-61291922 AGCAGGAACTGCAAGTGCAAAGG - Intronic
1083275034 11:61592113-61592135 AGAGGGAACAGCCAGTGCAAAGG + Intergenic
1083687074 11:64382908-64382930 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1083746295 11:64738826-64738848 AGAAGAAACTACAAGTGGCAAGG + Intronic
1084106972 11:66986559-66986581 AGAGGGAACGGCAGGTGCAAAGG + Intergenic
1084178794 11:67436598-67436620 AGAGGGAACAGCCAGTGCGAAGG - Intronic
1084614985 11:70229813-70229835 ACAGGGAACAGCAAGTGCAAAGG + Intergenic
1084914873 11:72421210-72421232 AGAGGGAACCCCACCTGCCATGG - Intronic
1084959259 11:72707699-72707721 AGAGGGAACAGCATGTGCAAAGG + Intronic
1085083820 11:73653702-73653724 AGAGGGATCAGCATGTGCCAAGG + Intronic
1085084245 11:73656092-73656114 AGAGGGAACAGCATGTGCGAAGG - Intronic
1085200085 11:74696677-74696699 AGGAGGAACTGCAAGGGCCAGGG + Intronic
1085287689 11:75374844-75374866 AGAGGGAACAGCAAGGGCCAAGG + Intergenic
1086204450 11:84241045-84241067 AGAGGGAAGTGCAAGTACAAAGG - Intronic
1086308484 11:85508361-85508383 AGAGGGAATAGCAAGTGCAAGGG - Intronic
1086965738 11:93026159-93026181 AGAGGGAACTGCAAAAGCAAAGG + Intergenic
1087212385 11:95457303-95457325 AGAGGAAACATCAAATGCAATGG - Intergenic
1087883581 11:103449120-103449142 AGAGGGAACAGCAAGTGCCATGG + Intronic
1088249144 11:107847774-107847796 GGAGGGAACTACAGGTGCAAAGG + Intronic
1088258008 11:107918964-107918986 AGAGGGAACAGCAACTGCAAAGG + Intronic
1088515626 11:110630133-110630155 AGAGGGAACAGCAGGTGCAAAGG - Intronic
1088611191 11:111578619-111578641 AAAGGGAACTTTAAGTGATAAGG - Intergenic
1088891047 11:114044452-114044474 AGGGGGAGCAGCAAGTGCCAAGG + Intergenic
1088902237 11:114127068-114127090 AGGGGGAACTGCAAGAGCCAGGG - Intronic
1088926427 11:114307743-114307765 AGAGGAAACCGCAAGTGCAAAGG - Intronic
1089133753 11:116233006-116233028 AGAGGGAACAGCATGTGCAAAGG - Intergenic
1089646658 11:119884819-119884841 AGAGGAAACAGCAAGTGCAAAGG - Intergenic
1090086917 11:123658310-123658332 AGAGGGGACATCAAATGCTAAGG - Intergenic
1090197257 11:124827279-124827301 AGAGGGAATAGCAAGTGCCAGGG - Intergenic
1090968659 11:131620606-131620628 AGAGGGAACAGCAGGTGCCAAGG - Intronic
1090987363 11:131780654-131780676 AGAGGGAAAATCAAGTGCCATGG - Intronic
1091405863 12:209137-209159 ACAGGGAACGGCAGGTGCCAAGG - Intronic
1091679879 12:2519590-2519612 ACAGGGAAATTGAAGTGCCGTGG + Intronic
1091816316 12:3441440-3441462 AGAAGGAACAGCAAGTGCAAAGG - Intronic
1091989094 12:4940174-4940196 AGAGGGCACAGCAAGTGCAAGGG + Intergenic
1092219284 12:6701590-6701612 TGAGGGAACAGCAAGTGCAAAGG - Intergenic
1093489506 12:19688782-19688804 AGAGGGAACAACCAGTGCCAAGG - Intronic
1093878203 12:24374588-24374610 AGGGGGAACCTCAAGTCCAAAGG + Intergenic
1093980716 12:25472305-25472327 AGTGAGAACTCCAAGTGCAATGG + Intronic
1095178121 12:39116866-39116888 AGTGGGAACTTCAAGGCCAAAGG - Intergenic
1095477018 12:42596033-42596055 AGAGGGAACATCATGTGTAAAGG + Intergenic
1095939055 12:47713864-47713886 AGAGGGAACTGCAAGAGCAAAGG + Intronic
1096317940 12:50585052-50585074 AGAAGGAACAGCAAGTGTCAAGG - Intronic
1096388542 12:51211806-51211828 AGAAGGAACAGCAAGTGCTAAGG + Intronic
1096860607 12:54524980-54525002 AGAGGAAACAGCAAGTGCAAAGG + Intronic
1097312369 12:58134143-58134165 AGAGGGAACTGCATGTGCAAAGG - Intergenic
1097924346 12:65111022-65111044 AGAGGAAACTTCACGTGCAAAGG + Intronic
1098094197 12:66937107-66937129 AGAGGGAACAGCAAGTGCGAAGG - Intergenic
1098139562 12:67437864-67437886 TAAGGGAACATCAAGTGCAAGGG + Intergenic
1098878422 12:75891395-75891417 AGAGGAAACTTCAGGGGCAAGGG - Intergenic
1099257629 12:80333845-80333867 AGAGGGACCAGCAAGTGCAAAGG + Intronic
1100004928 12:89883486-89883508 AGAGTGAACATTAATTGCCAAGG + Intergenic
1100591684 12:96035689-96035711 TGAAGGAACTACAAGTTCCATGG + Intronic
1100678913 12:96897897-96897919 AGAGGGAGCAGCAAGGGCCAAGG + Intergenic
1100895049 12:99172119-99172141 AGAGGGAACAGCATGTGCAAAGG + Intronic
1101360373 12:104020769-104020791 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1101421406 12:104554319-104554341 AGAGGGAACAGCATGTGCAAGGG + Intronic
1101733198 12:107443494-107443516 AGAGAGAACAGCAAGTGCAAAGG + Intronic
1102189563 12:110976761-110976783 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1102198524 12:111041713-111041735 AGAGGGAACACCCAGTGCCAGGG + Intronic
1102204366 12:111080126-111080148 AGAGGGAACAGCCAGTGCAAAGG - Intronic
1102205749 12:111089718-111089740 AGAGGGAACAGCAAGTACAAAGG + Intronic
1102360930 12:112286927-112286949 AGAGGGAATAGCAAGTACCAAGG - Intronic
1102372311 12:112392380-112392402 AGGGGGAACAGCAAGTGCAAAGG - Intergenic
1102380925 12:112466299-112466321 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1102403075 12:112647748-112647770 AGAGGGAACTGCAGGTGCAAAGG + Intronic
1102404115 12:112657935-112657957 AGAGGGAACAGCCAGTGCAAAGG + Intronic
1102426158 12:112845958-112845980 AGGGGGAACAGCAAGTGCAAAGG + Intronic
1102528309 12:113527760-113527782 AGAGGGAACAGCATGTGCAAAGG - Intergenic
1102573657 12:113842846-113842868 AGAGGGAACAGCATGTGCAAAGG + Intronic
1102730867 12:115108216-115108238 AGAGGGAAAAGCAAGTGCAAGGG - Intergenic
1103042944 12:117710901-117710923 AGAGGGAACGGCATGTGCAAAGG - Intronic
1103189478 12:118988935-118988957 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1103267005 12:119639066-119639088 AGAGGGAACGGCAAGTGCAGAGG - Intronic
1103393666 12:120591774-120591796 AGAGGGAACTGCTTGTGCTAAGG + Intergenic
1103954879 12:124570360-124570382 AGACGGAACAGCAAGTGCAAAGG - Intergenic
1103955724 12:124575795-124575817 AGAGGGAACCACCAGTGCAAAGG + Intergenic
1104010322 12:124925628-124925650 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1104047020 12:125170664-125170686 AGAGGGAACAGCGAGTGCAAAGG + Intergenic
1104085806 12:125473185-125473207 AGGGGGAACAGCAAGTGCAAAGG - Intronic
1104278509 12:127352630-127352652 AGAGGGAACTGCAAATGTAAAGG - Intergenic
1104516502 12:129431900-129431922 AGAGGAAACTGCAAGTGCAAAGG - Intronic
1105325830 13:19370110-19370132 AGCGGGAACATCACATGCCAAGG + Intergenic
1105700205 13:22930035-22930057 AGAGGGAGCTTAAAGGGCTAGGG - Intergenic
1105867676 13:24474984-24475006 AGCGGGAACATCACATGCCAAGG - Intronic
1105914446 13:24900215-24900237 AGAAGGAGCAGCAAGTGCCAAGG + Intronic
1106405672 13:29470835-29470857 AGAAGGAACTGCAAGTACCAAGG - Intronic
1106470385 13:30049192-30049214 AGAGGGAACAGTAAGTGCCAAGG + Intergenic
1106657256 13:31759483-31759505 AAAGGCAACATCAAGTGCAAAGG + Intronic
1107560597 13:41553825-41553847 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1107898300 13:44987998-44988020 AGAAGGAACTGCAAGTGCAAAGG - Intronic
1108091000 13:46849604-46849626 AGTGGGAACAGCAAGTCCCAAGG - Intronic
1108232958 13:48369681-48369703 AGAGGGAATATCAAGTACGAGGG - Intronic
1108476104 13:50819250-50819272 AGAGGGAAGAGCAAGTGCAAAGG + Intronic
1108519221 13:51230884-51230906 AGAGGGAACCTCAGCTGCGAAGG - Intronic
1110228171 13:73141429-73141451 CCAGGGAACTTCGAGAGCCAGGG + Intergenic
1110882329 13:80587442-80587464 AGAGGAAACAGCAAGTGCAAAGG + Intergenic
1112202096 13:97286720-97286742 GGAGGGAACAGCCAGTGCCAAGG - Intronic
1115449725 14:33532593-33532615 AGAGAGAACTTCCAGAGTCAGGG - Intronic
1116748057 14:48846951-48846973 TGAGGAAACTTCAGGGGCCAAGG - Intergenic
1117593942 14:57307167-57307189 GGAGGGAAGCTCAAGTTCCAGGG - Intergenic
1118151849 14:63198047-63198069 AAAGGGAAATCCAAGTCCCAGGG + Intergenic
1118168492 14:63361441-63361463 AGAGGAAACAGCAAGTGCAAAGG + Intergenic
1118202306 14:63687648-63687670 AGAGGGAATATCAAGTGCAAAGG + Intronic
1118466285 14:66034175-66034197 ATTGGAAACTTCAGGTGCCAAGG + Intergenic
1118891857 14:69916622-69916644 AGAGGGAACAGCAAGGGCAAAGG - Intronic
1118916226 14:70108889-70108911 AGAGGGAACATCATTTGCAAAGG - Intronic
1119215003 14:72862682-72862704 AGAGGGAACAGCAGGTGCAAAGG - Intronic
1119215950 14:72869119-72869141 AGAGGGAATAGCATGTGCCAAGG - Intronic
1120350782 14:83355312-83355334 AGAGGAAACATCAAGTGTAAAGG + Intergenic
1120681058 14:87480990-87481012 AAAGGGAACAGCAAGTGCAAAGG + Intergenic
1120765035 14:88321192-88321214 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1120801142 14:88690071-88690093 AGAGGGAGCAGCAAGTGCAAAGG + Intronic
1120844779 14:89116175-89116197 AGAGGGAAGAGCAAGGGCCAAGG - Intergenic
1120879073 14:89400726-89400748 AGAGAGAACAGCAAGTGCAAAGG - Intronic
1121198772 14:92099133-92099155 AGAGAGAACTTGGAGGGCCAAGG - Intronic
1121435425 14:93916064-93916086 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1122149697 14:99718243-99718265 AGAGGGAACAGCATGTGCCAAGG - Intronic
1122179228 14:99943598-99943620 AGAGGGAAATTCAAGAGCACAGG + Intergenic
1122217348 14:100213037-100213059 AGAGGGAACAGCATGTGCAAAGG + Intergenic
1122218757 14:100221997-100222019 AGAGGGAACCACATGTGCTAAGG + Intergenic
1122580591 14:102769217-102769239 AGAGGGAACAGCAGGTGCCAGGG + Intergenic
1123425496 15:20167639-20167661 AGAGGGAACTGCAAGTGTTGAGG - Intergenic
1123534718 15:21174157-21174179 AGAGGGAACTGCAAGTGTTGAGG - Intergenic
1123722451 15:23071528-23071550 AGAGGGAACAGCAAGTCCAAAGG + Intergenic
1124039347 15:26085862-26085884 AGAGGGAAATTCAAATTCAAAGG - Intergenic
1124695037 15:31857432-31857454 AGAGGGGACTACGAGTGCCCAGG - Intronic
1124858499 15:33413928-33413950 AGAGGGAATTCCAAGTACGATGG + Intronic
1125355319 15:38811664-38811686 AGAGGGAGGCTTAAGTGCCATGG + Intergenic
1125747900 15:42009765-42009787 AGAGGGAGCTACATGTGCAAAGG - Intronic
1126559253 15:50025468-50025490 AGAGGGAAAATCATGTGCAAAGG - Intronic
1126658423 15:51006419-51006441 AGATGGAGCTTCAAGTCTCAGGG - Intergenic
1126700450 15:51362104-51362126 AGAGGGAATAGCAAGTGCAAAGG + Intronic
1127247916 15:57198051-57198073 AGAGGGGAATTCAAATGACAGGG - Intronic
1127492646 15:59479656-59479678 CGAGGGCAGTTCAAGTTCCAAGG + Intronic
1128242186 15:66108647-66108669 AGAGGGAACAGGAACTGCCAAGG + Intronic
1128251696 15:66168222-66168244 AGAGGGAAGTGCATGTGCAAAGG - Intronic
1128369864 15:67032778-67032800 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1128961706 15:72013354-72013376 AGAGGGCCCTACAAATGCCAAGG + Intronic
1129168495 15:73793387-73793409 AGAGGGAACAGCCAGTGCAAAGG - Intergenic
1129682519 15:77665790-77665812 AGAGGGAACTGCCTGTGCAAAGG - Intronic
1129815822 15:78552766-78552788 AGAAGGAACTGCACGTGCAAAGG + Intergenic
1129960480 15:79680312-79680334 AGAGGGAACAGCCAGTGCAAAGG + Intergenic
1129991178 15:79964895-79964917 AGAGGGAGCAGCAAGTGCAAAGG + Intronic
1130054385 15:80509762-80509784 AGAGGGAATAGCAAGTGCAAAGG + Intronic
1130122496 15:81063142-81063164 AGAGGGAATAGCAAGTGCAAAGG - Intronic
1130446806 15:84009790-84009812 AGAGGGAACAGCAAGTACCTTGG - Intronic
1130614339 15:85390397-85390419 GGAAGGAACATCAAGTGCAAAGG + Intronic
1130885591 15:88090028-88090050 AGAGGGAGCTGCTAGTGCAAAGG - Intronic
1131116679 15:89800192-89800214 AAAGGGAATAGCAAGTGCCAGGG - Intronic
1131393669 15:92069699-92069721 AGAGGGAAGGGCAAGTGCAAAGG - Intronic
1131439272 15:92446790-92446812 GGAGGGAACCTTAAGTGCAAAGG + Intronic
1131846900 15:96497674-96497696 AGAGGGGACATCAGTTGCCAAGG - Intergenic
1131894420 15:97010616-97010638 ACAGGAAGCTTCAAGTGGCAAGG - Intergenic
1132993256 16:2808352-2808374 AGAAGGAACAGCATGTGCCAGGG + Intergenic
1133055831 16:3145069-3145091 AGAGGGAACTGCTTGGGCCAAGG - Intronic
1133386949 16:5377431-5377453 AGAGGGAACAGAAAGTGCAAAGG + Intergenic
1133906322 16:10025888-10025910 AGAGGAAACTTCCACTGCCTCGG - Intronic
1134013052 16:10869341-10869363 AGAGGGAACGGCATGTGCAAAGG - Intergenic
1134059765 16:11192160-11192182 AGAGGGAACAGCCAGTGCAAAGG + Intergenic
1134754375 16:16653150-16653172 AGAGGGAATAGCAAGTGCAAAGG + Intergenic
1134818604 16:17227317-17227339 AGAGGCAACTGCATGTGCAAAGG + Intronic
1134855625 16:17516377-17516399 AGAGGGAACAGCAGGTGCAAAGG - Intergenic
1134991686 16:18705884-18705906 AGAGGGAATAGCAAGTGCAAAGG - Intergenic
1135004455 16:18806643-18806665 AGATTGAACTTCAATTTCCAAGG + Exonic
1135535943 16:23294581-23294603 AGAGGGAACAGCAAGGGCAAAGG - Intronic
1135619680 16:23945078-23945100 AGAGGGGACTTCTAGGGACATGG + Intronic
1135641315 16:24122205-24122227 AGAGGGAACAGCAGGTGCAAAGG + Intronic
1135651501 16:24210350-24210372 AGAGGGAGCAGCAAGTGCAAAGG - Intronic
1135665448 16:24331803-24331825 AGAGGAAACTGCAAGTGCCAAGG - Intronic
1136015740 16:27399645-27399667 AGAAGGATCTGCAAGTGCAAAGG - Intergenic
1136020378 16:27436339-27436361 AGAGGGCACTGCCAGTGCAAAGG + Intronic
1136073171 16:27801089-27801111 AGAGAGAACAGCAAGTGCAAGGG + Intronic
1136596390 16:31253119-31253141 AGAGGGAACAGCCAGTGCCATGG + Intergenic
1137631887 16:49952404-49952426 AGAGGGACCTTCAGGTGACAAGG - Intergenic
1137706855 16:50541388-50541410 AGAGGGAACAGCATGTGCAAAGG - Intergenic
1137797712 16:51236220-51236242 AGAGGGCACAGCAAGTGCAAAGG - Intergenic
1137944758 16:52723209-52723231 AGAGGGAACTACAAGTGAGAAGG - Intergenic
1138122911 16:54414818-54414840 AAAGGGAACCGCAAGTGCAAAGG + Intergenic
1138158093 16:54724896-54724918 AGAGGAAAGTGCAAGTGCAAAGG - Intergenic
1138369760 16:56517407-56517429 AGAGGGATCTGCAGGTGCAAGGG - Intronic
1138371506 16:56530655-56530677 GGAGGGAACTGTAAGTGCCAAGG - Intergenic
1138509742 16:57501566-57501588 AGAGGGAACTGCACGTGTAAAGG + Intergenic
1139314843 16:66059375-66059397 AGAAGGGACTGCAAGTGCAAAGG - Intergenic
1139348674 16:66321681-66321703 AGAGGAAACTGCAAGAGCAAAGG + Intergenic
1139403907 16:66703337-66703359 AGAGGGAACAGCATGTGCCAAGG + Intergenic
1139514460 16:67445124-67445146 AGAGGGAACAGCATGTGCAAAGG + Intronic
1139690422 16:68638223-68638245 AGAGGGAACGGCAAGTGCAAAGG + Intronic
1139747834 16:69088762-69088784 AATGGGAACAGCAAGTGCCAAGG + Intergenic
1139829858 16:69788528-69788550 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1140014772 16:71171180-71171202 AGCGGGAACAGCAAGTGCAAAGG - Intronic
1140128135 16:72134694-72134716 AGAGGGAATAGCAAGTGCAAAGG - Intronic
1140278707 16:73534239-73534261 AGAGAGAACTGCAAGTACAAAGG - Intergenic
1140412948 16:74752484-74752506 AGAGGGAACAGCAGGTGCAAAGG - Intronic
1140733182 16:77874540-77874562 AGAGGGAACAGCATGTGCAAAGG - Intronic
1141133792 16:81452625-81452647 AGAGGGAACAGCAATTGCAAAGG + Intronic
1141673095 16:85503094-85503116 AGAGGGCACGGCCAGTGCCAAGG + Intergenic
1143037115 17:4005627-4005649 AGAGGGATCTTCAGAGGCCACGG + Exonic
1143327158 17:6106875-6106897 AGGGGGAACAGCAAGTGCAAAGG + Intronic
1143439594 17:6959194-6959216 AGAGGGAACTCCAGGTACAAAGG - Intronic
1143622789 17:8090571-8090593 AGAGGGAACAGCATGTGCCAAGG - Intergenic
1143828415 17:9631524-9631546 AGAGGGAATAGCAAGTGCAAAGG + Intronic
1144035916 17:11365984-11366006 AGAGGGAACTGCAAGTGCAAAGG + Intronic
1144628420 17:16857334-16857356 AGAGGGAACTGCAGCTGCAAAGG - Intergenic
1144755888 17:17680615-17680637 AGAAAGAACATCAAGTGCAAAGG - Intergenic
1145110008 17:20154433-20154455 AGAGGGAACACCAAGTGCAAAGG + Intronic
1145160009 17:20567905-20567927 AGAGGGAACTGCAGCTGCAAAGG - Intergenic
1145241918 17:21245166-21245188 AGAGGGAACAGCCAGTGCAAAGG + Intronic
1145262703 17:21364366-21364388 AGAGGGAGCAGCAAGTGCAAAGG + Intergenic
1145303813 17:21658880-21658902 AGAATAAACTTCAAGTTCCAAGG + Intergenic
1145346221 17:22042944-22042966 AGAATAAACTTCAAGTTCCAAGG - Intergenic
1145764938 17:27452101-27452123 AGTGGGAACATCATGTGCAAAGG - Intergenic
1146184781 17:30717625-30717647 AGAGGGAACAGCACGTGCAAAGG - Intergenic
1146291079 17:31607732-31607754 AGAGGGAACTGCAAATGCAAAGG + Intergenic
1146467366 17:33096827-33096849 GGAGGGAACAGCAAGTGCCAAGG + Intronic
1146480326 17:33200022-33200044 AGAGGGAACAGCATGTGCAAAGG - Intronic
1146570684 17:33950189-33950211 AGAGGGAAATTGAAGTTCCCAGG - Intronic
1146651702 17:34611154-34611176 AGAGGGAACAGCATGTGCAAAGG + Intronic
1146662876 17:34676319-34676341 AGAGGGAACTGCAATTGCAAAGG - Intergenic
1147392412 17:40118359-40118381 AGAGGGAACAGCAACTGCAAGGG + Intergenic
1147444187 17:40464764-40464786 AGAGGGAACAGCACGTGCAAAGG - Intergenic
1148028273 17:44603137-44603159 AGAGGGAACAGCAAGTGAAAAGG + Intergenic
1148717409 17:49725607-49725629 AGAGGGAACAGCCAGTGCAAAGG + Intronic
1149280420 17:55098574-55098596 AGAGGGAACAGCAAGTGGAAAGG + Intronic
1149357167 17:55852186-55852208 AGTGTGAAATTCAAGTGCAATGG + Intergenic
1149637364 17:58181643-58181665 AGAGGAAACAGCAAGTGCAATGG + Intergenic
1150007024 17:61476354-61476376 AGAGGGACCTGCATGTGCAAAGG + Intronic
1150098420 17:62399616-62399638 AGAGGGAAAAGCAAGTGCAAAGG - Intronic
1150558870 17:66277880-66277902 AAAGGGAAGTGCAAGTGCAATGG + Intergenic
1150839265 17:68592878-68592900 AGAGGCAAAGTCAAGTCCCAGGG - Intronic
1151178350 17:72307498-72307520 AGAGGGAACAGAAAATGCCATGG - Intergenic
1151252270 17:72845401-72845423 AGAGGGAACAGCCAGTGCAAAGG - Intronic
1151323913 17:73367422-73367444 AGAGGGAACCGCAGGTGCTAAGG - Intronic
1151440073 17:74122761-74122783 AGAGGGAAGAGCAAGTGCAAAGG - Intergenic
1151966386 17:77433813-77433835 ACAGGCAACATCAAGTGCCTGGG - Intronic
1152030500 17:77839271-77839293 ACAGGGAACTGCAAGTGTCAAGG - Intergenic
1152298222 17:79480658-79480680 AGAGGGAATGGCCAGTGCCAAGG - Intronic
1152869027 17:82741622-82741644 AGAGCGAGCCTCAAGTGCAAAGG + Intronic
1153116203 18:1659491-1659513 GGAGGGAACTTCCAGTGAAAGGG + Intergenic
1153243830 18:3054425-3054447 AGAGGGCACAGCAAGTGCAAAGG - Intergenic
1153671258 18:7414668-7414690 AAAGGGAACAGCATGTGCCAAGG + Intergenic
1154405498 18:14086376-14086398 AGGGGGATCCTCAAGTTCCACGG - Intronic
1155134478 18:22974881-22974903 AGAGGGTACTTCATGTACTAGGG - Intronic
1155530909 18:26765532-26765554 AGAAGGAACAGCCAGTGCCAAGG + Intergenic
1157508373 18:48248393-48248415 AGAGGGAACAGAAAGTGCAAAGG - Intronic
1157737334 18:50061764-50061786 AGAGTGAACCTCAGGAGCCAAGG + Intronic
1158209398 18:55030120-55030142 AGAGAGAACTTCATGAGCAAAGG + Intergenic
1158261380 18:55609756-55609778 AGAGCGAACAGCAAGTGCAAAGG - Intronic
1158555665 18:58472683-58472705 AGAGGGAATAGCAAGTGCAAAGG + Intergenic
1160059488 18:75516296-75516318 AGAGGGAACAGCAAGTGCGAAGG + Intergenic
1160659829 19:292664-292686 TGAGGGAACTCCAAGGGCAAGGG + Intergenic
1160901158 19:1429392-1429414 AGAGGGAACGGCAGGTGGCAAGG - Intronic
1161245835 19:3251381-3251403 AGAGGGCACAGCATGTGCCAAGG + Intronic
1161246791 19:3257214-3257236 AGAGGGAACGGCCAGTGCAAAGG + Intronic
1161350842 19:3790668-3790690 AGAGGGAACAGCCAGTGCAAAGG - Intronic
1161496255 19:4587525-4587547 AGTGGGAACAGCAAGTGCCAAGG - Intergenic
1161536363 19:4821489-4821511 AGAGGGAACAGCCAGTGCAAAGG - Intronic
1161646172 19:5454796-5454818 GGAGGGAGAGTCAAGTGCCAGGG - Intergenic
1161860765 19:6796507-6796529 AGAGGGAACAGCCAGTGCAAAGG - Intronic
1161874136 19:6894510-6894532 AGAGGGAACAGCATGTGCAAAGG + Intronic
1161914568 19:7218916-7218938 AGAGGGAACAGCAAGTGCCGAGG + Intronic
1162146403 19:8614751-8614773 ACAGGGAACAGCAAGTGCAAAGG - Intergenic
1162330591 19:10026857-10026879 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1162360707 19:10218527-10218549 AGAGGGAACAGCAGGTGCAAAGG + Intronic
1162366756 19:10254413-10254435 AGAGGGAACAGCAAGTGCCAAGG + Intronic
1162746715 19:12802625-12802647 AGAGGGAATAGCAAATGCCAAGG + Intronic
1162752492 19:12837486-12837508 GGAGGGAACTGCAAGGGCAAAGG - Intronic
1162856505 19:13472586-13472608 AGAGGGAACAGCATGTGCAAAGG - Intronic
1162869707 19:13576220-13576242 AGAGAGAACAGCAAGTGCAAAGG - Intronic
1162874182 19:13608637-13608659 AGAGGGAACAGCAGGTGCGAAGG - Intronic
1162896604 19:13768403-13768425 AGAGGGAACTGCCACTGCGAGGG + Intronic
1162924310 19:13922389-13922411 AGTGGGAACTGCATGTGCAAAGG - Intronic
1163032946 19:14556222-14556244 AGAGGGAACAGTAAGTGCCAAGG - Intronic
1163120662 19:15215549-15215571 AGAGTGAACAGCAAGTGCAAAGG + Intergenic
1163160222 19:15459864-15459886 AGAAGGAACAACAAGTGCAAAGG - Intronic
1163173716 19:15550446-15550468 AGAGGAAACAGCAAGTGCAAAGG + Intronic
1163549466 19:17957560-17957582 AGAGGGAACCACATGTGCAAAGG + Intronic
1163581910 19:18144333-18144355 AGAGGGAACTGCATGAGCAAAGG + Intronic
1163582038 19:18144848-18144870 AGAGGGCACTGCACGTGCAAAGG + Intronic
1163665719 19:18603401-18603423 AGTGGGAGCTGCAAGTGCCAAGG + Intronic
1163670877 19:18627762-18627784 AGAGGGGACTGCATGTGCAAAGG - Intergenic
1164371500 19:27647934-27647956 AGAGACAGCTTCAAGAGCCATGG - Intergenic
1164700119 19:30279054-30279076 AGAGTGAACAGCAAGTGCAAAGG - Intronic
1165071214 19:33255949-33255971 AGAGGGAGCCACCAGTGCCAAGG + Intergenic
1165396307 19:35565544-35565566 AGAAGGAACTGTAAGTACCAAGG - Intergenic
1165692734 19:37876232-37876254 AAAAGGAACAGCAAGTGCCAAGG + Intergenic
1165697815 19:37914264-37914286 AGAGGGAACAGCAAGTGTTAAGG + Intronic
1165701572 19:37942455-37942477 AGAGGGAACAGCAGGTGCAAAGG + Intronic
1165806406 19:38583734-38583756 AGAGAGAACATCAGGTGCAAAGG - Intronic
1165844598 19:38810036-38810058 AGAGGGAACAGCCAGTGCAAAGG - Intronic
1165910001 19:39219858-39219880 AGAGGGAACAGCCAGTGCAAAGG + Intergenic
1165937982 19:39401085-39401107 AGAGGGAACTGCAAGTGCCAGGG + Intergenic
1165958734 19:39517621-39517643 TGAGGGAACTGCCAGTGCAAAGG + Intronic
1165986864 19:39777108-39777130 AAAGGGAACATCAAGTGCAAAGG - Intronic
1166006915 19:39914394-39914416 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1166093826 19:40527620-40527642 AGAGGGAACGGCTAGTGCCAAGG + Intronic
1166101378 19:40573341-40573363 AGAGGGAACTGCAAGTGCAGAGG + Intronic
1166113713 19:40639873-40639895 AGAGGGAACAGCCAGTGCCAAGG - Intergenic
1166219595 19:41355945-41355967 AGAGGGAACAGCAAGTGCCAAGG + Intronic
1166220296 19:41359966-41359988 AGAGGGAACAGCCAGTGCAAAGG - Intronic
1166349027 19:42185576-42185598 ATAGGGAACTGCAAGTACAAAGG - Intronic
1166543456 19:43620456-43620478 AGAATGAACTGCAAGCGCCAAGG + Intergenic
1166658423 19:44628957-44628979 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1166673954 19:44727882-44727904 AGAGGGAACAGCAAGTGCCAAGG - Intergenic
1166760897 19:45224062-45224084 AGAGGGAAGGGCAAGTGCAAAGG + Intronic
1166822576 19:45589573-45589595 AGAGGGAACTGCAGGTGCAAGGG - Intronic
1166936589 19:46337201-46337223 AGAGAGAACAGCAAGTGCAAAGG + Intronic
1167041636 19:47026317-47026339 AGAGGGAACAGCAGGTGCAAAGG + Intronic
1167101061 19:47404570-47404592 AGAGGGAATAGCACGTGCCAAGG - Intronic
1167101177 19:47405087-47405109 AGAGGGAACAGCATGTGCAAAGG - Intronic
1167112034 19:47468259-47468281 AGGGGGAACAGCAGGTGCCAGGG - Intronic
1167150608 19:47707237-47707259 AGAGGGAACCGCCAGTGCAAAGG + Intergenic
1167242337 19:48351690-48351712 TGAGGGAACTCCACGTGCAAAGG - Intronic
1167252670 19:48408896-48408918 AGAGGGAACAGCAGGTGCAAAGG + Intronic
1167294561 19:48642044-48642066 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1167324617 19:48816418-48816440 AGAGGGAACAGCAAGTTCAAAGG - Intronic
1167347788 19:48957086-48957108 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1167490669 19:49791134-49791156 AGAGGGAACAGCCTGTGCCAAGG - Intronic
1167569481 19:50277985-50278007 AGAGGGAACAGCCAGTGCAAAGG + Intronic
1167615454 19:50530419-50530441 AGAGGGAACAGCATGTGCAAAGG - Intronic
1167774746 19:51547439-51547461 AGGGTGGACTTCCAGTGCCAGGG + Intergenic
1167796478 19:51712979-51713001 AGAGGGAACCCCAGGTTCCAAGG + Intergenic
1168184532 19:54690848-54690870 AGAGGGAACTTCACACACCAGGG + Intronic
1168237762 19:55074341-55074363 AGAGGAAACAGCAAGTGCAAAGG + Intronic
1168487626 19:56777965-56777987 AGAGCGAACAGCAAGTGCCAGGG - Intronic
924981199 2:223147-223169 AAAGGGAACATCACTTGCCATGG - Intronic
926147881 2:10407745-10407767 GGAGGGAACTGCAGGTGCGAAGG + Intronic
926295206 2:11564072-11564094 AGAGGGAACAGCATGTGCAAAGG + Intronic
927253396 2:21018516-21018538 AGAGGGACCAGCAAGTGCAAAGG - Intronic
931391409 2:61847201-61847223 AGAGGGAACAGCAAGTGCAAAGG - Intronic
932235660 2:70119240-70119262 AGAGGGAACAGCCAGTGCAAAGG + Intergenic
932376636 2:71241843-71241865 GGAGGGGATTTCAAGTACCATGG - Intergenic
932479256 2:72028818-72028840 AGAGGGAACGGTGAGTGCCAAGG + Intergenic
932996089 2:76855110-76855132 AGAGGGGACTGCAAGAGCAAAGG + Intronic
933699441 2:85244090-85244112 AGAGGGAACAGCAGGTGCAAAGG + Intronic
934517653 2:94998768-94998790 AGAGGGAACGGCATGTGCCCAGG - Intergenic
934700351 2:96434697-96434719 AGAGGGAACATCAAGGGTAAGGG - Intergenic
934865171 2:97802674-97802696 AGTGGAAATTTCAAGTGCCGGGG + Exonic
935514880 2:104023601-104023623 AGAGGCAAGTTCAAGTGATAAGG - Intergenic
935686876 2:105691722-105691744 AGAGGGAACGGCCAGTGCAAAGG + Intergenic
936512487 2:113159393-113159415 AGAGGGAACAGCAAGTGCAAAGG + Intronic
936597994 2:113867551-113867573 AGTGGGAACTTGAAGTTCTAAGG - Intergenic
936600180 2:113888429-113888451 AGAGTGAACAGCAAGTGTCAAGG - Intergenic
936685352 2:114821076-114821098 AGAGGGAACTTCAAGTGCCAAGG + Intronic
937103945 2:119293355-119293377 AGAGGGAAGAGCAAGTGCAAAGG + Intergenic
937415918 2:121714407-121714429 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
937808839 2:126177359-126177381 AGAGGTAAATCCAAGTACCAGGG + Intergenic
937877789 2:126838237-126838259 AGAGTGAACTCCAAGTGCTCAGG + Intergenic
939892890 2:147758191-147758213 AGAGGAAACTGCCAGTGCAAAGG - Intergenic
940012833 2:149072949-149072971 AGAGGGAACAGCAAGTGCAAAGG + Intronic
940201196 2:151152801-151152823 AGAGGGAACAGCAACTGCAAGGG - Intergenic
940446236 2:153781109-153781131 AGAGGGAACATCATATGCAAAGG + Intergenic
940940720 2:159557523-159557545 AGAGGGAAGAGCAAGTGTCAAGG - Intronic
940978259 2:159971530-159971552 AGAGGGAATTTCAATTTCCTGGG - Intronic
941360022 2:164540189-164540211 AGAGGGAACAGCAAGTGGAAAGG - Intronic
941894490 2:170615436-170615458 AGAGGGAATGGCCAGTGCCAAGG + Intronic
942015226 2:171806613-171806635 AGAGGGAAATTTTATTGCCATGG - Intronic
942257249 2:174115706-174115728 AGAGGAAACTGCAAGTACAAAGG - Intronic
943750371 2:191504028-191504050 AGAGGGAACCCCACTTGCCACGG + Intergenic
943784938 2:191867071-191867093 AAAGGGAAGTTCAAGAGCCAAGG - Intergenic
944177610 2:196850451-196850473 GAAGAAAACTTCAAGTGCCAGGG + Intronic
944701451 2:202249924-202249946 AGAGGAAACCCCAAGTGCCACGG + Intergenic
945196480 2:207241924-207241946 AGAGGGAATTGCAAATGCCCAGG + Intergenic
945939049 2:215930120-215930142 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
945974617 2:216260547-216260569 GGAAGGAACTCCAAGTGCAAAGG + Intronic
945978614 2:216290319-216290341 AGAGGGAATATCAAGTGCAAAGG + Intronic
946243326 2:218370333-218370355 AGAAGGAACAGCAAGTGCAAAGG + Intergenic
946345979 2:219110752-219110774 AGAGGGAACGGCAAGTGAGAAGG + Intronic
946348015 2:219126859-219126881 AGAGGGAACGGCATGTGCCAAGG + Intronic
946417660 2:219548557-219548579 AGAGGGAACAGCAAGGGCGAGGG + Intronic
947286970 2:228527965-228527987 AGAGGGAACTGCAAATGCAAAGG + Intergenic
947581069 2:231318967-231318989 AGAGGGAAGAGCAAGTGGCAAGG + Intronic
947666450 2:231908972-231908994 AGAGAGAACATCAAGTGCAAAGG + Intergenic
948057422 2:235019022-235019044 AGAGGGAACAGCTAGTGCAAGGG + Intronic
948113079 2:235472496-235472518 AAAGGGAAGCTCAGGTGCCACGG + Intergenic
948433276 2:237934349-237934371 AGAGAGAACTGCAGGTGCAAAGG - Intergenic
948460888 2:238129405-238129427 AGAGGGAACAGCCAGTGCAAGGG + Intronic
948503056 2:238408824-238408846 AGAGGGAATTTCAAGTCCTGAGG - Intergenic
1168756431 20:321617-321639 AGAGGAAACAGCAAGTGCAAGGG - Intergenic
1168811251 20:706191-706213 GGAGGGAACAGCAAGTGCCAGGG + Intergenic
1168976985 20:1974224-1974246 AGAGGGAACAGCAAATGCAAAGG - Intergenic
1169024480 20:2357390-2357412 AGAGGAGACTTCAAGTGTCTTGG - Intergenic
1169275271 20:4229582-4229604 AGAGGAAACGGCAAGTGCAAAGG + Intronic
1169654771 20:7911041-7911063 AGAGGGAACAGCCAGTGCAAAGG + Intronic
1169954101 20:11082215-11082237 AGAGGGAACTTGAAGGTCCCAGG + Intergenic
1170175211 20:13461110-13461132 AGAGGGAACAGCATGTGCAAAGG - Intronic
1170301187 20:14886242-14886264 AGAGGAAACAGCAAGTGCAAAGG + Intronic
1170381520 20:15764979-15765001 AGAGGGAACAGCAAGTGAAAAGG - Intronic
1170799551 20:19579726-19579748 AGAGGGAAGAACAAGTGCAAAGG + Intronic
1170946225 20:20893336-20893358 AGAGAGAACTTAAAGTTCCAAGG + Intergenic
1170994263 20:21336921-21336943 AGAGGGAATCACCAGTGCCAAGG + Intronic
1171555469 20:26079345-26079367 AGAATAAACTTCAAGTTCCAAGG - Intergenic
1171956553 20:31468255-31468277 AGAGGGAGCATCAAGGGCCAAGG - Intronic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1172027767 20:31960699-31960721 AGAGGGAACTGCAAGTGCAAAGG + Intergenic
1172044438 20:32070475-32070497 AGAGGGAACAGCAAATGCAAAGG - Intronic
1172096117 20:32461267-32461289 AGAGGGAACAGCAAGTACCAAGG - Intronic
1172114674 20:32566601-32566623 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1172125326 20:32622176-32622198 AGAGGGAACAGCAGGTGCAAAGG + Intergenic
1172125567 20:32623411-32623433 AGAGGGAACAGCAGGTGCAAAGG + Intergenic
1172186217 20:33032640-33032662 AGAGGGCACAGCAAGTGCAAAGG - Intronic
1172192100 20:33068394-33068416 AGAGGGAGCAGCAAGTGCAAAGG + Intronic
1172621597 20:36321247-36321269 AGAGGGAACAGCACGTGCAAAGG + Intronic
1172626328 20:36349551-36349573 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1172758139 20:37301892-37301914 AGAGGGCACTGCACGTGCAAGGG + Intronic
1172764233 20:37342654-37342676 AGAGGGATCAGCAAGTGCAAAGG + Intergenic
1172795951 20:37537723-37537745 AGAGGGAACAGCATGTGCAAAGG - Intergenic
1172880201 20:38194926-38194948 AGTGGGAACAGCAGGTGCCAAGG + Intergenic
1172888292 20:38246333-38246355 AGAGGGAACAGCCAGTGCAAAGG - Intronic
1173078174 20:39840691-39840713 AGAGGCAACAATAAGTGCCAAGG - Intergenic
1173190021 20:40869077-40869099 AGTGGGAACTTCTCGAGCCAAGG - Intergenic
1173199694 20:40945423-40945445 AGAGGGCACTGTAAGTGCAAAGG - Intergenic
1173288641 20:41694950-41694972 AGAGGGATCAGCAAGTGCAAAGG + Intergenic
1173340565 20:42149209-42149231 AGAGGGAACAGCAAGTGCGGAGG + Intronic
1173451072 20:43164525-43164547 AGAGGGAACAACTAGAGCCAAGG + Intronic
1173540221 20:43845402-43845424 AGAGGGAACAGCAAGTACAATGG - Intergenic
1173594956 20:44252951-44252973 AGAGGGAACAGCCAGTGCTAAGG - Intronic
1173659443 20:44723188-44723210 AGAGGGAACAGCCAGTGCAAAGG - Intronic
1173804700 20:45916703-45916725 AGAGGGAACAGCAAATGCAAAGG - Intergenic
1173866313 20:46314632-46314654 AGAGGGAGCTCCAGGTGGCAGGG - Intergenic
1173880648 20:46409405-46409427 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1173919081 20:46730549-46730571 AGAAGGAACAGCAAGTGCAAAGG + Intronic
1173927626 20:46792514-46792536 AGAGGGAACAGCAAGGGCAAAGG - Intergenic
1174007594 20:47422722-47422744 AGAGGGAAGTACAGGTGCAAAGG - Intergenic
1174021327 20:47532271-47532293 AGAGGGAACTACCAGTGGAAAGG + Intronic
1174090072 20:48039683-48039705 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1174126318 20:48309506-48309528 AGAGAGAACAGCAAGTGCAAAGG - Intergenic
1174163895 20:48571143-48571165 AGAGGGACCTGCAAGTGCAAAGG + Intergenic
1174177028 20:48651673-48651695 AGTGGGAACAGCAAGTGCAAAGG + Intronic
1174187917 20:48720078-48720100 AGAGGGAACAGCCAGTGCAAAGG - Intronic
1174251871 20:49225981-49226003 AGAGGGAACAGAAAGTGCAAGGG - Intronic
1174273954 20:49390017-49390039 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1174278359 20:49419997-49420019 AGAGGGCACAGCAAGTGCAAAGG - Intronic
1174297666 20:49560699-49560721 AGAGGCAACAGCAAGTGCAAAGG + Intronic
1174299274 20:49569629-49569651 AGAGGGAACAGCACGTGCAAAGG - Intergenic
1174322436 20:49752539-49752561 AGAAGGAACTCCATGTGCTAAGG + Intergenic
1174385372 20:50185665-50185687 AAAGGGAACAGCAAGTGCAAAGG - Intergenic
1174394691 20:50239711-50239733 AGAGGGAACTGCAAGTGCAAAGG + Intergenic
1174407121 20:50309856-50309878 AGAGGGAACCGCAGGTGCTAAGG + Intergenic
1174414186 20:50356428-50356450 AGGGGGCACCTCAAGTGCAAAGG + Intergenic
1174421232 20:50400367-50400389 AGAGGAAACAGCAAGTGCAAAGG + Intergenic
1174423967 20:50419012-50419034 ATAGGGAACAGCATGTGCCAAGG + Intergenic
1174426132 20:50432733-50432755 AGAGGGAATAGCAAGTGCAAAGG - Intergenic
1174428286 20:50448856-50448878 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1174503023 20:50999529-50999551 AGAGGGTACAGCAAGTGCAAAGG + Intergenic
1174688139 20:52475376-52475398 ATAGGGCATTTCAAGTGCAAGGG + Intergenic
1175080731 20:56418252-56418274 AGAGGGAACAGCAGATGCCAAGG + Intronic
1175134063 20:56809837-56809859 AGAGTGAACGGCATGTGCCAAGG + Intergenic
1175222913 20:57427602-57427624 TGAGGGAACTGCACGTGCAAAGG - Intergenic
1175227375 20:57452484-57452506 AGAGGGAACAACCAGTGCAAAGG + Intergenic
1175762162 20:61568642-61568664 AGAAGGAACAGCAAGTGCCAAGG - Intronic
1176655171 21:9581637-9581659 AGAATAAACTTCAAGTTCCAAGG + Intergenic
1176876945 21:14139823-14139845 AGAGGGAACATCCAGTACAAAGG + Intronic
1176908786 21:14537223-14537245 AGAGGGAAGAGCAAGTGCAAAGG - Intronic
1177748049 21:25245261-25245283 AGAGGGAACTGCCAGTGAAATGG - Intergenic
1178141051 21:29683889-29683911 AGAGGGAACAGCCAGTGCAAAGG - Intronic
1179122934 21:38565578-38565600 AGAGGGAACAGCATGTGCAAAGG - Intronic
1179143995 21:38751751-38751773 AGAGGGAACAGCCAGGGCCAGGG + Intergenic
1179288913 21:40001314-40001336 AGTGTGAAATTCAGGTGCCACGG + Intergenic
1179650948 21:42808301-42808323 AGAGGAAACCCCAAGTGCCACGG - Intergenic
1180845650 22:18980153-18980175 AGAGGAAGCCTCAAGTGCAAAGG - Intergenic
1181162182 22:20965533-20965555 AGAGGGAACTGCACGTGCAGAGG + Intronic
1181319889 22:21996109-21996131 AGAGGGAACAGGAAGTGCAAAGG - Intergenic
1181763182 22:25072093-25072115 AGAGGGAACAGCATGTGCAAAGG + Intronic
1181765943 22:25092318-25092340 AGAGGGAACAGCACGTGCAAAGG + Intronic
1181988050 22:26815370-26815392 AGAGGGAACAACATGTGCAAAGG + Intergenic
1182015643 22:27037340-27037362 AGAGGCAATTGCAAGTGCAAAGG + Intergenic
1182051340 22:27315105-27315127 AGAGGGAACAACAGGTGCAAGGG + Intergenic
1182060375 22:27392959-27392981 AGAGGGAAGAGCAAGTGCAAAGG - Intergenic
1182127306 22:27825391-27825413 AGAGGGAACAGCATGTGCAAAGG - Intergenic
1182294515 22:29305262-29305284 AGAGGGAACGGCCAGTGCAAAGG - Intergenic
1182409560 22:30171887-30171909 AGAAGGAACATCATGTGCAAAGG + Intronic
1182573960 22:31260232-31260254 AGAGAGAACAGTAAGTGCCAAGG - Intronic
1182706396 22:32283240-32283262 AGAAGGAACTGCAAGTGCAAAGG - Intergenic
1182767703 22:32770533-32770555 CAAGGGAACATCAAGTGCAAAGG - Intronic
1182959319 22:34457100-34457122 AGAGGGAATAGCAAGTGCAAAGG - Intergenic
1183271625 22:36865883-36865905 AGGGGGAGCTTCAAGTTCCTTGG - Intronic
1183321670 22:37168736-37168758 AGAGGGAGCTGCAAGAGCCAAGG + Intronic
1183343149 22:37293186-37293208 AGAGGGGACTGCGAGTGCAAAGG - Intronic
1183380310 22:37487349-37487371 GGTGGGAACAGCAAGTGCCAAGG - Intergenic
1183602287 22:38846929-38846951 AGAGGGAACCGCTAGTGCAAAGG + Intergenic
1183715404 22:39530366-39530388 AGAGGGAACACCCAGTGCAAAGG + Intronic
1183959651 22:41403793-41403815 AGAAGGAACAGCAAGTGCAATGG - Intergenic
1184025570 22:41853334-41853356 CCAGGGAACCTCAAGAGCCAAGG - Intronic
1184111663 22:42399099-42399121 AGAGGGAACAGCAGGTGCCAAGG + Intronic
1184196419 22:42932217-42932239 AGAGGGAACAGCATGTGCAAAGG - Intronic
1184394719 22:44226306-44226328 AGAAGGAACCACAAGTGCAAAGG - Intergenic
1184449853 22:44576420-44576442 AGAGGGGACAGCAGGTGCCAAGG + Intergenic
1184717965 22:46292661-46292683 TGAGGGAACAGCAAGGGCCAAGG - Intronic
949334885 3:2963537-2963559 AGAGAGAACATCAAGTGCAAAGG - Intronic
949571313 3:5295984-5296006 AGAGGGAACAGCCAGTGCAAAGG + Intergenic
950146999 3:10657260-10657282 AGAGGGAACGGCATGTGCAAAGG - Intronic
950158342 3:10740611-10740633 AGAGGGAACAGCCAGTGCAAAGG - Intergenic
950196326 3:11011534-11011556 AGAGGGAGCAGCAAGTGCAAAGG - Intronic
950455954 3:13092886-13092908 AGAGGGAACAGCAAGGGCAAAGG - Intergenic
950475445 3:13211734-13211756 AGAGGGAAGTTCCAGGGCAAAGG - Intergenic
950548740 3:13654098-13654120 AGAGGGACCGGCAAGTGCAAAGG - Intergenic
950556895 3:13701422-13701444 GGAGAGAACTGCAAGTGCAAAGG - Intergenic
950570544 3:13797121-13797143 AGAGGGAACTTCAGCTGCGAAGG + Intergenic
950577564 3:13841968-13841990 AGAGGGAACAGTAAGTGCAAGGG + Intronic
950682869 3:14597098-14597120 AAAGGGAACAGCAAGTGCAAAGG + Intergenic
950723308 3:14899904-14899926 AGAGGGAACAGCAAGTACAAAGG + Intronic
950838116 3:15940089-15940111 AGAGAGAACTGCCAGTGCAAAGG - Intergenic
950957766 3:17072788-17072810 ATACTGAACTTCAAGTGACATGG - Intronic
951392411 3:22122815-22122837 AGAGGCAACATCAAATGCAAAGG + Intronic
952087654 3:29845925-29845947 AGAGGGAATTCCAAGTGCAAAGG + Intronic
952105012 3:30059438-30059460 AGAAGGAACTGCAAGTGCAAAGG - Intergenic
952860697 3:37810098-37810120 AGAAGGACATTCAAGAGCCACGG - Intronic
952970022 3:38644895-38644917 AGAGGGAACTGCAAGTGCAAAGG - Intronic
953076598 3:39577547-39577569 AGAGGAAACCCCGAGTGCCATGG + Intergenic
953211280 3:40877467-40877489 AGTAGGAAGTTCAAGTGCAATGG + Intergenic
953411814 3:42694708-42694730 AGAGGGAACAACAAGGGCAAAGG - Intronic
953581506 3:44161288-44161310 AGAGGGAACAGCCAGTGCAAAGG - Intergenic
954663861 3:52240077-52240099 AGAGGGCACTGCATGTGCAAAGG + Intergenic
955040231 3:55309555-55309577 AGAGGCAACAGCAAGTGCCAGGG + Intergenic
955804409 3:62719287-62719309 AGAAGGAACAGCATGTGCCAAGG - Intronic
955886563 3:63605399-63605421 AGAGGGAACAGCAAGTGCAAAGG + Intronic
956718254 3:72097191-72097213 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
957422414 3:79988382-79988404 AGAGGAAAAGTCAAGTTCCAAGG - Intergenic
958643182 3:96835460-96835482 AGAGGGAGTATCAAGTGCAAGGG + Intronic
960605858 3:119504409-119504431 AGAGGGAACATCAAGGGGGAAGG + Intronic
960837830 3:121925820-121925842 GAAGGGAAGATCAAGTGCCAAGG + Intronic
961061455 3:123832270-123832292 AGGGGGAACTTCAGGAGCCTGGG - Intronic
961531942 3:127545279-127545301 GGAGGGGACTGCAAGTGCAAAGG + Intergenic
961656284 3:128443928-128443950 AGAGGGAACAGCATGTGCAAGGG + Intergenic
961744753 3:129057394-129057416 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
961823015 3:129584870-129584892 GGAGGGAACTGCCAGTGCAAAGG - Intronic
961941881 3:130646615-130646637 ATAGGGAACTTTAAGTGCAAAGG + Intronic
961955036 3:130792832-130792854 AGAGGGATCCTCAAGTACCTAGG + Intergenic
962159682 3:132985766-132985788 AGAGGGAACAGCAAATGCAAAGG - Intergenic
962425401 3:135265048-135265070 AGAAGGAACAGCAAGGGCCAAGG + Intergenic
962685980 3:137848083-137848105 AGAAGGAACTACATGTGCAAAGG - Intergenic
962879048 3:139559019-139559041 AGAGGGAACATCACATGCAAAGG - Intergenic
963115236 3:141723319-141723341 AGAAGGAACAGCAAGTGCCAAGG + Intergenic
963255939 3:143145051-143145073 AGAGGGCACTGCAAGTGCAAAGG - Intergenic
963638028 3:147823950-147823972 AGAAGAAACTTCCAGTGCAAGGG - Intergenic
964403722 3:156326671-156326693 AGAGAGAACAGCAAGTGCAAAGG - Intronic
964425960 3:156554442-156554464 AGAGAGAGGTTGAAGTGCCAGGG - Intronic
966449793 3:180045198-180045220 AGAGGGAACATCAAATGCTCAGG - Intergenic
967042924 3:185710388-185710410 AGAGGAAACTTCAGGGGCCAAGG - Intronic
967135871 3:186512164-186512186 AGAGGGAACAGCAAGAGCCAAGG + Intergenic
967385309 3:188905292-188905314 AGAGGGAAAAGCAAGTGCAAAGG - Intergenic
967873124 3:194248755-194248777 AGAGGGAAATTCATGGCCCAAGG - Intergenic
967907036 3:194509975-194509997 AGAGGGCACAGCAAGTGCAAAGG - Intergenic
967937919 3:194743953-194743975 AGAGGCAACAGCAAGTGCAAAGG - Intergenic
968744988 4:2355090-2355112 AGTGGGAACCTCACGTGCCAAGG - Intronic
969117052 4:4877157-4877179 AGAGGGAACAGCAAGTTCAAAGG - Intergenic
969489534 4:7491204-7491226 AAAGGGAACAGCATGTGCCAAGG - Intronic
969828124 4:9774389-9774411 AGAGGGAACATCACGGGCAAAGG - Intronic
970903168 4:21183775-21183797 AGAAGGAACAGCAAGTTCCAAGG - Intronic
970932537 4:21529347-21529369 TGACGGAACATCAAGTACCAAGG + Intronic
971121524 4:23710140-23710162 AGAGGGAATAGCAAGTGCAAAGG - Intergenic
971313860 4:25550528-25550550 AGAGGGAACAGCAAGTGCAAGGG + Intergenic
971423091 4:26491626-26491648 AGAGGTAACAGCAAGTGCAAAGG + Intergenic
973266485 4:48216139-48216161 AGAGGGAACAGCAGGTGCAAAGG - Intronic
973916639 4:55640475-55640497 AGAGGGACCATCAAGTGCAAAGG + Intergenic
975372020 4:73599965-73599987 AGAGGGATCAGCAAGTGCAAAGG - Intronic
977576190 4:98676940-98676962 AGAGGGAACAGCAAATGCAAAGG + Intergenic
977660460 4:99579419-99579441 AGAGGAAACAGCAAGTGCAAAGG - Intronic
977869970 4:102079932-102079954 AGAGAGAACAGCAAGTGCCAAGG + Intergenic
977874458 4:102132086-102132108 AGAGGGAACAGCAGGTGCAAAGG - Intergenic
978128766 4:105168401-105168423 AGAGGGAACAGCAAGTGCAAAGG - Intronic
978480482 4:109184580-109184602 TGAAAGAACTTCAAGTTCCAGGG + Intronic
978532344 4:109728035-109728057 AGAGGGAATAGCAAGTGCAATGG - Intronic
978624434 4:110668466-110668488 CCAAGGAACTTCATGTGCCATGG - Intergenic
978874249 4:113619598-113619620 AGAGGAAACATCAAGTGCAAAGG - Intronic
979549812 4:121978005-121978027 AAAGGGAACTGAAAGTGCAAAGG + Intergenic
980161281 4:129166426-129166448 AGAGAGCATTTCAAGTTCCATGG + Intergenic
980708750 4:136536264-136536286 GGAGAGATCTTCAAGTGTCAGGG + Intergenic
980933043 4:139199617-139199639 AGAGGAAACATCAAGGGCAAGGG - Intergenic
981078713 4:140617101-140617123 AGAAGAAACTGCAAGTGCAAAGG - Intergenic
981292987 4:143097987-143098009 AGAGGGAAGGTCAAGAGCAAAGG - Intergenic
981563550 4:146073844-146073866 AGAGGGAACAGCCAGTGCAATGG - Intergenic
981689728 4:147494472-147494494 AGAGGAAACATCAAGTGCAAAGG + Intronic
982178769 4:152730871-152730893 AGAGGGAACAGCATGTGCAAAGG + Intronic
982469810 4:155774314-155774336 AGAGGGAAGAGCAAGTGCAAAGG - Intronic
983160594 4:164409071-164409093 AGAGGAAACCTCCAGTGCAAAGG - Intergenic
983560957 4:169100882-169100904 AGAAGGAACTGCATGAGCCAAGG - Intronic
985468616 5:21908-21930 AGAGCCAACTTCCAGTGCCGGGG + Intergenic
985476444 5:81944-81966 AGAGGGAACAGCCAGTGCCCAGG + Intergenic
986329999 5:6711076-6711098 AGATGGAACAGCAAGTGCAAAGG + Intergenic
986345392 5:6830167-6830189 AGAGGTAACTGCCAGTCCCACGG + Intergenic
987129374 5:14846695-14846717 AGAATGAACCTCAAGGGCCAAGG + Intronic
987150230 5:15031350-15031372 AGAGGGAAAAACAAGTGCAAAGG - Intergenic
987360917 5:17105715-17105737 AGAGGGAACAGCAAGTGCAAAGG + Intronic
988496558 5:31750663-31750685 AGAGGGAACAGCAACTGCAAAGG + Intronic
988502299 5:31793389-31793411 AGAGGGAACTGCAGGTGCAAAGG - Intronic
989178433 5:38553167-38553189 AGAGGGAAGGGCAAGTGCAAAGG - Intronic
989282037 5:39655361-39655383 AGAGGGAACCCCACCTGCCATGG - Intergenic
989397813 5:40977425-40977447 AAAGGAAACTACAAGTCCCATGG + Intronic
990275542 5:54192093-54192115 AGAGGGAATGGCAAGTGCAAAGG - Intronic
991336620 5:65555321-65555343 AGAGGGAACTGCAAGTGCAAAGG + Intronic
991406478 5:66305398-66305420 AGAGGGAACAGCATGTGCAAGGG + Intergenic
991469757 5:66955336-66955358 AGTGGGAACTGTAAGTGCAAAGG + Intronic
992500993 5:77343594-77343616 AGAGGGAACATGAAGGCCCAGGG + Intronic
992679615 5:79141021-79141043 AGAGGGAACAACCAGTGCCAAGG - Intronic
994091778 5:95816009-95816031 AGAGGGAATAGCAAGTGCAAAGG - Intronic
995283830 5:110364453-110364475 AGAGGAAACTTCAAGGGTAAGGG - Intronic
995332409 5:110959898-110959920 AGAGGGAACAGCAAGTGCCAAGG + Intergenic
995366158 5:111363704-111363726 AGAGGGAACAGCAAATGCAAAGG + Intronic
996395056 5:123005297-123005319 AGAGGGAACAGCAAGTGCTGAGG - Intronic
996623100 5:125534704-125534726 AGAGGGAACATCACATACCAGGG + Intergenic
996798778 5:127379526-127379548 AGAGGAAATATCAAGTGCAAAGG - Intronic
996901465 5:128546767-128546789 TAAGGTAACTTCAAATGCCATGG + Intronic
996949087 5:129103542-129103564 AGAGGGAGATTAAAGTGCCAGGG + Intronic
997267471 5:132503490-132503512 AGAGGGAATAGCTAGTGCCAAGG + Intergenic
997284065 5:132665763-132665785 AAAGGGAACTGCAGGTGCTAAGG + Intergenic
997675209 5:135707569-135707591 AGAGGGAACAGCAGGTGCAAAGG - Intergenic
997786405 5:136717853-136717875 AGAGGGAACAGCATGTGCAAAGG + Intergenic
998160873 5:139812357-139812379 AGAGGGAACAGCCAGTGCAAAGG + Intronic
998389020 5:141774969-141774991 AGAGGGCACGGCAAGTGCAAAGG - Intergenic
998624139 5:143826169-143826191 AGAGAGAACAGCAAGTGCAAAGG - Intergenic
998675268 5:144400906-144400928 AGAGGGAACAATAAGTGCAAAGG + Intronic
998804695 5:145907002-145907024 AAAGGGAACTTCTGTTGCCAAGG + Intergenic
998936999 5:147239983-147240005 GGGGGTAACTTCAACTGCCAAGG - Intronic
998990466 5:147809925-147809947 AGAGGCAAATGCAAGTGCAAGGG - Intergenic
999190850 5:149746176-149746198 AGAGGGAACAGCAAGTGCAAAGG - Intronic
999250810 5:150181207-150181229 AGAGGGAACAGCAAGTGCAAAGG - Intronic
999324587 5:150635842-150635864 AGAGGGAACAGCAAGTGCTAAGG - Intronic
999660685 5:153859880-153859902 AGAGGGAAGAACAAGTGCAAAGG + Intergenic
999724174 5:154421285-154421307 AGAGGGAACAGCTAGTGCAAAGG + Intergenic
999735097 5:154506914-154506936 AGAGGGAACTACAAGTGCAAAGG - Intergenic
999793554 5:154966216-154966238 AGAGGAAACAGCAAGTGCAAAGG - Intronic
999907708 5:156162012-156162034 GGAGTAAATTTCAAGTGCCAGGG + Intronic
1000051987 5:157571382-157571404 AGAGGAAACAGCAAGTGCAATGG + Intronic
1000973622 5:167741007-167741029 AGAGGAAACAGTAAGTGCCAAGG - Intronic
1001072801 5:168601374-168601396 AAAGGGAACATCAAGTGCAAAGG - Intergenic
1001877048 5:175210650-175210672 AGAGGGGAAATCAAGTGTCAGGG + Intergenic
1001917048 5:175570491-175570513 AGAGGGAACAGCATGTGCAAAGG + Intergenic
1002063171 5:176638616-176638638 AGAGGAAACTGCAAGTGCAAAGG + Intronic
1002081936 5:176742610-176742632 AGAGAGAACAGCAAGTGCAAAGG + Intergenic
1002166357 5:177349930-177349952 AGAGGGAACAACAGGTGCAAAGG + Intronic
1002434232 5:179221367-179221389 AGAGGGAGCTGAAAGTACCAGGG + Intronic
1002512496 5:179732143-179732165 AGAGGGAACTGGAAATGCAAAGG - Intergenic
1002755688 6:157419-157441 AGAGCCAACCTCCAGTGCCAGGG + Intergenic
1003051834 6:2787508-2787530 AGAGGGAAAAGCAAGTGCAAAGG + Intergenic
1003449933 6:6221268-6221290 AGAGGGAACTTAAGATCCCAGGG - Intronic
1004274919 6:14227530-14227552 AGAGGGAACAGCCAGTGCAAAGG - Intergenic
1004325869 6:14673570-14673592 AGAGGGAACTGCAGGTACCCTGG + Intergenic
1004631658 6:17427172-17427194 AGAGGGAACAGCAAGAGCGAAGG + Intronic
1004796000 6:19085447-19085469 AGAGGAAACTTCCAGCGCTAAGG + Intergenic
1005571382 6:27148674-27148696 AGAGGGAATTTAAAGTGCAAAGG - Intergenic
1005687366 6:28267548-28267570 AGAGGGAATAGCAAGTGCAAAGG + Intronic
1005770480 6:29065735-29065757 AAGGGGAACATCACGTGCCAGGG - Intronic
1006471325 6:34230778-34230800 AGAGGGCACAGCAAGTGCAAAGG + Intergenic
1006750193 6:36372221-36372243 AGAGGGAACAGTAAGTGCAAAGG + Intronic
1006793769 6:36719761-36719783 AGAGGGAACAGCAGGTGCGAAGG + Intronic
1006809977 6:36813739-36813761 GGAGGGAACAGCAAGTGCAAAGG - Intronic
1007081537 6:39108636-39108658 AGAGGGAACCACAAGTGCAGAGG - Intronic
1007370753 6:41425685-41425707 GGAGGGAACAGCAAGTGCAAAGG + Intergenic
1007416071 6:41691952-41691974 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1007667859 6:43526491-43526513 AGAGGAAACAGCAAGTGCAAAGG + Intronic
1007943716 6:45806265-45806287 AGAGAGAATTGCAAGTGCAAAGG + Intergenic
1007998010 6:46329153-46329175 AGAGGGAATAGCAAGTGCAAAGG - Intronic
1008063860 6:47026818-47026840 AGAGGGGACTTCCAATGCCTGGG - Intronic
1008083746 6:47221909-47221931 AGAGGGAACCCTAAGTGCCACGG - Intergenic
1008448816 6:51625284-51625306 AAAGGGAAACTAAAGTGCCATGG + Intronic
1008592792 6:53010644-53010666 AGAGGAAACAGCAAGTGCAAAGG - Intronic
1009758544 6:67973835-67973857 AGAGGTTACTTCAAGTGTGAGGG + Intergenic
1009898310 6:69780239-69780261 AGAGGGAACCCCACCTGCCACGG - Intronic
1010087769 6:71940652-71940674 AGAAGGATTTTCAAGTGCTAGGG + Intronic
1011720225 6:90148590-90148612 AGAGGAATATTCAAGTGACATGG + Intronic
1012165872 6:95951111-95951133 AGAGGGAAAATCAAGTGCAAAGG + Intergenic
1013025958 6:106271915-106271937 AGAGGGAACAGCAAGAGCAAAGG - Intronic
1013596091 6:111662304-111662326 AGAGGGAACTCCAAGTGGGATGG + Intronic
1013636964 6:112038266-112038288 AGTCGGAGGTTCAAGTGCCAAGG - Intergenic
1014773638 6:125484666-125484688 AGAGGGAACAGCAAGTGCAAAGG + Intergenic
1015749132 6:136542589-136542611 AGAGAGAACTTGAATTGGCAGGG + Intronic
1016441994 6:144094201-144094223 AGAGGGAACTGCCAGTGCAATGG - Intergenic
1016448998 6:144161698-144161720 TGCTGGAACTTCAAGTGCTATGG + Intronic
1016621736 6:146118612-146118634 AAAGGGAACATCACATGCCAGGG - Intronic
1017323342 6:153118075-153118097 AGAGGGAGTGGCAAGTGCCAAGG + Intronic
1017752393 6:157500199-157500221 AGAGGGAACAGCTAGTGCAAAGG + Intronic
1018285148 6:162229675-162229697 AGAGGGAATGGCAAGTGCCAAGG - Intronic
1018306964 6:162467886-162467908 AAAGGGAACAACAAGTACCAAGG - Intronic
1018317981 6:162576203-162576225 AGAGGGAACTGCATGTTCAATGG - Intronic
1018486546 6:164246272-164246294 AGAGGGCACAGCAAGCGCCAAGG - Intergenic
1018629389 6:165809269-165809291 ACAGGGAACTACCAGAGCCAGGG - Intronic
1020417714 7:7965348-7965370 AGAGGGAACACCTAGTGCAAAGG + Intronic
1020494690 7:8834919-8834941 AGAAGGAAGTTCAAGTGTGAGGG + Intergenic
1020511345 7:9061042-9061064 AGTGGGAACTTCAAAAGGCAGGG + Intergenic
1020797718 7:12696852-12696874 AGAGGGAACTTTATTTGCAAGGG + Intergenic
1021576692 7:22111834-22111856 AGAGGGAACATCAAGTGCAAAGG - Intergenic
1021657213 7:22883896-22883918 AGAGGGAATGGCAAGTGCAAAGG - Intergenic
1021904572 7:25320549-25320571 AGAGGAAACAGCCAGTGCCAAGG + Intergenic
1021924811 7:25523995-25524017 AGAGGGAACAGCATGTGCAAAGG + Intergenic
1022830135 7:34057467-34057489 AGAGAAGACTCCAAGTGCCATGG - Intronic
1022957626 7:35396080-35396102 AAAGGGAAATTCTAGTGCCTGGG - Intergenic
1023050561 7:36247622-36247644 AGAGGGCACTTCAACTCCCTTGG - Intronic
1023357753 7:39384601-39384623 AGAGGGAGCAGCAAGTGCAAAGG - Intronic
1023646928 7:42327456-42327478 AGAGGGAACTTTGTGTGCGAAGG + Intergenic
1024656673 7:51456752-51456774 AGAGGGAACTTCAATTGCCAAGG - Intergenic
1025247185 7:57326227-57326249 ATAGGGAACAGCATGTGCCAAGG - Intergenic
1025253743 7:57369244-57369266 AGAGGGAACAGCAAGTGCAAAGG - Intergenic
1025256296 7:57385784-57385806 AGGGGGCACCTCAAGTGCAAAGG - Intergenic
1025302919 7:57834033-57834055 AGAATAAACTTCAAGTTCCAAGG - Intergenic
1026960289 7:74403703-74403725 AGAGCGAACTGCATGTGCCAAGG - Intronic
1027057453 7:75059801-75059823 ACAGGGAACTTAAAATGGCATGG + Intronic
1027973082 7:85111887-85111909 AGAAAGAACATCAAGTGCAAAGG - Intronic
1028970534 7:96853682-96853704 AGAGGGAACAGCCAGTGCAAAGG - Intergenic
1028997347 7:97116085-97116107 AGACGGGACAGCAAGTGCCAAGG + Intergenic
1029547663 7:101218920-101218942 AGTGGGAACCTCACGTGCAAAGG + Intronic
1030166690 7:106562560-106562582 AGAGGGAAATTCAAGTGCCCTGG + Intergenic
1030390357 7:108920483-108920505 AGAGGGAAGGTCTAGGGCCAAGG + Intergenic
1030676690 7:112392165-112392187 AGAGGGAACAGCAAATGCAAAGG - Intergenic
1031024031 7:116661305-116661327 ACAGGGAACAGCAAGTGCAAAGG - Intergenic
1032331770 7:130987161-130987183 AGAGGGACCAGCAAGTGCAAAGG + Intergenic
1033761502 7:144441124-144441146 AGAGGGAACAGCTAGTGCCAAGG + Intergenic
1035104160 7:156428308-156428330 CCAGGGAACCACAAGTGCCAGGG + Intergenic
1035655903 8:1304372-1304394 AGGAGGAATTTCAAGTGCCCAGG + Intergenic
1035930658 8:3776517-3776539 AGAGGGCACAGCAAGTTCCAAGG - Intronic
1036694060 8:10963260-10963282 AGAGGGGATTGCCAGTGCCAAGG - Intronic
1037156349 8:15704207-15704229 AGATGGAACAGCAAGTGCAAAGG + Intronic
1037269189 8:17107343-17107365 AGAGGTAACAGCAAATGCCAAGG + Intronic
1037575115 8:20195243-20195265 AGAGGGTTTTGCAAGTGCCAAGG - Intergenic
1037578726 8:20231963-20231985 AGAGGGAGCTTTAAGAGCCGGGG + Intergenic
1038426516 8:27467559-27467581 AGGGTGAACTTCATGTGCCCGGG - Intronic
1038734885 8:30160032-30160054 AGAGGGAAGCTCAAATTCCAGGG - Intronic
1038895133 8:31774191-31774213 AGAGGCAACCACAAGTGCAAAGG - Intronic
1038921652 8:32091608-32091630 AGAGTGAATTTCAGGTGTCATGG + Intronic
1039199023 8:35066643-35066665 AGAGGGAACGTCCAGTGGAAAGG - Intergenic
1039356634 8:36824609-36824631 AGATGGAGCTTCAACTGCAAAGG - Intronic
1040656754 8:49519323-49519345 AGAGTGAACATCAGGTGGCAAGG + Intergenic
1041076002 8:54170637-54170659 AAAGGGAACTCCAATTCCCAAGG - Intergenic
1042028386 8:64447828-64447850 AGAAGGAATTGCAAGTGCAAAGG - Intergenic
1042734851 8:71976904-71976926 AGCGGGAATTTCATGAGCCAAGG + Intronic
1042830329 8:73019729-73019751 AGAGGGAATGGCAAGTGCAAAGG - Intronic
1043675957 8:82953831-82953853 AGAGGGAACATAAAGTGCTCTGG - Intergenic
1044727471 8:95205083-95205105 AGAGGGAACAGCATGTGGCAAGG - Intergenic
1044870855 8:96618545-96618567 AGAAGGAACAGCAATTGCCAAGG + Intergenic
1045102566 8:98860395-98860417 AGAGGGAACAGCAAGTGTGAAGG + Intronic
1045384241 8:101655956-101655978 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1045638538 8:104221980-104222002 AGAGAGAACCTCTAGTGCAAAGG - Intronic
1046548445 8:115681488-115681510 AGAGGGAACAGCAGGTGCAAAGG - Intronic
1046612078 8:116437226-116437248 AGAGAGAACAGCAAGTGCAAAGG + Intergenic
1046841167 8:118858629-118858651 AGAGGGAGCAGCAAGTGCAAAGG - Intergenic
1046970963 8:120223053-120223075 AGAGTGAACTGCATGTGCTAAGG + Intronic
1047183883 8:122614616-122614638 TGAGGGAACAGCAAGTGCAAAGG - Intergenic
1047839539 8:128735726-128735748 AGAGGGAACAGCATGTGCAAAGG - Intergenic
1048014180 8:130483004-130483026 AGAGGAAACTGCAAGTGCAAAGG + Intergenic
1048335287 8:133497955-133497977 AGAGGGAACAGCAGGTGCAAAGG - Intronic
1048592874 8:135837712-135837734 AGAAGGAACAGCAAGTGCAAAGG - Intergenic
1049495020 8:142925966-142925988 AAAGGAAACATCAAATGCCAAGG + Intergenic
1050236425 9:3585914-3585936 ATAGAGAACATCAAGTGCCCTGG + Intergenic
1050499215 9:6277352-6277374 AGAGAGAACTGAAAGTGCAATGG + Intergenic
1050518093 9:6466802-6466824 GGAGGGAACATCAAGTACAAAGG - Intronic
1052291875 9:26851327-26851349 AGAGGAAACTGCAAGTGTGAGGG + Intronic
1053287875 9:36861634-36861656 AGAAGGAACAGCAAGTGCAAAGG + Intronic
1053294522 9:36903179-36903201 AGAGAGAAGGCCAAGTGCCAGGG - Intronic
1053303010 9:36965014-36965036 AGAGGGGACAGCAAGTGCAAAGG - Intronic
1055071874 9:72174925-72174947 AGAGGGAAGATCATGTGTCAAGG + Intronic
1055290764 9:74779777-74779799 AGAGGGAATAGCAAGTGCAAAGG + Intronic
1055770929 9:79716254-79716276 AGAGGGAACAACAAATGCAAAGG - Intronic
1056760602 9:89411982-89412004 AGAGGGAGCAGCAAGTGCCAAGG - Intronic
1057037781 9:91824382-91824404 ACTGGGAACATGAAGTGCCAGGG - Intronic
1057185939 9:93057830-93057852 AGAGGGAACAGCAGGTGCAAAGG - Intergenic
1057297664 9:93859018-93859040 AGAGGAAACAGCAAGTGCAAAGG + Intergenic
1057509296 9:95664148-95664170 AGAGAGAACTCCAAGTGCAAAGG - Intergenic
1057770039 9:97959297-97959319 AGAGGGAGCTGCAAGTACAAAGG + Intergenic
1057786552 9:98092393-98092415 AGAGGGCACAGCAAGTGCCAAGG - Intronic
1058649506 9:107161685-107161707 AGAGGGAACAACAATTGCAAAGG + Intergenic
1058662586 9:107280636-107280658 TGAAGGAACCTCAAGTGCAAAGG + Intergenic
1058873962 9:109225835-109225857 AGAGGGCACTGCATGTGCTAAGG + Intronic
1059422772 9:114202726-114202748 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1059984987 9:119813028-119813050 AGAGGGAACTGCATGTGGCAAGG + Intergenic
1060336567 9:122729240-122729262 AGAGGAAGCTTCAAGAGGCAGGG + Intergenic
1060385815 9:123227328-123227350 AGAAAGAACATCAAGTGCAAAGG + Intronic
1060756205 9:126215727-126215749 AGAGGGGACAGCAAGTGCAAAGG - Intergenic
1060853182 9:126894500-126894522 AGAGGGAACAGCACGTGCAAGGG + Intergenic
1060861041 9:126954996-126955018 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1060975596 9:127763088-127763110 AGAGGGAACAGCAAGTGCGAAGG - Intronic
1060976034 9:127765617-127765639 AGAGGGAACAGCACGTGCAAAGG - Intronic
1061205474 9:129160714-129160736 AGAGGGAACAGCAAGTACCAAGG + Intergenic
1061394149 9:130334140-130334162 AGAAGGAACAGCATGTGCCAAGG + Intronic
1061414003 9:130436148-130436170 AGAGGGGACAGCAAGTGTCAGGG + Intergenic
1061482872 9:130905796-130905818 AGAGGGAACAGCATGTGCAAAGG - Intronic
1061676700 9:132221247-132221269 AGAGGGAACAGCATGTGCAAAGG + Intronic
1061772044 9:132932740-132932762 AGAGGGAACAGCAAGTGCAAAGG - Intronic
1203574521 Un_KI270744v1:164790-164812 AGAGCCAACCTCCAGTGCCAGGG - Intergenic
1203632894 Un_KI270750v1:85109-85131 AGAATAAACTTCAAGTTCCAAGG + Intergenic
1186055153 X:5642255-5642277 AGAGGAGACCCCAAGTGCCATGG - Intergenic
1186092304 X:6062968-6062990 AGAGGGAACAGCCAGTGCCAAGG - Intronic
1186566155 X:10665067-10665089 AGATGGAAGATCAAATGCCAAGG - Intronic
1186747130 X:12581765-12581787 AGAGGGAACTGCAAATGCAAAGG - Intronic
1187047626 X:15663005-15663027 AGAGGGAACAGCATGTGCAAAGG - Intronic
1187244191 X:17539149-17539171 AGAGGGAACAGCAAGGGCAAAGG - Intronic
1187300943 X:18049261-18049283 AGAGGAAACATAAAGTGCAAAGG + Intergenic
1187452553 X:19411725-19411747 AGAGGGAACAGCAAGTGCAAAGG + Intronic
1188180723 X:27051880-27051902 AGAGAGAACTGCAAGTGAAAAGG + Intergenic
1188669433 X:32865466-32865488 AGAGGAAACTTCACATGCTAAGG + Intronic
1189222685 X:39385690-39385712 AAAGGGAACTGCATGTGCAAAGG - Intergenic
1189244662 X:39554266-39554288 AGAGGCAACAGCAAGTGCAAAGG + Intergenic
1189248985 X:39585429-39585451 TGAGTGAATGTCAAGTGCCAGGG - Intergenic
1189641132 X:43071932-43071954 AGAAAAAACTTCAAGTGCCCTGG + Intergenic
1189709419 X:43794234-43794256 AGATGGAACAGCCAGTGCCAAGG - Intronic
1189925197 X:45946105-45946127 AGAGGGAATTACAAGCGCAAAGG - Intergenic
1190337574 X:49271447-49271469 AGAGGAAACAGCAAGTGCAAAGG + Intronic
1190616486 X:52239219-52239241 ACAAGGAACTTCAAATGCCCAGG - Intergenic
1191250571 X:58258227-58258249 AGAGGCACCTTCAAATGGCAAGG + Intergenic
1192504295 X:71671595-71671617 AGAGCGTTCTTCAAGCGCCAGGG - Intergenic
1192551982 X:72061796-72061818 AGAGGGAACAGAAAGTGCCAAGG - Intergenic
1193373406 X:80727483-80727505 AGAGGGAACGGCATGTGCAAAGG - Intronic
1193956006 X:87863604-87863626 AGAGGGAACATCATGTGTAATGG - Intergenic
1194673756 X:96768684-96768706 AGAGAGAACATCAAGTGCGAAGG + Intronic
1195738422 X:108037023-108037045 AGGTGGAATTTGAAGTGCCAGGG + Intergenic
1195767956 X:108316769-108316791 AAAGGGAACAGCAAGTGCAAAGG + Intronic
1195890635 X:109689582-109689604 AGAGAGAACCTCAAGTACAAAGG - Intronic
1195910113 X:109880829-109880851 AGAGAGAACAACAAGTGCAAAGG - Intergenic
1196756998 X:119166735-119166757 AGAGGGAACTGTATGTGCAAAGG - Intergenic
1196768166 X:119268432-119268454 AGAGGGAACCACAAGAGCAAAGG - Intergenic
1196824622 X:119731455-119731477 AGAGGGAACTACAGGTGCAAAGG + Intergenic
1196847209 X:119905683-119905705 AGAGGGAACAGCAAGAGCAAGGG - Intronic
1196890242 X:120284367-120284389 AGAGGGAATAGCAAGTGCAAAGG - Intronic
1197828437 X:130615329-130615351 AGAGGGAAATGCAAATGCTAAGG - Intergenic
1198229839 X:134678376-134678398 AGAGGGAACAGAAAGTGCAAAGG - Intronic
1198507688 X:137317578-137317600 AGAGGAAACTGCAAGTGCAAAGG - Intergenic
1199259863 X:145759858-145759880 AGAGGGAACACCAAGTGCCAAGG + Intergenic
1199417361 X:147600478-147600500 ACATGGAACTTTAAGTGTCAAGG - Intergenic
1199965624 X:152818285-152818307 AGATGGAACAGCAAGTGCAAAGG - Intergenic
1200942350 Y:8798192-8798214 AGAGGGAACAACAAGTGCATAGG + Intergenic
1201504881 Y:14687298-14687320 AGAGGGAAGAGCCAGTGCCAAGG + Intronic