ID: 936689924

View in Genome Browser
Species Human (GRCh38)
Location 2:114874410-114874432
Sequence AAACCCTGCTTCACCAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 20, 2: 32, 3: 32, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936689924_936689927 20 Left 936689924 2:114874410-114874432 CCTATCTTGGTGAAGCAGGGTTT 0: 1
1: 20
2: 32
3: 32
4: 131
Right 936689927 2:114874453-114874475 AATGAGATTACGGAGTAGACTGG 0: 2
1: 15
2: 27
3: 33
4: 221
936689924_936689925 10 Left 936689924 2:114874410-114874432 CCTATCTTGGTGAAGCAGGGTTT 0: 1
1: 20
2: 32
3: 32
4: 131
Right 936689925 2:114874443-114874465 CAGCAACCAAAATGAGATTACGG 0: 9
1: 11
2: 20
3: 22
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936689924 Original CRISPR AAACCCTGCTTCACCAAGAT AGG (reversed) Intronic