ID: 936691095

View in Genome Browser
Species Human (GRCh38)
Location 2:114889804-114889826
Sequence CTGCAAAACATGAAGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 1, 2: 5, 3: 67, 4: 781}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936691095 Original CRISPR CTGCAAAACATGAAGAAAAA GGG (reversed) Intronic
900308613 1:2022936-2022958 GTGTAAAACAAGAAGAAAAGTGG + Intronic
900695065 1:4004671-4004693 CAGCAAAGCCTGAAGAACAAGGG + Intergenic
901118703 1:6872089-6872111 CTGCAAAACATGAATAAAAAAGG - Intronic
903087406 1:20874733-20874755 ATTCAAAACATGAAGGATAAAGG - Intronic
903964414 1:27077868-27077890 TTTTCAAACATGAAGAAAAATGG - Intergenic
904034241 1:27550536-27550558 CTGCTGAAGATGAAGAACAATGG - Exonic
904491334 1:30861376-30861398 CTGGACAACAGGAAGAAGAAGGG - Intergenic
905150897 1:35926626-35926648 CTGCAAAGCTAGAACAAAAATGG - Exonic
905227515 1:36488877-36488899 CTTCAAAAAATAAAAAAAAAAGG + Intergenic
905497019 1:38398959-38398981 CTGGAAAAGATGTAGAGAAAAGG + Intergenic
906007125 1:42484392-42484414 TTGCCATACAAGAAGAAAAAAGG + Intronic
906499435 1:46330666-46330688 CTTCAAAAAAAGAAAAAAAAAGG - Intergenic
906948752 1:50317482-50317504 CTCTGAAATATGAAGAAAAAAGG - Intergenic
906974392 1:50553810-50553832 CTGCAAAACCAGAACCAAAAAGG + Intronic
906980927 1:50628473-50628495 CAGTTAAACATGAAGATAAAAGG - Intronic
908342888 1:63200225-63200247 CTGAAAACCATGATGACAAAGGG + Intergenic
908362264 1:63381014-63381036 ATGCTAAACATTAAGAAAAATGG + Intronic
908857271 1:68444992-68445014 ATGCACAACATGAAGAATAAAGG + Intronic
908910145 1:69063695-69063717 TTGAAGGACATGAAGAAAAAGGG - Intergenic
909170981 1:72295121-72295143 CTGGAATACATGAGGCAAAAAGG + Intergenic
909413627 1:75380861-75380883 CTGCCAAACCTGAGGAAGAAGGG + Intronic
909579410 1:77217325-77217347 ATCCAAAAGATGAAGAAAAGAGG + Intronic
909896399 1:81075827-81075849 CTACAGAAAATGAAGGAAAATGG - Intergenic
910058037 1:83055385-83055407 CTCATAAACATCAAGAAAAAGGG - Intergenic
910599324 1:89013728-89013750 CTGTAAAATATGAAGGACAATGG - Intronic
910677453 1:89828895-89828917 CTGCAGAACAAGGAGAAGAAAGG + Intronic
910999902 1:93152838-93152860 CTGCAACACTTGCAGAACAAAGG - Exonic
911624316 1:100103942-100103964 CTGCACACCATGAACAAACATGG + Intronic
911805911 1:102207872-102207894 TTCCAAAAAATAAAGAAAAAGGG - Intergenic
912331845 1:108827279-108827301 AAGCAAAACGTGGAGAAAAAGGG - Exonic
912663370 1:111555571-111555593 CTACAAAATATTAAGAAACATGG + Intronic
912927478 1:113926186-113926208 CTGCAAATGATAAAGCAAAAGGG + Intergenic
913235663 1:116779954-116779976 ATGAAAAACATGAAATAAAATGG + Intergenic
913236463 1:116788530-116788552 CTCCAAAAGATGGAGAAAGAGGG + Intergenic
913417566 1:118628603-118628625 CTGAAAAACATAAAGGAACAAGG - Intergenic
914946104 1:152067804-152067826 CTCCAAGAGATGAAGAAAGAAGG - Intergenic
915402015 1:155629241-155629263 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
915790740 1:158667965-158667987 CTGGAAAACATACAGAAAACTGG - Exonic
916010080 1:160697419-160697441 CTGCCAAACCTGAGGAAGAAGGG + Intronic
916155080 1:161837103-161837125 CTGCAGAACATAAATAATAAAGG + Intronic
916322590 1:163521650-163521672 ATACAAAACCTAAAGAAAAATGG + Intergenic
916393786 1:164363145-164363167 AGGCAAAACCTGAAGACAAAAGG + Intergenic
916427262 1:164692601-164692623 AAGCAAGAAATGAAGAAAAATGG + Intronic
916479418 1:165201724-165201746 CAGCAAAACATAAGGAGAAAAGG - Intergenic
916484087 1:165242572-165242594 ATTCCAAAAATGAAGAAAAAAGG + Intronic
917128111 1:171709592-171709614 TTCAAACACATGAAGAAAAAAGG - Intronic
917200757 1:172512124-172512146 GTGCAATACATAGAGAAAAATGG + Intergenic
917577775 1:176342143-176342165 AAGGAAAGCATGAAGAAAAAAGG - Intergenic
917722074 1:177795398-177795420 CAGCAAACCATGAAGAAACCAGG + Intergenic
917875390 1:179282236-179282258 TCTCAAAACATGAAAAAAAAAGG + Intergenic
917915908 1:179701735-179701757 ATGCCAAAAATGAAGACAAATGG - Intergenic
917976000 1:180238605-180238627 CTTTAAAACATAAAGAGAAAAGG - Intronic
919696960 1:200587376-200587398 CAGAAAAAAAAGAAGAAAAAAGG + Intronic
920063949 1:203251536-203251558 CCTCAAAACATAAAGTAAAAAGG - Intronic
920214234 1:204350829-204350851 CTGCAAAACATACACACAAAGGG + Intronic
920629479 1:207637674-207637696 CTGCCAAACCTGAGGAAGAAGGG - Intronic
920657250 1:207886180-207886202 CTGCAAAATATGCAAAACAAAGG - Intronic
921438393 1:215155045-215155067 CTGTAAAATATTATGAAAAAAGG - Intronic
921470669 1:215544545-215544567 CTGCGTAACATGGATAAAAAAGG + Intergenic
921712963 1:218391213-218391235 CTGCAAATCATCAAGGAAAATGG - Intronic
922127118 1:222738561-222738583 CTGCAAAAAAAAAAAAAAAAAGG + Intronic
923377166 1:233375721-233375743 CATAAAAACATCAAGAAAAATGG - Intronic
923592482 1:235330971-235330993 ATGCAAAACAGGAAGAATAATGG - Intronic
923609921 1:235481506-235481528 CTACAAAAAATTAAGAAAATAGG - Intronic
923680998 1:236118632-236118654 CAGAAAAACATGAAAAGAAAAGG - Intergenic
924691025 1:246350614-246350636 CTGGAAAACATGAAGGGAAGTGG + Intronic
924901594 1:248407168-248407190 CATCAAAAGATGAAGCAAAAAGG + Intergenic
1063054224 10:2485636-2485658 CATGAAAACATGAAAAAAAATGG - Intergenic
1063652855 10:7956825-7956847 GTGAAAAACATGAAAAAATAGGG + Intronic
1064007225 10:11708260-11708282 CTGCAAAGGAAGAAGAGAAAAGG + Intergenic
1064634313 10:17348220-17348242 CTGCAAAAAAAAAAAAAAAAAGG - Intronic
1065877411 10:30009584-30009606 ATGCACAACATGAAGAAGAGGGG - Intergenic
1065910120 10:30295698-30295720 CTCCAAAAAAAGAAAAAAAAAGG - Intergenic
1066072435 10:31833373-31833395 CATCAAAACAGGAAGAAAAATGG + Intronic
1066364553 10:34764205-34764227 CTGCAAGACCTTAAGGAAAATGG + Intronic
1066440013 10:35429585-35429607 CTGTAAAACAGGGAGAAAATGGG + Intronic
1067261663 10:44698404-44698426 CTCCAAAAGATGAAGGACAAAGG - Intergenic
1067909462 10:50331518-50331540 CTACAAAAAATAATGAAAAATGG - Intronic
1068249598 10:54420743-54420765 TAGCAACAGATGAAGAAAAAAGG + Intronic
1068709396 10:60117012-60117034 CAGCAAAACGTGAAGGTAAAAGG + Intronic
1069094764 10:64245505-64245527 CTGCAAACTAGGAGGAAAAAAGG - Intergenic
1069273060 10:66554820-66554842 CTGAAAAAAATGAAGAAAGGAGG - Intronic
1070242497 10:74696730-74696752 CTGCAGAAAATGTGGAAAAAGGG - Intronic
1071007914 10:80904087-80904109 CTGAAAAAAATGAACAAAACTGG - Intergenic
1071140955 10:82508911-82508933 CTCCCAAAGATGAAGAAAAATGG - Intronic
1071256169 10:83873764-83873786 GTGGGAAACATGAAGAAAGATGG - Intergenic
1071923482 10:90377641-90377663 CTTCAAATCATGAAGGAAACTGG + Intergenic
1071971472 10:90911998-90912020 CTGCAAAACTTGGAAAACAATGG + Intergenic
1072028029 10:91484023-91484045 GTGAAAAACATGAAGCTAAATGG + Intronic
1072186464 10:93044119-93044141 CAATTAAACATGAAGAAAAAAGG - Intronic
1072263353 10:93703181-93703203 CTTAAAAAGAAGAAGAAAAAAGG + Intergenic
1072353791 10:94585955-94585977 CTGAAACACATGTATAAAAAAGG - Intronic
1072603777 10:96959328-96959350 CTGGAAAATGTGAGGAAAAACGG - Intronic
1072621704 10:97084044-97084066 CTGCAAAACCTGAACATAGAGGG + Intronic
1072947382 10:99822033-99822055 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1073209893 10:101791459-101791481 AAGCAACACATCAAGAAAAATGG + Intronic
1074218835 10:111415788-111415810 CTGTAAAGTATGCAGAAAAAAGG + Intergenic
1074247599 10:111710517-111710539 CTGCACAACATCAAGAAGCAGGG + Intergenic
1074902159 10:117827199-117827221 CAGCAAAAGAAGAACAAAAAAGG - Intergenic
1075907032 10:126090309-126090331 CTGCAAAAAAAAAAAAAAAAAGG + Intronic
1075928563 10:126273500-126273522 CTGCAAGAGAAGAAGTAAAAGGG + Intronic
1076398446 10:130159523-130159545 CTGCAAATTATGAAGCAAAAAGG - Intronic
1077995244 11:7446997-7447019 CTGCAAATAGTGAAGCAAAAGGG - Intronic
1078444998 11:11397407-11397429 ATCCAAAGCAGGAAGAAAAAGGG + Intronic
1078502896 11:11900458-11900480 ATGCAAAAAGTGAAGAAAATAGG - Intronic
1078809167 11:14740982-14741004 CTGCAGAAAATGAATAAGAATGG - Intronic
1078890579 11:15553278-15553300 ATGCAAATCAGGAGGAAAAAAGG - Intergenic
1079172452 11:18109244-18109266 CTGGAAAACATGGAGAAACCTGG + Intergenic
1079422184 11:20303945-20303967 AGACAAAACATGAAGCAAAAGGG + Intergenic
1079706396 11:23625897-23625919 GTGTAAAACAGGAACAAAAAAGG - Intergenic
1080025729 11:27612601-27612623 CTTCAAAAAATGAAGAAATAGGG + Intergenic
1080542941 11:33286390-33286412 CTGCAAAAAAAAAAAAAAAAAGG - Intronic
1080613566 11:33926296-33926318 CTGCAGAACAGAAAAAAAAATGG + Intergenic
1080947285 11:36988073-36988095 CTGAAAATCAAGAAGAAAAATGG + Intergenic
1081054681 11:38394796-38394818 CTGAAAAACATTAACAACAATGG - Intergenic
1081384007 11:42449153-42449175 TTACAGAAGATGAAGAAAAAAGG - Intergenic
1081385864 11:42472284-42472306 TTCCAAAACATGAAAAAGAAGGG - Intergenic
1081406787 11:42707632-42707654 ATGCAGAACTTGGAGAAAAATGG + Intergenic
1081495807 11:43609128-43609150 CTGGACAACATGACGAAAATTGG - Intronic
1082647280 11:55743279-55743301 ATGTAAAACATGAAGGAGAAAGG + Intergenic
1082733544 11:56829400-56829422 CTGCAAAAAACTAAGAAAGAGGG + Intergenic
1083117563 11:60477237-60477259 CTGCAGAAGCTGATGAAAAATGG + Intergenic
1083134687 11:60661213-60661235 CTGCAAAAAATGAAAAAACCAGG - Intergenic
1083327789 11:61881950-61881972 CAGCAAAACTGGTAGAAAAAAGG + Intronic
1083638881 11:64134828-64134850 CTACAAATCAATAAGAAAAATGG - Intronic
1084213966 11:67637354-67637376 CTGCAAAAAGTAAAAAAAAATGG - Intronic
1085900717 11:80697135-80697157 TTGCAAAACATGAATATAATAGG - Intergenic
1086039357 11:82456780-82456802 CTGCATGACAGGTAGAAAAATGG - Intergenic
1086053725 11:82624261-82624283 ATGGAAAACATGTAGTAAAAAGG + Intergenic
1086201301 11:84205117-84205139 CTGTAAAACAAGGAGCAAAACGG + Intronic
1086504011 11:87483793-87483815 ATGTAAAACATTCAGAAAAATGG - Intergenic
1086561731 11:88176263-88176285 TTGTAAAATAGGAAGAAAAATGG - Intergenic
1086725186 11:90173497-90173519 CTGCCAAACATTAATTAAAATGG + Intronic
1086776952 11:90848547-90848569 GTGAAAGACAAGAAGAAAAAGGG + Intergenic
1087027508 11:93664411-93664433 ATGCTATACATGAAGAAACAAGG - Intronic
1087051722 11:93892511-93892533 CTTCAAATCAGTAAGAAAAATGG - Intergenic
1087098078 11:94339080-94339102 GGGCAAAACCTGGAGAAAAAAGG - Intergenic
1087241237 11:95783405-95783427 CTGCAAAACAGAAATAAAACTGG + Intronic
1087551539 11:99656731-99656753 CTGCAAAACACCAGGAAAACAGG + Intronic
1087724447 11:101701931-101701953 CTGCCAAACCTGAGGAAGAAGGG + Intronic
1087977736 11:104570381-104570403 ATGGAAAACATGAGGAAAAGCGG + Intergenic
1088690083 11:112318814-112318836 CTCAAAAACAAGCAGAAAAATGG - Intergenic
1088929375 11:114334405-114334427 CTGCAAAAACTGAAAACAAAGGG + Intergenic
1088931598 11:114356763-114356785 ATGCAAAACATTAATAATAAAGG - Intergenic
1089093084 11:115894691-115894713 TTTTAAAACATGAAGAAATATGG - Intergenic
1089417643 11:118305822-118305844 CTGCACCACATGAGGCAAAATGG + Intronic
1089546701 11:119232425-119232447 CTGCAACAAATGAAAAAGAAGGG - Intronic
1089720654 11:120417169-120417191 CTGTAAAACATGAGGGAAACGGG - Intronic
1089801584 11:121034719-121034741 TTGCAACACATGAAAAATAAGGG + Intronic
1090857933 11:130627015-130627037 CTGCAAAAGAGGAAAAGAAAAGG - Intergenic
1090963566 11:131578970-131578992 CTGCATAACATGGAGGAAACCGG + Intronic
1091156235 11:133376911-133376933 CTGCAAAACATGCATGAAGATGG - Intronic
1091313467 11:134593588-134593610 ATGCACAATATGAATAAAAAAGG - Intergenic
1091371209 11:135060012-135060034 CTGAACAACATGAAGAATAGAGG + Intergenic
1091685935 12:2562240-2562262 CTCCCAAGCATGAGGAAAAAGGG + Intronic
1091690974 12:2597207-2597229 CTGCAAAACAAAAAGGAACAGGG - Intronic
1092268781 12:7004940-7004962 CTTAAAAAAATGAAGAAAGAAGG - Intronic
1092932198 12:13326602-13326624 CTGCAGAAGTTGAAGAAACAAGG + Intergenic
1093085136 12:14858609-14858631 TTGCAATAGATGAAAAAAAAAGG - Intronic
1093381948 12:18503793-18503815 TTGCAAACCATTAAGAAAATGGG - Intronic
1093821639 12:23626076-23626098 GAGGAAAAAATGAAGAAAAAAGG + Intronic
1094040003 12:26112716-26112738 TTACAAAACATGGAGAGAAAAGG + Intergenic
1094129114 12:27055646-27055668 CTCCAAAACTTCATGAAAAATGG + Intronic
1094486305 12:30928172-30928194 CTGCAGAACAAGAGGAAAACTGG + Intronic
1095323001 12:40852306-40852328 CTATAAAATAAGAAGAAAAATGG - Intronic
1095900359 12:47321462-47321484 CTCCAAGAGATGAAGAAAAGTGG - Intergenic
1096314685 12:50553960-50553982 CAGTAAAAAATTAAGAAAAAAGG - Intronic
1096340971 12:50798855-50798877 CTACCAAAAATGAATAAAAATGG + Intronic
1096480621 12:51938387-51938409 CTGTAAAACATGGATAACAATGG - Intergenic
1096547286 12:52348866-52348888 CTGCAAATCACTAAGAAAAAAGG - Intergenic
1096899614 12:54862270-54862292 CTGCAAAACATGGATGAACATGG - Intergenic
1096974477 12:55692018-55692040 CTGCAAAACAAGCAGAAAAGGGG + Intronic
1097330731 12:58330034-58330056 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1097450138 12:59728101-59728123 CTTCAAAACATACAGTAAAAAGG + Intronic
1098101307 12:67020181-67020203 CTGCACAACATGATAAAAAGTGG - Intergenic
1098777300 12:74636682-74636704 CTGCAGAATATGAAAGAAAAGGG - Intergenic
1098847837 12:75560066-75560088 ATGCAAAAAAAGAAGAAAAAAGG - Intergenic
1099191203 12:79563750-79563772 ATGCAAATCAAGAAGAAAAAAGG + Intergenic
1099666907 12:85642754-85642776 CCCCAAAACATGAAGATAATGGG + Intergenic
1099708111 12:86183054-86183076 CTGAACATGATGAAGAAAAATGG - Intronic
1099776692 12:87141803-87141825 CTGAAAAATATCAAGAAAAGTGG + Intergenic
1099795242 12:87392210-87392232 CTGCAAAACAGAAGTAAAAAGGG - Intergenic
1100181583 12:92092018-92092040 CTGTAAAACAGGAAAAAGAATGG + Intronic
1100530388 12:95456540-95456562 CTGCAAACCTTGAAAAAGAAGGG - Intergenic
1100589696 12:96015000-96015022 CTGCAAGACATGAAATAACATGG + Intronic
1100685088 12:96978793-96978815 CTGCAAAAAATTAAGAAATTAGG - Intergenic
1100726315 12:97412664-97412686 CTGCAATAAATGAAAGAAAAGGG + Intergenic
1100936612 12:99676794-99676816 CTGGAAAACAAGTAGAAAAGTGG + Intronic
1100937357 12:99684365-99684387 CTGCAAAAAAAAAAAAAAAAAGG + Intronic
1101331918 12:103763946-103763968 GTGCAAAACAAGATGGAAAAAGG + Intronic
1101361324 12:104030429-104030451 CTGTAAAACTAGAAGAAAACAGG + Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101493192 12:105229224-105229246 CTGGAAGAAAAGAAGAAAAAAGG + Intronic
1102144032 12:110640909-110640931 CTTCAACACATGGAGAAACAGGG + Intronic
1102716260 12:114975705-114975727 CTGGAAAACATAAAGGAGAATGG - Intergenic
1102903393 12:116656390-116656412 ATGCAAAACATCTGGAAAAATGG + Intergenic
1103010603 12:117455587-117455609 CTGGAAAAAATGGAGAAAAGTGG - Exonic
1103069335 12:117927690-117927712 CTGGAAAAAAGGAAAAAAAAAGG + Intronic
1103265392 12:119625731-119625753 CAGCAAAATAAGAATAAAAATGG - Intronic
1104178318 12:126353612-126353634 CTCCCAAACATGAAGCAAGATGG - Intergenic
1104325306 12:127790079-127790101 ATGCCAAACATGAACTAAAATGG - Intergenic
1105990041 13:25610882-25610904 CTGCAAAAAAAAAAAAAAAAAGG - Intronic
1106029985 13:25991205-25991227 CAGAAAAACATGAAATAAAAGGG + Intronic
1106361519 13:29035612-29035634 GAGGACAACATGAAGAAAAATGG - Intronic
1106591271 13:31100741-31100763 ATGCAACAAATGAAGTAAAAAGG - Intergenic
1107140667 13:36995426-36995448 CTTCATACAATGAAGAAAAACGG - Exonic
1107187794 13:37545304-37545326 CAGAAAAAAATGAAGAAAAAAGG - Intergenic
1107367703 13:39702266-39702288 CTCCAGAACATGAAAAAATATGG + Intronic
1107416741 13:40208141-40208163 CTACAATACATGAAGACAAATGG - Intergenic
1107597272 13:41975532-41975554 CTCAAAAACAAGAAAAAAAAAGG + Intergenic
1107656313 13:42595253-42595275 CTTCAAAACAAGACAAAAAAAGG - Intronic
1107729184 13:43331238-43331260 CGGCAAGACATGAAGGGAAAAGG - Intronic
1107977077 13:45700607-45700629 CTAGAAAACCTGAAGAAAAATGG - Intergenic
1107992022 13:45827011-45827033 CTGTTAGCCATGAAGAAAAAAGG - Intronic
1108219204 13:48216311-48216333 ATGCAAATCATGAAGACAATGGG + Intergenic
1108472721 13:50783694-50783716 ATGTAAAACATAAAGAAAATAGG + Intronic
1108740043 13:53327497-53327519 CTGCAAAAAATAAAAAAAAATGG - Intergenic
1108882973 13:55143692-55143714 CTACAAAAAATGAACAAAATTGG - Intergenic
1109413266 13:62002048-62002070 CTGTAAAACATGAAGACAACAGG - Intergenic
1109598770 13:64594887-64594909 CTCCAAAAAATTAAGAAGAAGGG - Intergenic
1109796459 13:67320107-67320129 CTGCAAATCAAGAGGGAAAATGG - Intergenic
1109926406 13:69146092-69146114 AAGCAAAACACTAAGAAAAAAGG + Intergenic
1110078394 13:71279512-71279534 CTCCAAAATAAGAAGAAAACAGG - Intergenic
1110311095 13:74050056-74050078 CTGCAAAACTTGACAAAAACAGG + Intronic
1110667495 13:78135192-78135214 CTGCAAAACCTCTAGCAAAATGG - Intergenic
1110886754 13:80647707-80647729 TTGAAAATCATGAAGAAAATTGG - Intergenic
1111693125 13:91590401-91590423 CTGGAAAACATGAACATATATGG + Intronic
1111859034 13:93678146-93678168 TTGTAAAACAGGAAAAAAAATGG - Intronic
1112123418 13:96438243-96438265 ATACCAAACATGAAGAAGAAAGG - Intronic
1112213232 13:97402354-97402376 CTAGAAAACATGAAAAACAAAGG + Intergenic
1112454894 13:99550719-99550741 CTGCAACAGATGCAGTAAAATGG + Intronic
1113245495 13:108390379-108390401 ATGATATACATGAAGAAAAATGG - Intergenic
1113676721 13:112212817-112212839 CTGAAAATCATGATTAAAAAGGG - Intergenic
1114729839 14:24980777-24980799 CTTCTAAACATGAAAAATAATGG + Intronic
1114951576 14:27761300-27761322 CTGCAACCCATGAGGAAATACGG - Intergenic
1115168025 14:30471467-30471489 CAGCAAAGCAGGAAGAAAAATGG + Intergenic
1115355716 14:32444548-32444570 ATTCAAATAATGAAGAAAAATGG - Intronic
1116388564 14:44362729-44362751 CTACAAAAATTGAAGAAAACTGG + Intergenic
1117211768 14:53508160-53508182 GTGCAAAACAGAAAAAAAAATGG - Intergenic
1117369848 14:55067408-55067430 CTCCAAAAAAAAAAGAAAAAAGG - Exonic
1117429076 14:55634298-55634320 CTGTAAAATATCAAGAAAAATGG - Intronic
1117527065 14:56619335-56619357 CTACAAAAAAAAAAGAAAAAAGG - Intronic
1118010584 14:61606788-61606810 CTGCGAAACAGTAATAAAAAGGG + Intronic
1119676938 14:76562811-76562833 AAGCAAAACCTGAAGAAAATGGG + Intergenic
1119690066 14:76664738-76664760 CTCCAAAAAAAGAAAAAAAAAGG + Intergenic
1120287827 14:82527135-82527157 CTGTATAACATTGAGAAAAAAGG - Intergenic
1120456282 14:84734859-84734881 CTTCAAAACACAAAGAAACATGG - Intergenic
1120484768 14:85099246-85099268 TGGCAAAACAGGAATAAAAAAGG + Intergenic
1120579939 14:86234136-86234158 CTCCAAAAAATGGAGAAAAAAGG + Intergenic
1120731707 14:88010288-88010310 CTTCAATACATGAAACAAAAAGG + Intronic
1120785771 14:88534207-88534229 CTGCTAAAAATTAAAAAAAAGGG + Intronic
1121028297 14:90633760-90633782 CTGCAAAAGATGAAAAATCAGGG + Intronic
1121844139 14:97158582-97158604 CTGCAAAAAAAAAAAAAAAAAGG - Intergenic
1122474533 14:101997730-101997752 CTTCAATGCATGAAGAAAAGTGG - Intronic
1122552373 14:102556942-102556964 CTCCAAAACAACAACAAAAAAGG + Intergenic
1122573355 14:102724209-102724231 CTGCAAAACAAAATGAAGAATGG + Intronic
1202901624 14_GL000194v1_random:46229-46251 CTGCAATACATGCAAACAAATGG - Intergenic
1202933778 14_KI270725v1_random:64927-64949 CTGCAAAATATGAAGAAACAAGG + Intergenic
1123917486 15:25047392-25047414 CTGGCAAGCCTGAAGAAAAAGGG - Intergenic
1123952936 15:25301067-25301089 CTGAAAAATATGAACAAAAGTGG + Intergenic
1124712150 15:32022545-32022567 GTGCAGAACAGAAAGAAAAATGG - Intergenic
1124807079 15:32895292-32895314 CTGTCTGACATGAAGAAAAAAGG + Intronic
1125494734 15:40181649-40181671 CTGAAAAACAAAAAGAAAAATGG - Intronic
1126123353 15:45272997-45273019 CAGCAAAGGAAGAAGAAAAATGG + Intronic
1126170211 15:45689288-45689310 CTGCTAATAATGAAGAAAAGAGG - Intronic
1126254379 15:46608210-46608232 CTGCAAAAAAAAAAAAAAAATGG - Intergenic
1126425863 15:48526582-48526604 ATGCAAAACATGGAAACAAAAGG - Intronic
1126464088 15:48944608-48944630 CTACCTAACATGAACAAAAAGGG + Intronic
1126504849 15:49393008-49393030 ATGAAAATCATGAAGAAAAGAGG + Intronic
1127177645 15:56377891-56377913 CTTCAAAACATGAGTATAAAAGG - Intronic
1127496512 15:59517972-59517994 CTCCAAAACAAAAAAAAAAAAGG - Intronic
1127756720 15:62099629-62099651 CTGTCAAACATGAAAAAAACTGG + Intergenic
1128100589 15:64995904-64995926 TTGATAAATATGAAGAAAAATGG + Intergenic
1128485067 15:68076990-68077012 CTGAAAAACATGAAGTTTAATGG + Intronic
1128854499 15:70997190-70997212 CTAAAATACATGAAGCAAAATGG - Intronic
1130010198 15:80146439-80146461 CTGTAAAACTAGAAGAAAATGGG + Intergenic
1130236941 15:82144253-82144275 CTCCAAAACAAAAAAAAAAAAGG + Intronic
1131899936 15:97076988-97077010 CTGTAAAACAAGAAGAACCAGGG - Intergenic
1131981085 15:97995505-97995527 CTGAAAAACAACAAGAGAAAAGG - Intergenic
1132219088 15:100091650-100091672 CCTGAAAACATGAGGAAAAATGG - Intronic
1133082843 16:3337153-3337175 CTCCAAAAAAAGAAAAAAAAAGG - Intergenic
1133343234 16:5052634-5052656 CTGGCAAAGATGAAGAGAAAGGG + Intronic
1133600416 16:7334778-7334800 CTGCAAAGGAGGAAGAAATAGGG - Intronic
1133919153 16:10136629-10136651 ATCCAAAATATGAAGAAAAATGG - Intronic
1133922814 16:10169213-10169235 TTGCAATGCATGCAGAAAAAGGG - Intronic
1134286631 16:12867675-12867697 CTGCAAAAAATGAAAAAAGTAGG - Intergenic
1134561804 16:15217216-15217238 CTGCAAACCATCCAGATAAATGG - Intergenic
1134922342 16:18128840-18128862 CTGCAAACCATCCAGATAAATGG - Intergenic
1135348001 16:21705644-21705666 CTGCAAAAAATACAAAAAAATGG + Intronic
1135690198 16:24530425-24530447 CTGAAAAATATTTAGAAAAAGGG + Intergenic
1136163621 16:28437700-28437722 CTGCAAAACAGGAGCAAAAGAGG - Intergenic
1136199343 16:28677287-28677309 CTGCAAAACAGGAGCAAAAGAGG + Intergenic
1136215687 16:28791462-28791484 CTGCAAAACAGGAGCAAAAGAGG + Intergenic
1136260413 16:29071294-29071316 CTGCAAAACAGGAGCAAAAGAGG + Intergenic
1136930576 16:34414624-34414646 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1136973998 16:34997184-34997206 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
1137839583 16:51627751-51627773 ATGAAAAAAATTAAGAAAAAAGG + Intergenic
1137853753 16:51773000-51773022 TTGGAAAAGAGGAAGAAAAAGGG + Intergenic
1138244600 16:55458112-55458134 CAGAAGAACATAAAGAAAAAGGG + Intronic
1139231761 16:65290231-65290253 CTGCATCACATGAAAAAAATGGG + Intergenic
1139502381 16:67377633-67377655 CTCAAAAAAAAGAAGAAAAAAGG - Intronic
1140172400 16:72619502-72619524 CTGCAAACAATGCAGAACAAGGG - Intergenic
1140273109 16:73483815-73483837 CTGCAAATTATGAAGAAAAATGG + Intergenic
1140615336 16:76656196-76656218 CTGAAAAACAGGATGAAAAAGGG - Intergenic
1140774937 16:78240874-78240896 CTCCAGAACATGAAGCCAAAGGG + Intronic
1141319951 16:82998861-82998883 CTGCAAAAAAAAAAAAAAAAAGG - Intronic
1141729886 16:85814931-85814953 CTAGAATACATGAAGACAAAAGG - Intergenic
1141943165 16:87291910-87291932 ATGGAAAACGTGAAGAAAATAGG - Intronic
1142622137 17:1171928-1171950 CTCAAAAAAATGAAGAAAGAGGG + Intronic
1143602262 17:7955493-7955515 CTGAAAAGCATGAAAGAAAATGG + Intergenic
1143759574 17:9091252-9091274 CTCTAAAACATAGAGAAAAATGG - Intronic
1144333065 17:14241701-14241723 AAGCAAAAGATTAAGAAAAAGGG - Intergenic
1145072986 17:19827133-19827155 TTACAAAACATTAAGAAAATAGG + Intronic
1146974676 17:37100517-37100539 GTGAAAAACATGAAAAACAAAGG + Intronic
1147624862 17:41893420-41893442 CTGCAAAGAATGGAGAAAGAAGG + Intronic
1148290078 17:46438306-46438328 CTAGATAACATGAAAAAAAAGGG - Intergenic
1148312246 17:46655878-46655900 CTAGATAACATGAAAAAAAAGGG - Intronic
1148403893 17:47393819-47393841 CTGAAAAACACCAAGAAAACGGG - Intronic
1149252296 17:54784279-54784301 ATGCAAAAGATGAAAAATAATGG - Intergenic
1149484952 17:57035343-57035365 CTACAAAAAATACAGAAAAATGG - Intergenic
1149605424 17:57921536-57921558 GTTCAAAACATGAAAAGAAAGGG + Intronic
1149940111 17:60855407-60855429 CTGGAAAAGATAAAGACAAATGG - Intronic
1150040970 17:61860657-61860679 CTCAAAAACAAAAAGAAAAAAGG + Intronic
1151945972 17:77320067-77320089 CTTCAAAACGGGAGGAAAAAGGG - Intronic
1152858183 17:82678417-82678439 CTAAAAAACAAGAACAAAAAAGG + Intronic
1153315290 18:3715276-3715298 CTGGAAAAGAGCAAGAAAAAGGG + Intronic
1155097289 18:22570037-22570059 CTGCAAAACATCAGGAATAAGGG - Intergenic
1155369806 18:25086469-25086491 TTTCAACACATTAAGAAAAATGG - Intronic
1155564328 18:27116535-27116557 CTGAAAAACATGAACAAAGTTGG - Intronic
1156593973 18:38524810-38524832 ATGGAAAACAGGAAGAAAAATGG + Intergenic
1156677740 18:39550904-39550926 CTCCAACACATGGAGAAACATGG + Intergenic
1157047617 18:44121735-44121757 GTGGAAGACATGAAGAAAGATGG + Intergenic
1157586983 18:48807266-48807288 ATGCAAAAAATCAAGGAAAAGGG + Intronic
1157607617 18:48935719-48935741 CTGGAACCCACGAAGAAAAAAGG + Intronic
1157846771 18:51010942-51010964 CTGCAAAACATGCCTAAAAATGG - Intronic
1158060921 18:53340416-53340438 CTGCAAAAGAAGATGAAAGAAGG + Intronic
1158540191 18:58346580-58346602 ATGGAAAAGATAAAGAAAAAAGG + Intronic
1159374887 18:67580421-67580443 CTGCAATATAAGAAGAAAAATGG - Intergenic
1159442864 18:68504256-68504278 ATGCAAAAGATGAAGAACAAGGG + Intergenic
1159582273 18:70246719-70246741 ATGCAAAATAGGAAAAAAAAAGG + Intergenic
1159740367 18:72160538-72160560 CAGGAGAAAATGAAGAAAAAAGG - Intergenic
1159826934 18:73224502-73224524 CTGAAAAAAATGAAAAAAAGAGG - Intronic
1160933128 19:1580056-1580078 CTGCAGAACTTGCAGAAATAAGG - Intronic
1161091847 19:2364410-2364432 CTGCAAAACAACAACAACAAAGG - Intergenic
1162236007 19:9309992-9310014 CTCCAAATCATGAAGAAACTAGG - Intergenic
1163084560 19:14969995-14970017 CTACTCAACATGAAGACAAAGGG + Intronic
1164154154 19:22579252-22579274 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
1164370568 19:27640192-27640214 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1164392442 19:27836930-27836952 CTACAAAACATAAAAGAAAAAGG - Intergenic
1165397531 19:35574043-35574065 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1166342873 19:42149336-42149358 CAGCAGAACACGCAGAAAAAGGG - Intronic
1168635007 19:57989365-57989387 CTGGAAAACGAGAAGGAAAAAGG + Intronic
926091451 2:10052825-10052847 CTACAAAACATCAATAGAAAAGG - Exonic
926467469 2:13208390-13208412 CTGCAAAAAAAAAAAAAAAAAGG + Intergenic
926610993 2:14946575-14946597 CTGCAAAACAGTAAGAGCAAAGG + Intergenic
926660446 2:15459777-15459799 CTGATAAAAATCAAGAAAAAGGG - Intronic
926717221 2:15934224-15934246 CTGCAAACCATGAAGAGCTACGG - Intergenic
926782389 2:16485572-16485594 ATGGAAAACATCAAGAAAAAGGG - Intergenic
926932183 2:18051715-18051737 CTTGAAAACAAAAAGAAAAAAGG - Intronic
927064333 2:19455766-19455788 AGGCAATACTTGAAGAAAAATGG - Intergenic
927760246 2:25746164-25746186 TTTAAAAACATTAAGAAAAATGG - Intronic
928257842 2:29740298-29740320 ATGAAAAAAAGGAAGAAAAAAGG + Intronic
928561366 2:32489897-32489919 CTTCAAAACATGCAAATAAAAGG - Intronic
929277614 2:40042840-40042862 AAGAAAAACATGAAGAAAAAGGG - Intergenic
930161479 2:48161827-48161849 CTGGCAAAGATGCAGAAAAAGGG + Intergenic
930248342 2:49007693-49007715 CTTCAAAACATTAGGAATAACGG + Intronic
930314507 2:49781247-49781269 GTGGAAAACATGAAGACAAGGGG - Intergenic
930494468 2:52124035-52124057 CTACAAACCATGATGAGAAAAGG - Intergenic
930560702 2:52956884-52956906 CTTCAAAACATAAACAAATAAGG + Intergenic
930566262 2:53024349-53024371 CTTCAAACTATGAAGCAAAAAGG - Intergenic
930849642 2:55945566-55945588 CTGAAAATGATGAAGAAACAAGG - Intergenic
930867589 2:56137079-56137101 CAGCAAAAAATCAAGAAAATTGG - Intergenic
931114465 2:59149443-59149465 CAGCAAAACATGAACAGTAATGG - Intergenic
931350898 2:61487723-61487745 CTGCAAATCATTTAGGAAAAAGG + Intronic
931469993 2:62529870-62529892 CTGCAAAACATTATACAAAAGGG - Intergenic
931853606 2:66278675-66278697 CTGCAAAACATGCACAATCATGG - Intergenic
931942632 2:67269476-67269498 CTGCAAAACATAAAAAAGCAAGG + Intergenic
932016406 2:68032333-68032355 CTGCCAAACATTATCAAAAATGG + Intergenic
932508655 2:72262816-72262838 CTGCAAATCAATAAGACAAAAGG + Intronic
932647352 2:73517412-73517434 CTACAAAACATAAAAAAAATAGG - Intronic
932652965 2:73579627-73579649 CAGCAAAACTTTAAGAATAAAGG - Intronic
932653755 2:73588608-73588630 GTACAAAAAGTGAAGAAAAAAGG + Intronic
933093918 2:78154407-78154429 CAGAAAAACATGATAAAAAATGG - Intergenic
933282694 2:80349555-80349577 CTGGAAAACAGGAAAAAAAAAGG - Intronic
933572872 2:84034456-84034478 TTGCAATTCATAAAGAAAAAAGG - Intergenic
934485773 2:94708400-94708422 CTGCAACCCATGAGGAAATACGG + Intergenic
934505139 2:94884887-94884909 CTGCAATACATGCAAACAAATGG + Intergenic
934872706 2:97881704-97881726 CTGCAAAAAAAAAAAAAAAAGGG + Intronic
935143182 2:100373907-100373929 TTCCAAAACATTTAGAAAAAGGG + Intergenic
935557566 2:104527059-104527081 CTGCAAAAGGTTAAGATAAATGG - Intergenic
936691095 2:114889804-114889826 CTGCAAAACATGAAGAAAAAGGG - Intronic
936860814 2:117017935-117017957 CTGTAAAATATCAAGTAAAAGGG + Intergenic
936890446 2:117363889-117363911 TTCCAAAAGATTAAGAAAAAGGG + Intergenic
936892451 2:117388760-117388782 CTCAAAAACATGAAAAAACAAGG - Intergenic
937124957 2:119468890-119468912 CTGAACAACATGTAGAAGAAGGG + Intronic
937397440 2:121549703-121549725 CTGCAAAAAAAAAAAAAAAAAGG + Intronic
938270318 2:129964533-129964555 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
938703879 2:133902887-133902909 CTGCGAAAGAGGAAGAAAATGGG + Intergenic
938910131 2:135877899-135877921 CTCCAAGACATTAAGAGAAACGG + Intergenic
939034278 2:137112228-137112250 TTGAAAAAAATAAAGAAAAAAGG + Intronic
939127497 2:138194713-138194735 CTCCAAAACATGAAGAGTAGTGG + Intergenic
939188928 2:138892894-138892916 ATCAAAAACATGAAGAAAACAGG + Intergenic
939326355 2:140694496-140694518 CTGCAGAAGATCATGAAAAAGGG - Intronic
939702408 2:145410027-145410049 ATGAAAAACATGAAGATAACTGG + Intergenic
939958260 2:148544886-148544908 CTCAAATACATCAAGAAAAAAGG - Intergenic
940099703 2:150020542-150020564 TTTCAAAACATGGAGAAAGATGG - Intergenic
940336093 2:152528999-152529021 CTGCAAAAAAGGATGAGAAACGG + Intronic
940452989 2:153864298-153864320 ATTCAAAACATGGAGAGAAAAGG + Intergenic
940767914 2:157809908-157809930 CTACAAAAAATAAAGAAAATTGG + Intronic
940785318 2:157974845-157974867 CTAAAAAACAGGTAGAAAAATGG - Intronic
941039847 2:160608930-160608952 CTGCAAAACATGAAGCAGGCAGG - Intergenic
941147446 2:161867757-161867779 ATAGAAAACATGAAGAAAGAAGG - Intronic
941446931 2:165613054-165613076 CTGCAAAAAATGTGGAGAAAAGG - Intronic
943158358 2:184214193-184214215 TTCCAAAAGATGAAGAAAGAAGG - Intergenic
943599994 2:189905533-189905555 CTGCAGACCTTGAAGACAAAAGG - Intronic
943864561 2:192913151-192913173 CAAGAAAACATGAACAAAAATGG + Intergenic
944325194 2:198396198-198396220 ATGAAAACCATAAAGAAAAAAGG - Intronic
944475232 2:200096928-200096950 TTGCAAATAATGTAGAAAAATGG - Intergenic
945103110 2:206281778-206281800 CTGAAAAACAAAAAGAAAAATGG - Intronic
945803958 2:214467395-214467417 CTGCAAAAGTTGAGGAAACAGGG - Intronic
946131885 2:217612875-217612897 CTGCAAAACAAGTAGCAAAGGGG + Intronic
946363834 2:219236299-219236321 CTGAACAAGAGGAAGAAAAATGG - Intronic
947649113 2:231769399-231769421 CTGCTAAAGATTAAGAAAAAGGG - Intronic
949048932 2:241886736-241886758 CTGCAGAGAATGAGGAAAAATGG + Intergenic
1168916420 20:1491859-1491881 CTGCACATCATGAATAATAATGG - Intergenic
1169058846 20:2645825-2645847 CTCCAAAACAGGAAGAAAAAAGG + Intergenic
1169614380 20:7423709-7423731 CTGCAAGAGTTGAAGAACAATGG + Intergenic
1169924942 20:10773342-10773364 ATGCAAAAGATGAGGAAAGAGGG - Intergenic
1170268359 20:14495369-14495391 AGGCAAAACATGAAAAAAAGTGG + Intronic
1170277428 20:14607569-14607591 CTGCAAGACATGGTGAGAAATGG - Intronic
1170565172 20:17596443-17596465 CTGCAATATATGAACAGAAAAGG - Intronic
1170822733 20:19767954-19767976 CTGCGAAACATGGAGAGAGACGG + Intergenic
1171059067 20:21938672-21938694 CTAAAAAACATGAACAACAAGGG - Intergenic
1171129482 20:22637175-22637197 CTGAAAGAATTGAAGAAAAATGG - Intergenic
1171892802 20:30731649-30731671 CTGCAATACATGCAAACAAATGG + Intergenic
1171969813 20:31557170-31557192 CTGCAAATTATGAAGACACATGG - Intronic
1173122756 20:40308701-40308723 CATGAAAACATGAAGGAAAATGG + Intergenic
1173140520 20:40477840-40477862 CTGCAAAACATGAGAATAAAAGG - Intergenic
1173956341 20:47035841-47035863 CTGAAAAAAAAAAAGAAAAAGGG + Intronic
1174585696 20:51606370-51606392 CTACAAAACATACATAAAAATGG + Intronic
1174853166 20:54016802-54016824 CCCCAAAAGAGGAAGAAAAATGG - Intronic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1176595178 21:8687083-8687105 CTGCAAAATATGAAGAAACAAGG + Intergenic
1176620998 21:9061003-9061025 CTGCAATACATGCAAACAAATGG - Intergenic
1176674033 21:9760518-9760540 CTGCTAAACATGCAGAAAGTAGG - Intergenic
1176674045 21:9760587-9760609 CTGCTAAACATGGAGAAAGTAGG - Intergenic
1176993885 21:15531072-15531094 CTGTAATTTATGAAGAAAAAAGG - Intergenic
1177059898 21:16358219-16358241 CTGAAATAAATGAAGAAAACAGG + Intergenic
1177248561 21:18563201-18563223 CTGCCAAACCTGAGGAAGAAAGG - Intergenic
1177419859 21:20842589-20842611 GTGCCCAAAATGAAGAAAAATGG - Intergenic
1177429875 21:20978184-20978206 CTGGCAAGGATGAAGAAAAAAGG - Intergenic
1177522482 21:22245133-22245155 ATCCAAAAGATAAAGAAAAAAGG + Intergenic
1177811486 21:25929317-25929339 ATGCCAAAAATGTAGAAAAAAGG + Intronic
1178179077 21:30139041-30139063 GTGTAAAACATGGAGAGAAATGG - Intergenic
1180742964 22:18066578-18066600 CTGCAGAACAGGAAGAGGAAGGG - Intergenic
1180797725 22:18614970-18614992 CTGCACAACATGATGAGAACAGG - Intergenic
1180838431 22:18945255-18945277 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
1181102432 22:20550354-20550376 CAGGACAACATGAAGAAGAAAGG - Intronic
1181223992 22:21380290-21380312 CTGCACAACATGATGAGAACAGG + Intergenic
1181254641 22:21554527-21554549 CTGCACAACATGATGAGAACAGG - Intronic
1181577645 22:23805503-23805525 CTCAAAAAAAAGAAGAAAAACGG - Intronic
1182195157 22:28508218-28508240 ATGCAAAACAGAAAAAAAAAAGG + Intronic
1182862132 22:33569364-33569386 CTGCAAAACAGGAAGACTACAGG + Intronic
1183193852 22:36339700-36339722 CTGCAAAGTTTAAAGAAAAAAGG + Intronic
1183694100 22:39410106-39410128 CTCAAAAAGAAGAAGAAAAACGG - Intronic
1183813788 22:40281449-40281471 TTGAAAAACATGAAGAGAGATGG - Intronic
1183843797 22:40523102-40523124 CTTTGAAAAATGAAGAAAAATGG + Intronic
1184203514 22:42985608-42985630 TTGCAAAACATAAAGATAACAGG + Intronic
1184218620 22:43084458-43084480 CTGCAAAGAAAGAAGGAAAAAGG - Intronic
1184317676 22:43709380-43709402 ATGCTAAAAATGAAGAAATAAGG - Intronic
1184375624 22:44110520-44110542 CTGAAAAAGATGAACAAAACTGG - Intronic
1184590786 22:45481657-45481679 CAACAAAAAATAAAGAAAAAAGG + Intergenic
1184780376 22:46646087-46646109 CAGCAACACAGGAAGAAGAAAGG - Intronic
1185042920 22:48514784-48514806 CTGCCAGACATGAATAGAAAAGG - Intronic
949585978 3:5437629-5437651 CTGCATAAGATGAAGAAGCATGG - Intergenic
950030603 3:9850250-9850272 CTGCCAAACCTGAGGAAGAAGGG - Intronic
950988623 3:17406016-17406038 CTGCCATTTATGAAGAAAAAAGG + Intronic
951261400 3:20514105-20514127 CTGCAAAAAATAAAAAAAGAAGG - Intergenic
951338049 3:21448411-21448433 CTGCAAAGAAGGAAGAAAAATGG + Intronic
951449119 3:22816974-22816996 CTGCCAAGCATGTAGAAAACTGG + Intergenic
951456379 3:22896606-22896628 TTGCAACACATTAAAAAAAAGGG - Intergenic
951529417 3:23684793-23684815 CTACAAAAAATAAAAAAAAATGG - Intergenic
951539224 3:23766407-23766429 CTCAAAAAGAAGAAGAAAAAGGG - Intergenic
951878072 3:27450505-27450527 CTTCAAAACATAAAGAAAAGTGG + Intronic
952077709 3:29718092-29718114 ATGAAAAACATCAGGAAAAAGGG - Intronic
954562257 3:51567278-51567300 CTGCGAAACATGTAGAAATGTGG - Intronic
955851641 3:63226207-63226229 CTGGAAAAGATGTGGAAAAAAGG + Intergenic
955907201 3:63819547-63819569 CAGCAACTCAAGAAGAAAAATGG + Exonic
956043078 3:65167192-65167214 CAGCCAAACTTCAAGAAAAAAGG - Intergenic
956244599 3:67168243-67168265 ATGCAAAACATGATTAAACAGGG + Intergenic
956983301 3:74666219-74666241 CTGCAAGATATTAAGAAAGAAGG + Intergenic
958668114 3:97166538-97166560 CTGCCAAATATGAATAAATATGG - Intronic
958764415 3:98347822-98347844 CTGGCAAAAATGAAGAGAAAAGG + Intergenic
958954536 3:100452956-100452978 TTGCAAAACAGGAATAATAATGG + Intronic
959070571 3:101698421-101698443 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
960027644 3:113026845-113026867 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
960295010 3:115932247-115932269 CTCCAAATCATTAAGAAAATGGG + Intronic
960624243 3:119665016-119665038 TTGCATAAACTGAAGAAAAAGGG - Intronic
961297388 3:125897168-125897190 CTGCCAAACCTGAGGAAGAAAGG + Intergenic
961794809 3:129401852-129401874 CTGGAAAACAAGAAGACACAGGG + Intronic
962509280 3:136082960-136082982 CTGGCAAAAATGAAGTAAAAAGG - Intronic
962633364 3:137302450-137302472 CTGTAAAACATGAACAAAAGGGG - Intergenic
962634933 3:137320911-137320933 CTGCAAAGCACTTAGAAAAATGG - Intergenic
962902165 3:139771040-139771062 CTGCAAAAAGTCAGGAAAAAGGG - Intergenic
963668650 3:148223303-148223325 AGGCAAAACAGGAAAAAAAAAGG + Intergenic
963963620 3:151339450-151339472 CTTCCAAATATAAAGAAAAAAGG - Intronic
964037800 3:152219512-152219534 TTACAAAACCTGGAGAAAAAAGG - Intergenic
964048838 3:152366394-152366416 CAGCAAAATAAGAAGACAAATGG - Intronic
964099185 3:152968287-152968309 CTGAAAAAGATGAAGAAATAAGG - Intergenic
964327165 3:155559787-155559809 CTGGAAAACAGGAAGTAAGAAGG + Intronic
965035925 3:163437939-163437961 CTGTCAAACATGTAGAGAAAAGG + Intergenic
965173287 3:165296364-165296386 CGGCAAGAAATGAAGAAAGAAGG - Intergenic
966041474 3:175494917-175494939 CTGCAAATCTTGAAAAAATAAGG - Intronic
966177338 3:177152597-177152619 CTGCAAAAAGCTAAGAAAAAGGG - Intronic
966193590 3:177292575-177292597 GTTCAAAACATGAGAAAAAAGGG - Intergenic
966454257 3:180096822-180096844 ATGCTAAACATGAGTAAAAACGG - Intergenic
966457824 3:180137717-180137739 CTGCAAAACCTGAAGGAATGAGG - Intergenic
966480110 3:180398212-180398234 CTCTAAGACATGAAGATAAAAGG + Intergenic
967026075 3:185565123-185565145 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
967117643 3:186356080-186356102 TTGAAAAAGATGAAGAAATATGG + Intronic
968738509 4:2313420-2313442 CTACAAAAAATGTAAAAAAATGG - Intronic
968782220 4:2591627-2591649 CTTATAAACATGAAGAAAAAAGG - Intronic
968937014 4:3616672-3616694 CAGCAAAACACCAAAAAAAAGGG - Intergenic
969925086 4:10577819-10577841 CTGCAAGACATTTAAAAAAATGG - Intronic
969977645 4:11120608-11120630 TTGCACAATATGAAGAAAATGGG - Intergenic
970203160 4:13629529-13629551 CTCAAAAACAAGAAAAAAAAAGG + Intergenic
970293966 4:14607794-14607816 ATGCAAACAATGAAGAGAAAAGG + Intergenic
971130687 4:23806241-23806263 CTGCTAAAAATGAAAATAAAAGG + Intronic
971228564 4:24778504-24778526 CTGAAAAAAATGTGGAAAAATGG - Intergenic
971564463 4:28119917-28119939 CTGAAGAACAGGAAGAAAAAAGG - Intergenic
971643634 4:29167087-29167109 CTGCAAAAAATAAAGAAATATGG + Intergenic
971798904 4:31262848-31262870 CAGCAATAAATGAAGAAAGAGGG - Intergenic
972138533 4:35925179-35925201 CTGAAAGACATGAAAGAAAAGGG + Intergenic
972409772 4:38781912-38781934 CTGTAAAATATGAATAATAATGG - Intronic
972578819 4:40376879-40376901 CTACAAAAAATGTAGAAAATTGG + Intergenic
973116738 4:46470017-46470039 CTGCAACAAATTAAGTAAAAAGG + Intronic
973127103 4:46600362-46600384 CTGGAAAAGATGTAGAGAAAAGG + Intergenic
973595780 4:52488010-52488032 CTGTCAAAAAAGAAGAAAAAAGG + Intergenic
973660626 4:53102743-53102765 CTGAAAATCATGTATAAAAATGG - Intronic
973765763 4:54160963-54160985 ATGCAAAATATGTAAAAAAAAGG - Intronic
974189459 4:58485790-58485812 TTGAAAAACAAAAAGAAAAAAGG - Intergenic
974394681 4:61319511-61319533 CTGCAACACATGAGGGAAAGGGG - Intronic
974407740 4:61497098-61497120 CTGCAAAAAAGAAAAAAAAAAGG - Intronic
974509908 4:62825625-62825647 CTGCCTACCATGAAGAAAAGAGG - Intergenic
974669624 4:65013349-65013371 AGGAAAAAAATGAAGAAAAAGGG - Intergenic
974847402 4:67367425-67367447 CAGAAAAACATGAAAATAAAGGG + Intergenic
974982200 4:68972466-68972488 TTGCTAAACATGAAAAAAAGGGG - Intergenic
975229383 4:71913537-71913559 CTGAAAAACATGCAGAAAACAGG - Intergenic
975267055 4:72382408-72382430 CTGGAAACCATGCAGAGAAAAGG + Intronic
975757130 4:77582043-77582065 CTGGAAAACATAGAAAAAAATGG + Intronic
976035572 4:80816322-80816344 CTGGAAAACTTTGAGAAAAAAGG + Intronic
976151672 4:82098830-82098852 CTGCAAAAACTAAAGGAAAAGGG + Intergenic
976579374 4:86717500-86717522 ATGCAAAAAATAAAGGAAAAAGG - Intronic
976676283 4:87707413-87707435 CTGGAAGACTTGAAGAAAAAAGG - Intergenic
976828518 4:89286549-89286571 CTAAAAAACACAAAGAAAAAAGG - Intronic
977590550 4:98821552-98821574 CAGCAAAACAGAAAAAAAAAGGG - Intergenic
977728683 4:100326200-100326222 CTGCAGAAGATGAGAAAAAATGG - Intergenic
977926727 4:102708965-102708987 CTGAAAAACATAGAGAAAATAGG + Intronic
978137313 4:105277965-105277987 CTGCATAAGATGAATAAACAGGG + Exonic
978461589 4:108960338-108960360 ATGTAAAACATTAATAAAAATGG + Intronic
978611383 4:110544990-110545012 CTGCAGCACATGAGGAAAATGGG + Intronic
978629205 4:110723728-110723750 TTCCAAAAGATAAAGAAAAAGGG - Intergenic
978964201 4:114722361-114722383 ATGGAAAATATGAAGAAATAAGG + Intergenic
979442902 4:120773275-120773297 TTGAAAAAAATAAAGAAAAAAGG + Intronic
979758517 4:124372084-124372106 GTGCTAAACATGAAAACAAAAGG - Intergenic
979790487 4:124774474-124774496 CTCCAAAACATACAGAAAAAGGG - Intergenic
980723231 4:136723746-136723768 CTGCAAATCAATCAGAAAAATGG + Intergenic
981078267 4:140612883-140612905 CTGTAAAATATGAACCAAAAGGG + Intergenic
981301959 4:143197133-143197155 GTGCTACAGATGAAGAAAAAAGG - Intronic
981916456 4:150039210-150039232 CTGAAAGTCATGAAGAAATAGGG + Intergenic
981944665 4:150327252-150327274 CTACAAAAAATAAAGAAAATTGG + Intronic
982522165 4:156431836-156431858 TTGAAAAACATGAAAAAGAAAGG + Intergenic
982589660 4:157291134-157291156 CAGAAAAACATGGAGAAAATTGG - Intronic
982801074 4:159708545-159708567 CTGCCAAATATGTAGAATAAGGG - Intergenic
983215687 4:165000314-165000336 CTGCCAAACCTGAGGAAGAAGGG + Intergenic
983403796 4:167299540-167299562 CTGAAAGACATACAGAAAAAAGG + Intergenic
983557440 4:169071012-169071034 CTTCAAACCATGAACAAACAAGG + Intergenic
984042516 4:174752951-174752973 ATGGAGAACATGAAGAAACATGG - Intronic
984301691 4:177927889-177927911 CTCAAAAACATGAAGCAAAAAGG - Intronic
984523682 4:180830760-180830782 CAGCACAGCATGAAGGAAAAAGG + Intergenic
985050248 4:185983540-185983562 CTGCAAAAAAAAAAAAAAAAAGG - Intergenic
985431408 4:189884664-189884686 CTGCAAAACATACAGCAGAAAGG + Intergenic
986263430 5:6169309-6169331 CAGCAAAAGATAAAGAAAAAAGG + Intergenic
986420437 5:7575523-7575545 CAACAAAACAAGAACAAAAAAGG - Intronic
986613317 5:9591534-9591556 CTACAAATCATCAAGAAAAAGGG + Intergenic
986817297 5:11426745-11426767 CTGAAAAACATGAAGAATTGAGG + Intronic
987592054 5:19942573-19942595 CAGGAAAACATGAGTAAAAATGG - Intronic
988268773 5:28986889-28986911 CTGGAAAAAATGATGAAAGAAGG - Intergenic
988380197 5:30489220-30489242 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
988847216 5:35140245-35140267 ATGTAATAAATGAAGAAAAAGGG + Intronic
988868419 5:35361009-35361031 CAGCATCACATGAAGAAAAGGGG + Intergenic
988915100 5:35884132-35884154 TGGCAAAAGGTGAAGAAAAAAGG - Intergenic
989263668 5:39447866-39447888 GTCCTAAAAATGAAGAAAAATGG + Intronic
989628206 5:43453243-43453265 CTGTAAAACATAAAGAATAAGGG + Intronic
989706804 5:44343391-44343413 GTGCTAAACATGAATAAAACTGG - Intronic
990172831 5:53073729-53073751 CACCAAATTATGAAGAAAAAAGG + Intronic
990395836 5:55377326-55377348 CTAAAAAAAAAGAAGAAAAAAGG + Intronic
990673017 5:58153578-58153600 CTGCAAAAAAAAAAAAAAAAAGG + Intergenic
990761217 5:59131686-59131708 ATGCAAAACAAGGACAAAAAGGG - Intronic
991100031 5:62781830-62781852 CTGCAAAAAAAAAAAAAAAAAGG - Intergenic
992200295 5:74377155-74377177 AAGCATAACATGAAGAAACAAGG - Intergenic
992435114 5:76748747-76748769 GTGACAAACATAAAGAAAAAGGG - Intergenic
993181024 5:84552276-84552298 CTGCAGAACATGCAGCTAAAGGG + Intergenic
993626037 5:90225694-90225716 TTCCTAAACATTAAGAAAAAAGG + Intergenic
993726301 5:91370739-91370761 CTGCAAAACATACAGCAAAAAGG + Exonic
993780282 5:92058096-92058118 CTACAAAATCTGATGAAAAATGG - Intergenic
993844173 5:92919724-92919746 CAGCAAAAAATGAAGGAGAAAGG - Intergenic
994384056 5:99107391-99107413 CTGAAATACATGAAAACAAATGG - Intergenic
994604341 5:101947919-101947941 CTACAAAAAATGGAGAAAACAGG - Intergenic
994924428 5:106096198-106096220 AAGCTAAACCTGAAGAAAAATGG - Intergenic
995167633 5:109064274-109064296 CTAAAAAACATTAGGAAAAAAGG - Intronic
995354914 5:111225892-111225914 CTGAAAAACTTGATCAAAAATGG - Intronic
995430113 5:112065076-112065098 CTGCATAAAAGCAAGAAAAATGG - Intergenic
995668503 5:114572941-114572963 GTGATAAATATGAAGAAAAAAGG + Intergenic
995847322 5:116508335-116508357 CAGCCAAGCATGAAGCAAAAGGG + Intronic
995902230 5:117083358-117083380 CTGCAAAGCATGCAGCAAACAGG + Intergenic
995962552 5:117860538-117860560 GTGCAAACCATGAAGATGAAGGG + Intergenic
996045094 5:118862946-118862968 GTCCAAAGCAAGAAGAAAAAGGG - Intronic
996937296 5:128964279-128964301 CTGCAGAACATGAGGCAGAAGGG + Intronic
997026076 5:130063296-130063318 CTCCAAAAGTTGAAGACAAAAGG - Intronic
997798687 5:136838119-136838141 CAGAAAAATATGAAGAAGAAAGG - Intergenic
997931377 5:138074879-138074901 CTCCAAAAAAAGAAAAAAAAAGG + Intergenic
999792993 5:154959928-154959950 CGGCTAAACCTGAAGTAAAATGG - Intronic
999951920 5:156660281-156660303 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1000167569 5:158669138-158669160 ATTCAATAAATGAAGAAAAATGG - Intergenic
1000468987 5:161615512-161615534 CAGGAAAACATGATGAAAATAGG + Intronic
1002410607 5:179072389-179072411 CTGAAAAACAGGGAGAAAAAAGG + Intronic
1003396095 6:5753220-5753242 CTGCAAACTTTGAAGAAAGATGG + Intronic
1003706257 6:8534409-8534431 CAGGAAAACACGAAGAAAATGGG - Intergenic
1003883663 6:10501300-10501322 CTGAAAAACAGGAAAAAAATGGG - Intronic
1004112244 6:12730541-12730563 CTGCAAAGGAAGAGGAAAAAGGG + Intronic
1004204653 6:13580959-13580981 CTTCACAACAAGAAAAAAAAGGG - Intronic
1004292403 6:14380335-14380357 CTGATAAACATGAAGAAAGTTGG - Intergenic
1004384456 6:15160355-15160377 CTACAAAACATAAACAAAAATGG - Intergenic
1004729650 6:18345362-18345384 TTGCAAAACATTAACAAGAAAGG + Intergenic
1005210965 6:23462355-23462377 ATGCAAAACTAGAAGCAAAAGGG + Intergenic
1005528174 6:26673198-26673220 CTGCAAAGAAGGAGGAAAAAAGG - Intergenic
1005542621 6:26828441-26828463 CTGCAAAGAAGGAGGAAAAAAGG + Intergenic
1005717978 6:28569819-28569841 CTGCAAAACAAGCAGAAAATAGG + Intergenic
1005722132 6:28613800-28613822 CCACAAAACATACAGAAAAATGG + Intronic
1006334684 6:33414454-33414476 CTGGGAGAAATGAAGAAAAATGG - Intronic
1006958171 6:37896171-37896193 CTGTAAAAGAAAAAGAAAAAAGG - Intronic
1007837824 6:44688891-44688913 CTCCAAAAGATGGAGAAAGATGG - Intergenic
1007950195 6:45865318-45865340 CTGTAAAACATAATGTAAAAGGG - Intergenic
1008020893 6:46575943-46575965 CTGTAATTTATGAAGAAAAAAGG + Intronic
1008308159 6:49931396-49931418 CTGCAAAATAAGAAGGATAATGG - Intergenic
1008350542 6:50484555-50484577 CAGAAAAACAAAAAGAAAAAGGG + Intergenic
1008689949 6:53966822-53966844 CTGAAAAAGATCAAGAAAGAGGG + Intronic
1009013436 6:57870558-57870580 CTGCAAAGAAGGAGGAAAAAAGG + Intergenic
1009311600 6:62160452-62160474 CTGCACAAAATGAATAAACAAGG + Intronic
1009451759 6:63809548-63809570 ATTGGAAACATGAAGAAAAAAGG + Intronic
1009997064 6:70907566-70907588 CTGCAAAGGATGCAGAAACATGG - Intronic
1010014441 6:71087804-71087826 CTGCAAAACAGGATGAGAGATGG - Intergenic
1010355528 6:74928227-74928249 CTGTAAAAGAATAAGAAAAATGG - Intergenic
1010591671 6:77719509-77719531 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1010665392 6:78623867-78623889 TTGCCAAACCTAAAGAAAAATGG - Intergenic
1010851070 6:80778731-80778753 CTGGCAAACATGAAGAGAAAAGG + Intergenic
1010947811 6:81998800-81998822 CAGCTATACATGAAGATAAATGG + Intergenic
1011175425 6:84554355-84554377 ATGCAAAATATTAAGACAAAAGG + Intergenic
1011855326 6:91682709-91682731 CTGCAGACCATGTAGAAAAAAGG - Intergenic
1011860440 6:91748295-91748317 ATGCAAAACAAGAAGAAATTAGG + Intergenic
1012213690 6:96556571-96556593 ATGCAAAACATGGAGTCAAAGGG - Intergenic
1012347671 6:98211383-98211405 CTGTAAAACTTGAAGAAAACAGG + Intergenic
1012616852 6:101288064-101288086 CTGTAAAACAGAAATAAAAATGG + Intergenic
1013257541 6:108403555-108403577 ATGCAAAGCATGAATATAAAGGG - Intronic
1013682933 6:112544964-112544986 TTGCAAACAATGAAAAAAAAGGG + Intergenic
1013760515 6:113512136-113512158 CTGGAAAAGAGGAAGAAAGAGGG - Intergenic
1013958425 6:115868072-115868094 ATGAAAGACAAGAAGAAAAAGGG - Intergenic
1014017883 6:116554574-116554596 CTGCAAAACCTTGAGTAAAATGG + Intronic
1014882288 6:126738082-126738104 CTGCAAAAGATGCAAAACAATGG - Intergenic
1014937960 6:127405929-127405951 CTGAAAAATATCAAGAAATATGG + Intergenic
1015438612 6:133220539-133220561 CTTTAAAAAATGAAGAAAATTGG + Intergenic
1015634433 6:135261916-135261938 CTACAAAAAATGAAGAAACTAGG - Intergenic
1015728106 6:136320277-136320299 CTACAAAAAATAAAGAAAATTGG + Intergenic
1015833051 6:137390083-137390105 CTACAAGACAAGAAGAACAAAGG + Intergenic
1015886799 6:137926115-137926137 CTGAAAAACATAAACAAAACTGG + Intergenic
1016370655 6:143370827-143370849 TTGCAAAAAATAAACAAAAATGG - Intergenic
1016722774 6:147321927-147321949 CAGCCAAACATGATGCAAAATGG - Intronic
1016755703 6:147683548-147683570 GAGAAAAAGATGAAGAAAAAGGG - Intronic
1017089951 6:150750405-150750427 CTGCAGAACTTCAAGGAAAACGG - Intronic
1017661458 6:156678193-156678215 CTGGAAAACCTTAAGAAGAAAGG - Intergenic
1017674956 6:156803815-156803837 TTCCTAAACATGATGAAAAATGG - Intronic
1018003583 6:159600753-159600775 GTTCAAAACATGAAAAAAATTGG - Intergenic
1018035067 6:159874743-159874765 CTGCAGGACAGGAAGCAAAATGG + Intergenic
1018387257 6:163316227-163316249 CTGCATAAAATGAAGAAATGAGG + Intergenic
1018679324 6:166251519-166251541 CTTAAAAAGAAGAAGAAAAACGG - Intergenic
1019230862 6:170561580-170561602 TGGATAAACATGAAGAAAAATGG - Intronic
1019951589 7:4377557-4377579 CTGCAAAACAGGAATGAATATGG - Intergenic
1019976347 7:4585001-4585023 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1019977283 7:4593505-4593527 CTGCCAAACCTGAGGAAGAAGGG - Intergenic
1020340530 7:7104875-7104897 ATACAAAACATGAAGTAGAAGGG + Intergenic
1020604985 7:10326029-10326051 TTGCAAATCAAGAAGTAAAATGG + Intergenic
1020740041 7:12004420-12004442 CTGAAAAAGATGAACAAAATGGG - Intergenic
1020769087 7:12365043-12365065 GTGCAAAAGATGAAGAAAGATGG + Intronic
1020769090 7:12365097-12365119 GTGCAAAAGATAAAGAAAGATGG + Intronic
1020941845 7:14549210-14549232 CTGCAAAACACTCAGAAAGATGG + Intronic
1021714976 7:23453242-23453264 CTTTTAAACAAGAAGAAAAAAGG + Intronic
1022526288 7:31039661-31039683 CTGTAAAATGTGAAGAATAATGG - Intergenic
1022837984 7:34135191-34135213 CTGTGAATCATGAACAAAAATGG + Intronic
1023165739 7:37342215-37342237 CTGCAAAAAATGAAAAAAAAGGG + Intronic
1023672344 7:42591000-42591022 TTGCAAAACAAAAAAAAAAAGGG - Intergenic
1024238608 7:47416410-47416432 CTGTTAAACATTAACAAAAAAGG + Intronic
1024303860 7:47909801-47909823 CAGCATAATAAGAAGAAAAAAGG + Intronic
1024493938 7:50020739-50020761 TGGAAAAAAATGAAGAAAAATGG + Intronic
1024829958 7:53439384-53439406 ATGAAAAACATGGGGAAAAAGGG - Intergenic
1026086303 7:67265946-67265968 CTGCAAATCACGCTGAAAAAAGG + Intergenic
1026488753 7:70845244-70845266 CTGAAAAGCAAGAAGGAAAATGG + Intergenic
1026690843 7:72548873-72548895 CTGCAAATCACGCTGAAAAAAGG - Intergenic
1026953252 7:74361219-74361241 CTGAAAAAAAGAAAGAAAAAGGG - Intronic
1027341921 7:77218733-77218755 CTACAAAAAATAAAAAAAAATGG - Intronic
1027348411 7:77286073-77286095 CTGGATAACATAAAGAAAAGAGG + Intronic
1027580113 7:79982426-79982448 CTGCAAAACATGAATTAAAGGGG - Intergenic
1027637804 7:80697373-80697395 ATGCACAACATGAAGACAATGGG + Intergenic
1028112277 7:86955948-86955970 CTGCAAAAAACAAAAAAAAAAGG + Intronic
1028138934 7:87250795-87250817 CTACAAATCAGCAAGAAAAATGG - Intergenic
1028226785 7:88261402-88261424 CAGCAAAAAATGAAGAAGAAAGG - Intergenic
1028893861 7:96018924-96018946 CTTCATATCATGGAGAAAAATGG - Intronic
1029535202 7:101154021-101154043 CTGGAAAACAGAAAGACAAAGGG - Intergenic
1029831310 7:103262467-103262489 TTTTAAAACATGAAAAAAAAAGG + Intergenic
1029923457 7:104290868-104290890 CTGCAAAGCAGGAAGCAAAGTGG + Intergenic
1029954669 7:104625232-104625254 AAGCAAAACATGAAAAAAGAAGG + Intronic
1030091400 7:105862010-105862032 CTGCAAAAGATGATGAGGAAGGG + Intronic
1030341036 7:108381235-108381257 TTGGGAAAAATGAAGAAAAATGG - Intronic
1030401858 7:109061670-109061692 ATGCATAACATGAAAAAATAAGG + Intergenic
1030460127 7:109824916-109824938 CTTCAGAACATGAAGAACAATGG - Intergenic
1030486764 7:110178548-110178570 CTGCATTACATAAAGAAATATGG - Intergenic
1030522468 7:110615210-110615232 CTGCTCAGCATGCAGAAAAAGGG - Intergenic
1031200688 7:118681204-118681226 GTGAAAAACCAGAAGAAAAAAGG + Intergenic
1031237520 7:119196216-119196238 CTTTAACACAAGAAGAAAAATGG + Intergenic
1031299799 7:120050870-120050892 CTGCAAAAAAGAAAAAAAAAAGG - Intergenic
1031795832 7:126173659-126173681 TTGAGATACATGAAGAAAAAAGG + Intergenic
1031934238 7:127719503-127719525 CAGAAAAACATGAAGATTAATGG - Intronic
1032729089 7:134619873-134619895 AAGCAAAACATGATGAAAGAGGG - Intergenic
1032739117 7:134721326-134721348 CTGCAAAAAAAAAAAAAAAAAGG + Intergenic
1032959676 7:137016900-137016922 TGGCATAACAAGAAGAAAAATGG - Exonic
1033430861 7:141288387-141288409 CTGCAACAGATGAGGAATAAAGG - Intronic
1034021051 7:147642552-147642574 GTACAAAACATCAGGAAAAATGG + Intronic
1034849270 7:154478891-154478913 ACGCAAGAGATGAAGAAAAATGG + Intronic
1035440044 7:158889516-158889538 TTGGGAAACATGAAGAAAATAGG - Intronic
1035529779 8:342197-342219 CTGCAAGACGTGAAAGAAAAAGG + Intergenic
1036095577 8:5721529-5721551 CTGTGAAACTTGTAGAAAAAAGG + Intergenic
1036291895 8:7500450-7500472 CTGCCAAACCTGAGGAAGAAGGG - Intronic
1036503109 8:9331383-9331405 CTTAAAAACATGAAGAAAGTGGG - Intergenic
1037150456 8:15628839-15628861 CTTCACACCATGAAGAAAACAGG - Intronic
1037552539 8:19988919-19988941 CAGCAAAAGATAAAGAAAACTGG + Intergenic
1038390482 8:27194114-27194136 CTGAAAAACAGAGAGAAAAAAGG - Intergenic
1038619649 8:29128960-29128982 CTGGAAAACAGGAAGAGAACAGG - Intronic
1038970521 8:32628653-32628675 GTGAAAAAAATGAAGAAAAATGG + Intronic
1038977975 8:32722942-32722964 CTGCAAAATGTGAAAAAAGATGG - Intronic
1039185517 8:34911314-34911336 CTGCAACAGATGAAGTAAATAGG + Intergenic
1039777377 8:40750490-40750512 CAGCAAGAGATGAAGACAAATGG + Intronic
1040045404 8:42958250-42958272 CTGCAAAACATTTAGAAAGAAGG - Intronic
1040089388 8:43381440-43381462 CTTCAAACCATGGAGAAAATAGG + Intergenic
1042015071 8:64299906-64299928 CTGAAAGACAGGAAGAAAACTGG + Intergenic
1042118894 8:65462621-65462643 TTGGAAAACTAGAAGAAAAATGG + Intergenic
1043580634 8:81708704-81708726 CTGGAAACCATGGAGAAAAAGGG + Intronic
1043730073 8:83666556-83666578 ATGACAAACCTGAAGAAAAATGG + Intergenic
1044027348 8:87189943-87189965 CTTGAAAACATGCAGGAAAAAGG + Intronic
1044514743 8:93125024-93125046 CTGCAAATCATGAAGGAACTTGG - Intergenic
1045014171 8:97984639-97984661 TTGCACACCATGAAGAAACACGG - Intronic
1045178705 8:99756320-99756342 TTTTAAAAAATGAAGAAAAATGG + Intronic
1045274794 8:100693714-100693736 ATGCATACCCTGAAGAAAAATGG + Intronic
1045332502 8:101167469-101167491 CTGAAAATGATCAAGAAAAATGG - Intergenic
1045497848 8:102723241-102723263 CTGTAAAAGAGGAAGAATAATGG - Intergenic
1045557791 8:103231493-103231515 CTGCACACCAGGAAGCAAAAGGG - Intergenic
1045695226 8:104801731-104801753 CTGGAAAATATCACGAAAAAAGG - Intronic
1045846917 8:106647948-106647970 CTGCAAATCTTTAAGCAAAATGG - Intronic
1046124983 8:109894784-109894806 TTTGAAAACATGAAGAACAATGG + Intergenic
1046190219 8:110785389-110785411 CTGGAAAACAAGTAGGAAAATGG - Intergenic
1046234489 8:111404544-111404566 GTGCAAAACATTAAATAAAATGG + Intergenic
1047575803 8:126153871-126153893 CTGCAAAAAAAAAAAAAAAAAGG + Intergenic
1047862123 8:128978724-128978746 TTGCAAAACATGAAAAAAGCTGG + Intergenic
1048310909 8:133321824-133321846 CTGAAAAAAAGTAAGAAAAATGG + Intergenic
1049914386 9:302961-302983 CTACAAAACATCAAAATAAATGG + Intronic
1050211496 9:3263726-3263748 CAGAACAAGATGAAGAAAAATGG - Intronic
1050667306 9:7954485-7954507 CTGCTACAAATGAAGAGAAAAGG + Intergenic
1050716125 9:8528379-8528401 CTGCAAAACACACAGAGAAAAGG + Intronic
1050764191 9:9112022-9112044 CAGCAAAATGAGAAGAAAAATGG - Intronic
1051202164 9:14638861-14638883 CTGGCAAACATGCAGAGAAAAGG + Intronic
1051224494 9:14884703-14884725 GTGCACAACAAGAAAAAAAATGG + Intronic
1051813244 9:21074720-21074742 CTCCAAAACTTCAATAAAAATGG - Intergenic
1051914054 9:22186214-22186236 CTTCAGAATATGAATAAAAAGGG + Intergenic
1051924179 9:22303710-22303732 CTGAAAAAAATGGAAAAAAATGG + Intergenic
1052376900 9:27727861-27727883 CAGCAAAAAATGAAAAACAAGGG + Intergenic
1053170422 9:35875965-35875987 CTGAAGAACAGAAAGAAAAAGGG - Intergenic
1053399334 9:37803588-37803610 CTGATAAACATGAAAAAGAATGG - Intronic
1053454914 9:38226612-38226634 CTGTAAAACATTCAGAACAAAGG + Intergenic
1053529472 9:38865558-38865580 TTGCAAACCATGAAGATAAGAGG + Intergenic
1053672015 9:40375926-40375948 CTGCAACCCATGAGGAAATACGG - Intergenic
1053921830 9:43002284-43002306 CTGCAACCCATGAGGAAATACGG - Intergenic
1054201699 9:62089985-62090007 TTGCAAACCATGAAGATAAGAGG + Intergenic
1054356081 9:64064524-64064546 CTGCAATACATGCAAACAAATGG - Intergenic
1054383131 9:64515970-64515992 CTGCAACCCATGAGGAAATACGG - Intergenic
1054512608 9:66000384-66000406 CTGCAACCCATGAGGAAATACGG + Intergenic
1054636660 9:67498374-67498396 TTGCAAACCATGAAGATAAGAGG - Intergenic
1054706322 9:68466139-68466161 CTGAAACACAAGAAGAAAAAAGG - Intronic
1054938851 9:70717933-70717955 CTGAAAAACTCGAAGACAAAGGG + Intronic
1054940542 9:70735926-70735948 CTGAAAAACTCGAAGACAAAGGG + Intronic
1055894099 9:81155913-81155935 CTGCAAGACAAGATGAAAGAGGG - Intergenic
1055995465 9:82153972-82153994 CTGCAAAAGATGGAGAGACAGGG + Intergenic
1056153657 9:83814239-83814261 ATGCAAAATCTGAAGAAAGAGGG - Intronic
1056356834 9:85808861-85808883 ATGCAAAATCTGAAGAAAGAGGG + Intergenic
1056481196 9:87008071-87008093 CTGCAAACCATGAGGAGAGAGGG - Intergenic
1056524295 9:87428596-87428618 CTTTAAAACAAGGAGAAAAATGG + Intergenic
1057973226 9:99577097-99577119 CTGCTAAACATGCATATAAAAGG + Intergenic
1058373259 9:104294351-104294373 CTTCAGAACATGGAGAAAAAAGG - Intergenic
1058884280 9:109311601-109311623 CTGCAAAAAATGCTGAGAAATGG + Intronic
1059540033 9:115121148-115121170 CTGCCAAACAGGAGGAAAAATGG - Intergenic
1060473755 9:123970216-123970238 CTGCACAACATAAGGAAGAAAGG - Intergenic
1061001777 9:127906713-127906735 CTGCAAAACAGGAAGGCAGAGGG - Intergenic
1061787638 9:133039826-133039848 CTGAAAAATGTGAATAAAAATGG - Intronic
1203744215 Un_GL000218v1:31461-31483 CTGCAATACATGCAAACAAATGG - Intergenic
1203454549 Un_GL000219v1:153171-153193 CTGCAAAACATACAGCAGAAAGG - Intergenic
1186213599 X:7275928-7275950 CTGCAAAAAAAAAAAAAAAAAGG - Intronic
1186766940 X:12780608-12780630 CTGCACAACATAAAGAGAAGTGG + Intergenic
1186795893 X:13045712-13045734 CTGCAAAAAATAAACAAAATTGG - Intergenic
1187177775 X:16912316-16912338 CTGCACTACATGAAGAAGATAGG - Intergenic
1187270813 X:17777577-17777599 CAGCAAGAGATGAAGACAAAAGG - Intergenic
1187621022 X:21054977-21054999 CTGGAAAGGCTGAAGAAAAAAGG + Intergenic
1187854206 X:23621217-23621239 CAGCTAAACATGAATATAAAAGG - Intergenic
1188163672 X:26834361-26834383 CTACAAAACAGGCAGAAGAAGGG + Intergenic
1188422498 X:30007283-30007305 CTGCAACTTATGAAGAATAATGG + Intergenic
1189025043 X:37385759-37385781 CTGAAAAACAAAAAAAAAAAAGG - Intronic
1189079346 X:37953611-37953633 CTCCAAAACCAGAAAAAAAAAGG + Intronic
1189407539 X:40738437-40738459 ATTGAAAACATGGAGAAAAAGGG - Intergenic
1191762530 X:64661495-64661517 CTGCAAAACTCCAAGAAAACAGG - Intergenic
1191773546 X:64787396-64787418 CAGAAAAAAATAAAGAAAAAAGG - Intergenic
1192786286 X:74339191-74339213 CTGAAGAACAGAAAGAAAAAAGG - Intergenic
1193045163 X:77046206-77046228 CTACAAAACATTAATAAAATAGG + Intergenic
1193235085 X:79096765-79096787 CTTCAAAACACTAATAAAAAAGG + Intergenic
1193257975 X:79372096-79372118 CTGCAAAACAAGAACAATCAAGG - Intergenic
1193322677 X:80141576-80141598 ATGAACAACAAGAAGAAAAAAGG - Intergenic
1193681411 X:84523720-84523742 ATACAAAACATGAAGTAACATGG + Intergenic
1193803665 X:85968679-85968701 CTTCTAAACATGAGGAAAAGGGG - Intronic
1193848073 X:86499612-86499634 CTGCTAAATGTTAAGAAAAATGG + Intronic
1194260315 X:91686442-91686464 CTGACAAAAATAAAGAAAAATGG + Intergenic
1194431045 X:93805831-93805853 CTACAAACCAGGAAAAAAAAGGG - Intergenic
1194737739 X:97533430-97533452 CTGTTAAATATGAAGAAAACTGG + Intronic
1194835729 X:98680651-98680673 CTTTACAACATGAAGAAAAAAGG - Intergenic
1195636912 X:107127993-107128015 CTGGAAAGAATGCAGAAAAATGG + Intronic
1196310630 X:114161347-114161369 CTGCCAAAGATGCAGAGAAAAGG - Intergenic
1197143243 X:123140266-123140288 TTTAAAAACAAGAAGAAAAACGG - Intergenic
1197173371 X:123458749-123458771 CTGCAAAACATAAATGTAAAAGG + Intronic
1198056279 X:132998596-132998618 CTGCAAAACATGAAAAAGCCTGG + Intergenic
1198326906 X:135583282-135583304 TTGCAAAACACAAAGGAAAATGG + Intergenic
1198984361 X:142432169-142432191 CTGCAGAGCATGAGGAGAAAAGG - Intergenic
1199361427 X:146923731-146923753 CATCAAATCATGGAGAAAAAAGG - Intergenic
1199419586 X:147629467-147629489 CTGCAAAACATGTAAAAACCTGG - Intergenic
1200268106 X:154657194-154657216 CTGCAAAAGAAGAGGAAATATGG - Intergenic
1200379799 X:155823344-155823366 ATGCAAAATATGTAGAAGAAAGG + Intergenic
1200579010 Y:4925500-4925522 CTGACAAAAATAAAGAAAAATGG + Intergenic
1200646761 Y:5794504-5794526 CTGAAGAAAATGAACAAAAATGG - Intergenic
1201074722 Y:10178502-10178524 CTGAAAAAAATGAAAAAAGAAGG - Intergenic
1201754850 Y:17475836-17475858 CAGCTAAATATGAAGAAAATAGG - Intergenic
1201846702 Y:18430149-18430171 CAGCTAAATATGAAGAAAATAGG + Intergenic