ID: 936691238

View in Genome Browser
Species Human (GRCh38)
Location 2:114891783-114891805
Sequence CTTCAATCACTCAAGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936691238_936691241 14 Left 936691238 2:114891783-114891805 CCTTTTTCCTTGAGTGATTGAAG 0: 1
1: 0
2: 1
3: 23
4: 248
Right 936691241 2:114891820-114891842 ATTACAATTTAGACAAGACAAGG 0: 1
1: 0
2: 1
3: 34
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936691238 Original CRISPR CTTCAATCACTCAAGGAAAA AGG (reversed) Intronic
902181647 1:14693728-14693750 CTCCAAACACCCAAGAAAAACGG - Intronic
905398546 1:37684654-37684676 GTTCTACGACTCAAGGAAAAGGG + Intronic
905468706 1:38175674-38175696 CTCAAATAACTCAAGGAAAAAGG - Intergenic
905607773 1:39318730-39318752 CTCAAACCACTCAAAGAAAAGGG - Intronic
909889201 1:80981671-80981693 CTTCATTTTCTCAACGAAAAAGG + Intergenic
910844856 1:91595053-91595075 CTTCAGTCACTCTGGGCAAAGGG + Intergenic
915819866 1:159011039-159011061 CTTCAATTACTAAATGAACAAGG - Intronic
917872376 1:179253604-179253626 CTTCACTCACATAAGAAAAATGG + Intergenic
919049341 1:192494325-192494347 CTGAAATAACTCAAGAAAAAAGG + Intergenic
919493719 1:198237820-198237842 TCTCGATCACTCAATGAAAATGG + Intronic
921712424 1:218386283-218386305 CTTCATTCACACAATGAGAATGG + Intronic
922299048 1:224279666-224279688 CTTCAATAAAACAAGGAAAGTGG - Intronic
924417175 1:243868908-243868930 CTTCCATCACTCTAGGAAGAGGG - Intergenic
924553076 1:245096521-245096543 CTGAAATCTCTCAAGGACAAGGG - Intronic
1063533321 10:6857427-6857449 CTTCAAACACTCAAGTCAAAAGG + Intergenic
1063941812 10:11137821-11137843 TTTCAATCACTGAAAGAATATGG - Intronic
1068501581 10:57845654-57845676 CTTAAATTACTAAAGGACAATGG - Intergenic
1071302955 10:84270673-84270695 CCCCAACCACTCCAGGAAAATGG + Intergenic
1072462820 10:95635717-95635739 CTTCTTTCACTCAATGTAAATGG + Intronic
1072702180 10:97650616-97650638 CTTCAAACAAACAAGGTAAATGG - Intronic
1078351574 11:10599449-10599471 CTTCCAACACTGACGGAAAATGG + Intronic
1078641684 11:13102554-13102576 CATCAATAACTCAGGGAGAAAGG + Intergenic
1079475654 11:20826488-20826510 ATTCAATTACTAAAGGAAAGGGG + Intronic
1081954481 11:47078290-47078312 CTTCCGTCACTCAACTAAAATGG - Intronic
1082712616 11:56571693-56571715 CTTCAAACACTGAACAAAAAAGG - Intergenic
1082776822 11:57251745-57251767 GTGCAATCACTAAAGGAAAAAGG - Intergenic
1085048149 11:73365171-73365193 CTTAAATCACTCAAGTTTAATGG + Intronic
1085068565 11:73520874-73520896 GTTCAATCCCCCAAAGAAAATGG + Intronic
1088331487 11:108657596-108657618 TATCACTGACTCAAGGAAAAAGG + Intergenic
1089033848 11:115363675-115363697 CTTCATTCACTAATGGGAAAAGG + Intronic
1089448676 11:118574621-118574643 CTTCAATAACTAAAGCCAAAGGG - Intronic
1090931293 11:131300186-131300208 CTTCCTTCACTCAAGGAATCGGG + Intergenic
1092987341 12:13858975-13858997 CCTAAATCACTTGAGGAAAATGG - Intronic
1093441943 12:19208991-19209013 CTTCAAAAATTCATGGAAAATGG + Intronic
1093843876 12:23943235-23943257 CTTCACTTACTCATGGACAATGG - Intronic
1095173411 12:39061375-39061397 CTTCAATCACTTCAGGGAAAGGG + Intergenic
1095230065 12:39729113-39729135 CTTCAAAAACTCAAGGAATCTGG - Intronic
1096414343 12:51400620-51400642 CTTTAACCACTCAATGGAAAAGG + Intronic
1097822849 12:64145170-64145192 CTTCCATCAAACAAGGAATATGG - Exonic
1099521907 12:83674870-83674892 TTTCAATCAGTCAAAGAAAGGGG - Intergenic
1100124447 12:91406809-91406831 CTTCAATGACTTCAGGCAAATGG - Intergenic
1103332479 12:120163818-120163840 ATTCAATTAATCAAGGATAAAGG + Intronic
1105502470 13:20984411-20984433 TTTCAGTAACTCAGGGAAAATGG + Intronic
1105586140 13:21744697-21744719 CTTCCTTGACTCATGGAAAATGG + Intergenic
1106099192 13:26679857-26679879 CTTCAATTAAGGAAGGAAAAAGG + Intronic
1106961866 13:35008324-35008346 CTCTAATCCCTTAAGGAAAATGG + Intronic
1107966994 13:45605866-45605888 GTTCAATCTTTAAAGGAAAAAGG - Intronic
1109725057 13:66329515-66329537 CTATACTCTCTCAAGGAAAAAGG - Intronic
1109780217 13:67100907-67100929 ATGCAATCACTCAAAAAAAATGG + Intronic
1111298910 13:86320526-86320548 CTTTAATCAATGAAGTAAAAGGG + Intergenic
1111315789 13:86557666-86557688 GGTAAATCACTCCAGGAAAACGG + Intergenic
1112261599 13:97882587-97882609 CTTCACTCACTCAAGGCCAAAGG + Intergenic
1117194911 14:53330137-53330159 GTTCAAACACTCAAGGAAATTGG - Intergenic
1118457283 14:65956505-65956527 TTCCAAGCTCTCAAGGAAAAAGG + Intergenic
1119086738 14:71746130-71746152 ATACAAACACTAAAGGAAAATGG - Intergenic
1119361995 14:74058501-74058523 CTTCAATCACTTAAGGTGACTGG - Exonic
1120735717 14:88049871-88049893 CTACAATTACAGAAGGAAAATGG + Intergenic
1121474188 14:94180081-94180103 CTTCAACCACACTGGGAAAAGGG - Intronic
1202833390 14_GL000009v2_random:59531-59553 CCTCACCCACTCAAGGAAACAGG + Intergenic
1124200391 15:27674269-27674291 CTTCACTCACTCAAGCACCAAGG - Intergenic
1126069819 15:44856307-44856329 CTTCAGGCACTCAAGGGAAAGGG - Intergenic
1126088709 15:45032855-45032877 CTTCAGGCACTCAAGGGAAAGGG + Intronic
1126095540 15:45087152-45087174 CTTCAACCACTCCAGGTAATGGG + Intergenic
1126235834 15:46383106-46383128 CTTCAATCAGTCATTGAACATGG - Intergenic
1126562532 15:50059509-50059531 ATTCATTCATTCAAGGAACAGGG - Intronic
1126877511 15:53060198-53060220 CTACAACCACTTGAGGAAAAAGG - Intergenic
1128112435 15:65085229-65085251 CTTGAGTCAGTGAAGGAAAAAGG - Intergenic
1128218955 15:65954207-65954229 CTAAAATCATTCAAGGATAAAGG + Intronic
1129729564 15:77922215-77922237 CTTCAAGCACCCAAGGACAGAGG + Intergenic
1130423691 15:83774467-83774489 CTGCAATGTCTCAAGGAAACTGG - Intronic
1131654994 15:94446946-94446968 CCTCAATCAATCAACAAAAATGG - Intronic
1138369082 16:56510206-56510228 ATTCAATCAATGAAGGAACAGGG + Intronic
1139470625 16:67176337-67176359 CATCAATCACCCCAGGAGAAGGG + Exonic
1143881529 17:10033786-10033808 CTGCAGGCACTGAAGGAAAATGG + Intronic
1144400100 17:14887522-14887544 CTTCAATTCCAGAAGGAAAATGG - Intergenic
1146813431 17:35923003-35923025 CTGGAATCACTCATCGAAAAAGG + Intronic
1150785180 17:68157013-68157035 CTGAAATCACTCACCGAAAAAGG + Intergenic
1153551239 18:6263665-6263687 CTCCAACCACCCAAGGAGAAAGG + Intronic
1153871412 18:9324041-9324063 CTCCAATCATTCATGGAATAAGG + Intergenic
1154028376 18:10727392-10727414 CATCAATCACCCCAGGAGAAGGG - Intronic
1155236446 18:23824510-23824532 TTTCAATCACACCAGGAATATGG + Exonic
1156541024 18:37910647-37910669 CTTCAATCTCTCTAGGAACCTGG + Intergenic
1158651554 18:59292551-59292573 CTACAGTCATTCAAGGATAAGGG - Intronic
1158869777 18:61674768-61674790 TTTCATTCACTCAAGATAAAAGG + Intergenic
1159079857 18:63724707-63724729 CTTCAATGCCCCAAGGAGAAAGG - Intronic
1159644742 18:70904368-70904390 CTTCAATCACACAATTAAAATGG - Intergenic
1159787252 18:72728841-72728863 CTTTCATAACTCAAGGAAATGGG - Intergenic
1160354940 18:78219323-78219345 ATTCAATCACTTTAGCAAAAGGG + Intergenic
1161175195 19:2838044-2838066 CCTCATTAGCTCAAGGAAAAAGG - Intergenic
1163620531 19:18357217-18357239 CTGCAGTCACTCTTGGAAAAAGG - Intronic
1163840538 19:19606139-19606161 CTTCCTGAACTCAAGGAAAAAGG - Intronic
1164759434 19:30717727-30717749 ATTCAGTCACTCAATGAGAATGG - Intergenic
1166822351 19:45588163-45588185 CCTCACTCATTCCAGGAAAAGGG - Intronic
1168097148 19:54122398-54122420 CTTCAGTTACTAAAGGAAGAAGG + Intronic
1202639281 1_KI270706v1_random:68164-68186 CCTCACCCACTCAAGGAAATAGG - Intergenic
926668855 2:15555707-15555729 GTACAATGATTCAAGGAAAAAGG + Intronic
926845198 2:17129255-17129277 CTGCCAACACTCAAGGAAAAAGG + Intergenic
927505716 2:23613063-23613085 CTTCAATAAGTCAAGGATGAGGG + Intronic
928313607 2:30230517-30230539 CTTCAATCACGCCTGTAAAATGG - Intergenic
929097961 2:38281819-38281841 CTCCAATCCCTCAAGAATAAAGG + Intergenic
929464492 2:42132565-42132587 CATGAATTACTCAATGAAAATGG - Intergenic
929586738 2:43120971-43120993 CTCCCATCACTCAAGGCCAAGGG - Intergenic
930747329 2:54898187-54898209 CTTGAATGGCTCAAGGAAATGGG - Intronic
930903758 2:56540827-56540849 CTTCACTGACCCAGGGAAAAAGG + Intergenic
932850550 2:75180391-75180413 CTGCAAACACTCATAGAAAAGGG - Intronic
933651150 2:84851254-84851276 CTGCAAACACTCAAGGAGATGGG + Intronic
934494742 2:94787623-94787645 CCTCACCCACTCAAGGAAACAGG - Intergenic
936691238 2:114891783-114891805 CTTCAATCACTCAAGGAAAAAGG - Intronic
937159307 2:119745376-119745398 CTTAAAGCACTAAAAGAAAAAGG + Intergenic
937812424 2:126213528-126213550 CTTGATACACTCAAAGAAAATGG + Intergenic
938124229 2:128660252-128660274 CTTTTATCATTCAAGGAAAATGG - Intergenic
938331331 2:130450536-130450558 CTTCACTCACTGAAGGAAGCCGG - Intergenic
939026788 2:137023639-137023661 ATTAAATCCCTCAGGGAAAATGG + Intronic
942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG + Intergenic
943028269 2:182655141-182655163 CTTCATTCACTAAAGCAATAAGG - Intergenic
943290768 2:186068216-186068238 GTAAATTCACTCAAGGAAAAAGG - Intergenic
943675729 2:190715055-190715077 CGTTAAACACTCAGGGAAAATGG - Intergenic
944261281 2:197680258-197680280 CTTCATTCATTCAAGGACTAAGG - Intergenic
945256632 2:207808551-207808573 CCGGGATCACTCAAGGAAAATGG + Intergenic
946441415 2:219700067-219700089 CTTGAATCAAACATGGAAAAGGG + Intergenic
946735732 2:222752740-222752762 ATTCTATCAAACAAGGAAAAAGG - Intergenic
947090982 2:226511132-226511154 CATCAATCAGTCATGGAACATGG + Intergenic
947695509 2:232184076-232184098 ATGCAATTACTCAAGAAAAATGG - Intronic
1169500061 20:6150964-6150986 CTGCATTCACTCATGGCAAAAGG + Intergenic
1170552910 20:17492225-17492247 ATTCAATCAGTCAAGAAAAATGG - Intergenic
1170758645 20:19229326-19229348 CTTTACTGACTCAGGGAAAAGGG - Intronic
1170770878 20:19331645-19331667 CATCAATCAGTCAATAAAAAGGG - Intronic
1170800341 20:19585086-19585108 CTTCACTGTCTGAAGGAAAAGGG + Intronic
1170974942 20:21153725-21153747 CTTCTATGACTCAAGGAGAAAGG - Intronic
1171040038 20:21754488-21754510 CGTCAGTCTCTCAAGGAGAAAGG + Intergenic
1171885877 20:30652279-30652301 CCTCACCCACTCAAGGAAACAGG - Intergenic
1172607486 20:36223947-36223969 TTTCATTCATTCAAGGAAAAGGG - Intronic
1174936439 20:54875405-54875427 GTTTAACCACTCATGGAAAAAGG - Intergenic
1174941427 20:54933102-54933124 CGTCAATCTCTAAGGGAAAAGGG + Intergenic
1175567943 20:59995526-59995548 CGTAAATCACACAAGGAAAGAGG - Intronic
1176647605 21:9365773-9365795 CCTCACGCACTCAAGGAAACAGG - Intergenic
1176897768 21:14402902-14402924 CTTGAATTATTTAAGGAAAAGGG + Intergenic
1177092958 21:16792799-16792821 CTTCATTCCCTCAATGAAATGGG - Intergenic
1177453276 21:21300612-21300634 CATTAATCCTTCAAGGAAAAAGG + Intronic
1179335299 21:40445916-40445938 CTTCAATTAGTCTAGGAAACTGG + Intronic
1180239704 21:46493427-46493449 CTGAAAACACTCATGGAAAAAGG - Intronic
1180362667 22:11913700-11913722 CCTCACCCACTCAAGGAAACAGG + Intergenic
1182140381 22:27951080-27951102 CTCAAATCACTGGAGGAAAATGG + Intergenic
1183037776 22:35153097-35153119 CTCCAATCTCTCAAGGCAGAAGG + Intergenic
1203323866 22_KI270737v1_random:97682-97704 CTTCAAAAACTAAAGGACAATGG - Intergenic
952619347 3:35318201-35318223 CTTAAATCAATGAAAGAAAATGG + Intergenic
952859928 3:37804468-37804490 CATCACTCTCTCAAGGAGAAAGG + Intronic
955093573 3:55775185-55775207 CATCAAGCAAGCAAGGAAAAAGG - Intronic
955610886 3:60755880-60755902 TTTGAATCATTTAAGGAAAAAGG + Intronic
955743309 3:62115320-62115342 TTTAAATCACCCAAGGGAAAGGG - Intronic
955863222 3:63354580-63354602 CTTCAAACTCACAAGGCAAAGGG + Intronic
955966157 3:64391293-64391315 CTTCTGCCACTCAAGTAAAAGGG - Intronic
957028418 3:75212044-75212066 CTTTGATCACTCAAGTAAGATGG - Intergenic
957283759 3:78188536-78188558 CTTCAATATTTCAATGAAAAAGG + Intergenic
957495796 3:80990135-80990157 CTGCAATAACTCAGGAAAAATGG - Intergenic
959239419 3:103769673-103769695 CTTCAATCACCCAAAGGTAAAGG + Intergenic
959601999 3:108197702-108197724 CTCCCAAGACTCAAGGAAAAGGG + Intronic
962285015 3:134078048-134078070 CTTCATTCACTAGAGGAAATTGG + Intronic
963942060 3:151105251-151105273 TTTTAATCACACAAGGAAGAAGG - Intronic
964131366 3:153291288-153291310 CTTCAATCAATTAAGAAAAAGGG + Intergenic
968013996 3:195311002-195311024 CTTTAATCAGTTAAGTAAAAGGG + Intronic
968324239 3:197798481-197798503 CTACAATCACACACAGAAAAAGG + Intronic
1202739273 3_GL000221v1_random:39214-39236 CCTCACGCACTCAAGGAAACAGG + Intergenic
970250359 4:14108720-14108742 GCTCAATAGCTCAAGGAAAAGGG + Intergenic
970394534 4:15653499-15653521 CTACAAACACCCTAGGAAAATGG + Intronic
971114146 4:23624003-23624025 TTTCAAAAACTCGAGGAAAAGGG + Intergenic
971227313 4:24766754-24766776 ATTCAATCACTCAAGCAATGTGG + Intergenic
971446107 4:26750679-26750701 TTTAAAGCACTCAGGGAAAATGG - Intronic
971836157 4:31765862-31765884 GTTCAACCACTCAATTAAAATGG - Intergenic
973369522 4:49234524-49234546 CCTCACCCACTCAAGGAAACAGG - Intergenic
973391509 4:49560892-49560914 CCTCACCCACTCAAGGAAACAGG + Intergenic
973778792 4:54268925-54268947 CTTGAATCACTAAAAGGAAAAGG - Intronic
973995628 4:56455927-56455949 ATTAAATAATTCAAGGAAAATGG - Intronic
974379801 4:61124511-61124533 CTTGAAACTTTCAAGGAAAATGG - Intergenic
974907816 4:68078838-68078860 TTTCCATCACTCAGGGAACAGGG + Intronic
975233141 4:71958241-71958263 CTTTAAATATTCAAGGAAAACGG - Intergenic
976151672 4:82098830-82098852 CTGCAAAAACTAAAGGAAAAGGG + Intergenic
976209179 4:82650338-82650360 CTTCATTCACCCCAGGAAAATGG + Intronic
976341416 4:83949794-83949816 CTTCAGCCACTAATGGAAAATGG + Intergenic
976841635 4:89438743-89438765 CTTAAATCACTCTGGCAAAAGGG + Intergenic
978540098 4:109807210-109807232 CTTCAATGACTGCAGGAGAAGGG - Intergenic
978854874 4:113382971-113382993 CTTCAACCACTAGAGGAATAAGG - Exonic
982320689 4:154073812-154073834 TTGAAATCAGTCAAGGAAAAAGG + Intergenic
984924889 4:184798009-184798031 TTTCAATCTCTCATGCAAAAGGG + Intronic
985006069 4:185536159-185536181 CTTTAAACACTCAAGAATAAGGG + Intergenic
985075725 4:186212284-186212306 CTTCCATCTTTAAAGGAAAAAGG + Intronic
985254047 4:188052340-188052362 CTTCAATATTTCAAGAAAAAGGG + Intergenic
1202766633 4_GL000008v2_random:154034-154056 CCTCACCCACTCAAGGAAATAGG - Intergenic
986676833 5:10193196-10193218 TTTCAAGCACTGAAGGAAAAGGG + Intergenic
987444755 5:18004008-18004030 CATCCATGACTCAAGGAAGAAGG + Intergenic
988541240 5:32111962-32111984 CTACAGTAACGCAAGGAAAAAGG + Intergenic
989814154 5:45715358-45715380 CATCATTCAACCAAGGAAAACGG + Intergenic
991963927 5:72072614-72072636 CTTCATTCACTGAAGAAATAGGG + Intergenic
991970387 5:72135369-72135391 CTTTACTCACTCAAGTAATAAGG - Intronic
992864316 5:80942146-80942168 CTTCCTTCACTCAAGGATCATGG - Intergenic
993814083 5:92519215-92519237 CTTCAATCAATCAAGAAAAAGGG + Intergenic
994403583 5:99315139-99315161 CTGCCCTCACTCAAGGGAAAGGG + Intergenic
994564681 5:101427569-101427591 GTTCAATCACTTAACAAAAAAGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996559417 5:124812910-124812932 CCTCAGTCACTGAAGGAAACAGG - Intergenic
996813631 5:127548291-127548313 GGACAATCAATCAAGGAAAAGGG - Intronic
996941869 5:129016717-129016739 ATAAAAACACTCAAGGAAAATGG - Intronic
997632781 5:135382094-135382116 CTGGAATCAGGCAAGGAAAAAGG - Intronic
997878744 5:137571466-137571488 CTTCAATGACTCAAGCAGGAGGG - Intronic
998934740 5:147222849-147222871 CTCCAATCACTCAATGAAATTGG + Intergenic
999441747 5:151606561-151606583 CTTCAATGAATGAAGGAGAATGG + Intergenic
1000822235 5:165998870-165998892 CATCTATCACTCTAGGAAATTGG - Intergenic
1002659615 5:180782799-180782821 CTTCAATATTTAAAGGAAAAAGG + Intergenic
1004127920 6:12891341-12891363 TTTGAATAACTCACGGAAAAGGG - Intronic
1004142173 6:13028450-13028472 CTTCAATCAATCCAGGAATCAGG + Intronic
1004370301 6:15046528-15046550 CATCAATCACTCAATTAAATTGG + Intergenic
1006253257 6:32808171-32808193 CTCCAATGGCTCCAGGAAAATGG - Intergenic
1006858057 6:37149806-37149828 TTTATATCACTTAAGGAAAAAGG - Intergenic
1008470749 6:51881604-51881626 CTTCAATTGCACATGGAAAATGG - Intronic
1008742132 6:54622040-54622062 CTTCAATAACACAAGGAAATAGG + Intergenic
1008957489 6:57231799-57231821 TTTCAAGCACTCATAGAAAATGG - Intergenic
1011713670 6:90081464-90081486 CTTCAATTGCTGTAGGAAAAAGG + Intronic
1011988189 6:93476480-93476502 CCACAACCATTCAAGGAAAATGG - Intergenic
1013866412 6:114702380-114702402 GTTCAAACACTCAAGGTAAATGG - Intergenic
1014336408 6:120142250-120142272 CTTCAAGCAGTCAATGAAGAAGG - Intergenic
1016840908 6:148524629-148524651 CTTCATTCACTGAGAGAAAAGGG + Intronic
1018780797 6:167063592-167063614 CTTATGTCACTAAAGGAAAAAGG + Intergenic
1019897481 7:3994025-3994047 CTTCAATGAGTCAGAGAAAATGG - Intronic
1021000932 7:15329285-15329307 CTTAATTCACTGAAAGAAAAAGG - Intronic
1021135683 7:16962409-16962431 CTTCATTAACTCCAGGAAACTGG - Intergenic
1023476641 7:40586302-40586324 CTTCAAGTGCTCAAGCAAAACGG - Intronic
1024091585 7:45947157-45947179 TTTCAAGCACTCATAGAAAATGG - Intergenic
1024096301 7:45985452-45985474 CTTCAATGTCCCAAGAAAAAAGG - Intergenic
1027615007 7:80411565-80411587 CTCCAACCTCTCTAGGAAAAAGG - Intronic
1028067764 7:86409167-86409189 CTTCCATCACTCTAGGCAAGTGG - Intergenic
1029015534 7:97312095-97312117 CTTCAAAATCTCAAGCAAAATGG - Intergenic
1029218317 7:98968624-98968646 TTTCATTCACTCCAGGTAAATGG - Intronic
1030788748 7:113696692-113696714 CTTCAAACATTCATTGAAAAAGG - Intergenic
1032830053 7:135614032-135614054 CATCAACAACTCAAGTAAAATGG - Intronic
1033007589 7:137584302-137584324 ATTCAATCATAGAAGGAAAATGG + Intronic
1035195106 7:157211958-157211980 CTTGACTCACTTGAGGAAAACGG + Intronic
1038521775 8:28239109-28239131 TTGCAATCACTCAAAAAAAAAGG + Intergenic
1039367998 8:36952265-36952287 TATCAAGCACTCAAGAAAAATGG + Intergenic
1039666832 8:39543014-39543036 TTCCAATAAATCAAGGAAAAAGG - Intergenic
1039829638 8:41202574-41202596 CTCCAATCAGTCCAGGGAAAGGG + Intergenic
1040761270 8:50848183-50848205 AATCAATCACTCAAGGACAAGGG - Intergenic
1041123918 8:54615269-54615291 CACCAATCACAAAAGGAAAAAGG - Intergenic
1041717138 8:60942724-60942746 CTGCCTACACTCAAGGAAAAGGG + Intergenic
1043516649 8:81000997-81001019 CTTCCATTTCTAAAGGAAAAAGG + Intronic
1044332908 8:90942507-90942529 CTTGAGTCACTGAAGTAAAAAGG - Intronic
1048269711 8:133018860-133018882 CTTAAAGTACTCCAGGAAAAGGG + Intronic
1050252187 9:3756684-3756706 CTTCATTCACTCATAGAATAGGG + Intergenic
1051105705 9:13577635-13577657 CATCAATCAATAAAGGAATAGGG + Intergenic
1051758037 9:20426861-20426883 CTACAATCACTCATGAAAGATGG + Intronic
1052589129 9:30468332-30468354 CTACAACCACTAAAGAAAAAAGG + Intergenic
1052592172 9:30512915-30512937 CATAAATAGCTCAAGGAAAATGG - Intergenic
1052679770 9:31674712-31674734 TTTGAATCAGTAAAGGAAAAAGG + Intergenic
1052719619 9:32157430-32157452 CTTCCATTTCTCAAGGAGAATGG - Intergenic
1053490938 9:38501771-38501793 CTTGACTGACTCAAGTAAAATGG + Intergenic
1053565634 9:39247749-39247771 CTGGAATCACTCAAGAATAAAGG - Intronic
1053662376 9:40292736-40292758 CCTCACCCACTCAAGGAAACAGG + Intronic
1053831400 9:42085604-42085626 CTGGAATCACTCAAGAATAAAGG - Intronic
1054131515 9:61371287-61371309 CTGGAATCACTCAAGAATAAAGG + Intergenic
1054374505 9:64438965-64438987 CCTCACCCACTCAAGGAAACAGG + Intergenic
1054522234 9:66083548-66083570 CCTCACCCACTCAAGGAAACAGG - Intergenic
1054599147 9:67101834-67101856 CTGGAATCACTCAAGAATAAAGG + Intergenic
1055629747 9:78211775-78211797 CTTCCATCTCCAAAGGAAAATGG + Intergenic
1057161867 9:92894867-92894889 CCTCACCCACTCAAGGAAACAGG - Intergenic
1057671256 9:97090976-97090998 CTTGACTGACTCAAGTAAAATGG + Intergenic
1060358673 9:122933913-122933935 TTTCAATAATTCAAGGAAAAAGG - Intergenic
1203547388 Un_KI270743v1:138912-138934 CCTCACCCACTCAAGGAAACAGG - Intergenic
1185534809 X:852570-852592 CTCCAATAACTTATGGAAAAGGG - Intergenic
1185940428 X:4312676-4312698 CTTCAATTAGTCAAGGAAGTTGG - Intergenic
1187604979 X:20872893-20872915 CTTAAATGATTCCAGGAAAAAGG + Intergenic
1188260499 X:28017231-28017253 CTTGAACAACTCAAGGATAAGGG + Intergenic
1196518408 X:116641480-116641502 CCTCAATCACACAAATAAAAAGG + Intergenic
1197048296 X:122027140-122027162 CTTCTATCACTCCAGCAAGAAGG - Intergenic
1199893062 X:152107493-152107515 CTTCAAACTCTCTAGGAAAGGGG - Intergenic