ID: 936692753

View in Genome Browser
Species Human (GRCh38)
Location 2:114912489-114912511
Sequence CTGTGAGAAGGGAGGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 1, 2: 3, 3: 70, 4: 624}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936692753 Original CRISPR CTGTGAGAAGGGAGGCAAGA TGG Intronic
900300851 1:1976388-1976410 TGGTGAGAGGGGAAGCAAGAGGG - Intronic
900687113 1:3955630-3955652 CTGTGGGAAAGGAGCCAATAAGG - Intergenic
900874862 1:5334951-5334973 TTCTGAAAAGGGAGGCTAGATGG + Intergenic
902471322 1:16648891-16648913 GTTTGAGAAGTGTGGCAAGAGGG + Intergenic
902487485 1:16758554-16758576 GTTTGAGAAGTGTGGCAAGAGGG - Intronic
903450913 1:23453029-23453051 CTGTGTGAAAGGGGGCAGGAGGG + Intronic
903696705 1:25212781-25212803 CTGTAAGAAGGGAGGAAATGAGG - Intergenic
903840023 1:26232454-26232476 ATGTGAGGAGGGAGGGAACAGGG - Intergenic
903997766 1:27318502-27318524 CTGTGAGAAATGAGGCTGGAAGG + Intergenic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904597974 1:31658598-31658620 CAGTGAGAGGGGAGGAAAGCAGG + Intronic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904984869 1:34537095-34537117 CTGGGAAAAGGGAGCCGAGAAGG - Intergenic
905003917 1:34695238-34695260 ATATGAAAAGGGCGGCAAGAGGG - Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905525856 1:38639009-38639031 ATGGGAGAAGAGAGGTAAGAGGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905616571 1:39404919-39404941 CTGACAGAAGGGTGGGAAGAAGG - Intronic
905918468 1:41702255-41702277 GTAAGAGAAGGGAAGCAAGATGG - Intronic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906147516 1:43568818-43568840 CTGGGAGAAGGCAGCCAGGAGGG + Intronic
906539556 1:46574791-46574813 TTGGGAGAAGGGAGGCCGGAGGG - Intronic
907038058 1:51234373-51234395 GAGAGAGAAGGGAGGCAGGAAGG - Intergenic
908037965 1:60076035-60076057 ATGTGACAATGGAGGCAAGAGGG + Intergenic
908319782 1:62967874-62967896 CTAGGAGCAGGGAGGAAAGAGGG - Intergenic
908961384 1:69700512-69700534 CTGTGAGGAAGGAGACATGAAGG - Intronic
909883535 1:80911143-80911165 GGGTGAGAAGGAAGGAAAGAAGG + Intergenic
909897822 1:81095395-81095417 CTCAGAGAATGGAGGCAGGATGG + Intergenic
910069365 1:83193184-83193206 CTCTTAGAAGGGAGGCAACATGG - Intergenic
911254138 1:95614821-95614843 ATGAGAGAAGGGAGGAAGGAAGG - Intergenic
911841510 1:102688057-102688079 CTGTGAGGTGGGAAGCAAGATGG - Intergenic
912262272 1:108121892-108121914 CAGTGAGAAGGGAGGCTGGGAGG - Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912872407 1:113321185-113321207 CAGAGAAAAGGGGGGCAAGAGGG - Intergenic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913449493 1:118983557-118983579 TTGTGTGAAGGGAAGCGAGAGGG - Intronic
913501783 1:119478401-119478423 CTGTTAGAATGGAGCGAAGAAGG + Intergenic
915040145 1:152961481-152961503 CTCTGAGGAGAGAGGAAAGAGGG + Intergenic
915835943 1:159174720-159174742 ATGTGAGAAGGAAGGGCAGATGG - Intronic
917531743 1:175842042-175842064 TTGGCAGAAGGGAGGCAGGAAGG + Intergenic
917538842 1:175894286-175894308 CTGTGGGAAAGGCGGCAAGTAGG + Intergenic
917963457 1:180164258-180164280 GTGTGCTAAGGGAGTCAAGAAGG + Intronic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
918321410 1:183368673-183368695 GTGTCAATAGGGAGGCAAGAAGG - Intronic
919481086 1:198090672-198090694 GAGTGAGAAGGGAGGTGAGAAGG + Intergenic
919592444 1:199521511-199521533 CTGGGAGAAGGGAGGTAGGTAGG - Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920617027 1:207503602-207503624 CTTATAAAAGGGAGGCAAGAGGG - Intronic
921815970 1:219563789-219563811 CTTTGAGAAGAGAGGGGAGAAGG + Intergenic
921841152 1:219830021-219830043 CTGGGAGAATGGAGGCGGGAAGG - Intronic
921905262 1:220489024-220489046 CTGTGAAAAGCCAGGCAACATGG - Intergenic
922620938 1:226987726-226987748 CTGTAAGAAGGGAGGTGGGAGGG + Intergenic
922905115 1:229168433-229168455 CTGTGTGGGGGGAGGCAAGGGGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922968251 1:229710711-229710733 CTGAGAGAAGGGAAGCAGGGAGG + Intergenic
923067083 1:230527718-230527740 CAGTGAGGAGGCTGGCAAGATGG - Intergenic
923080723 1:230651924-230651946 CTGTGAAGGGGGAGGCAGGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924467808 1:244314016-244314038 CTGTTAGAATGGAGGCATGTGGG - Intergenic
1063157304 10:3391563-3391585 ATGTTAGAAGGGAGGAAAGGAGG + Intergenic
1063249872 10:4262768-4262790 CTGGGATATGGCAGGCAAGAAGG + Intergenic
1063665970 10:8060890-8060912 CTGTGAGAAAGGAATTAAGAAGG - Intronic
1063702586 10:8400110-8400132 GTGTGTGAAGTGAGGCAGGAAGG + Intergenic
1064577381 10:16760040-16760062 CTTTGAGAAAGGAGCTAAGATGG - Intronic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1064722202 10:18240798-18240820 CTTTGAGTAGGCAGGCAGGATGG - Intronic
1066687795 10:37996841-37996863 CGGGGAGAAGGGAGCCAAGTTGG + Intergenic
1066950243 10:42110747-42110769 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1068798196 10:61107807-61107829 GGGTGAGAAAGGAGACAAGAGGG + Intergenic
1069074488 10:64024072-64024094 CTCTCACCAGGGAGGCAAGACGG + Intergenic
1069616833 10:69811557-69811579 CTGTGACATGGGAGGTCAGAGGG + Intronic
1069658589 10:70108523-70108545 CTGATAAGAGGGAGGCAAGAAGG - Intronic
1069843119 10:71352358-71352380 CTGTGAGAAGGTAGGCAGGAGGG + Intronic
1070831258 10:79419362-79419384 CTGGGAGAAGGTGGGCAACACGG + Intronic
1071149122 10:82612292-82612314 ATGAGGGAAGGAAGGCAAGATGG - Intronic
1072614073 10:97038007-97038029 GGGTGAGAAGGGAAGCGAGAAGG - Intronic
1072855002 10:98937091-98937113 CTGTGACAATGGAGCCAAGATGG + Intronic
1073192590 10:101662333-101662355 CTGGGAGAAATGAAGCAAGAAGG + Intronic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1075572749 10:123557496-123557518 CTGCCAGAAGGGGGGCAAGGGGG + Intergenic
1076108988 10:127846650-127846672 CTGGGAGAAGGGAGGTGGGATGG - Intergenic
1076294751 10:129375649-129375671 CTGGGAGAAGTTAGCCAAGAAGG - Intergenic
1076572295 10:131440807-131440829 CGGTCAGCAGGGAGGGAAGAGGG + Intergenic
1076906483 10:133364858-133364880 CTTTGAGAAGGGCGGCACCATGG - Intronic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077118849 11:897667-897689 CTGTGTGAAGGGAGGCTGGGAGG - Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1078288062 11:9978162-9978184 TTGGGGGAAGGGAGGCAGGATGG - Intronic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1080728024 11:34916637-34916659 CAGTGAGAAGGCCGTCAAGATGG + Exonic
1081571304 11:44293094-44293116 CTGAGAGAAGGAAGGAAGGAAGG + Intronic
1081771814 11:45654749-45654771 CTGTTAGAAAGCAGGCAAGTTGG + Intronic
1082758812 11:57106197-57106219 CTGTAAAAAGGGAGGAAAGGGGG + Intergenic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1083470224 11:62879519-62879541 CTGGGAGAAGGCAAGCAAGTGGG - Intronic
1083611326 11:64005798-64005820 CCCTGAGAAGGCAGGCAGGAGGG + Intronic
1083712651 11:64558731-64558753 CTGTGAGGTGGCAGGCAAGGTGG - Intronic
1083713106 11:64560650-64560672 CTGTGATGAGGGAAGCAAGGAGG - Intronic
1084192070 11:67503941-67503963 CTGTGGGAAGAGGGGCAGGAGGG - Intronic
1085334311 11:75679256-75679278 CTGGGAGATGGGAGGCCAGAAGG + Intergenic
1085391170 11:76183055-76183077 GTCTGAGGAGGGAGACAAGAAGG - Intergenic
1085692147 11:78672668-78672690 CTTTCAGCAGGGAGTCAAGAAGG - Intronic
1085982922 11:81746021-81746043 ATGTAAGAAGGGATGAAAGAAGG + Intergenic
1086160769 11:83719565-83719587 CAGTGAGAAAAGAGGCAAGGTGG + Intronic
1087683943 11:101242617-101242639 CAGCGAGCAGGCAGGCAAGAAGG - Intergenic
1088644126 11:111902875-111902897 GTGTGAGAAATGAGGCAAGAGGG - Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1088886986 11:114015458-114015480 CTATGAGAAGGCAGGCATGGTGG + Intergenic
1089159890 11:116429274-116429296 CTCTGGCAAGGGAGGCAAGCTGG - Intergenic
1089772681 11:120814942-120814964 CTGGGAGAAGGAAGGCAGGCAGG - Intronic
1089960756 11:122615421-122615443 CTGTTAGAAGGAAGGAAGGAAGG + Intergenic
1089982442 11:122783396-122783418 CAGAGAGGAGGGAGGCAAGCTGG - Intronic
1090057935 11:123439278-123439300 GTGGGAGAAGGGAAGCAGGATGG + Intergenic
1090438565 11:126707889-126707911 CTTTCTCAAGGGAGGCAAGAAGG - Intronic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091222250 11:133936414-133936436 CTGGGAGAAGGCAGGCAGGAAGG - Intronic
1091423011 12:359807-359829 GAGGGAGAAGGGAGGCAAGGAGG + Intronic
1091437715 12:485861-485883 CTCAGAGAAGGGAGGTGAGAAGG + Intronic
1091481312 12:834547-834569 CTGAGGTAAGGGAAGCAAGATGG + Intronic
1091697940 12:2640598-2640620 CTGGGAGGAGGGGGGCCAGAAGG + Intronic
1091701668 12:2667359-2667381 CTGGGGGAAGGGAGACCAGAGGG + Intronic
1092010363 12:5105374-5105396 CTGTAAGAAGGGAGGCTATTCGG + Intergenic
1092131111 12:6114032-6114054 CTGTGAGATGGGATGAAAGGAGG - Intronic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1092483107 12:8878498-8878520 AAGGGAGAAGGGAGGAAAGAGGG + Intronic
1093229537 12:16526762-16526784 CTGTGAAAAGTGAGCCAGGAAGG + Intronic
1093816374 12:23553524-23553546 GTGGAAGAAGGGAGGCAGGAGGG + Intronic
1093988793 12:25567691-25567713 CAGTGAGAGTGGAAGCAAGATGG - Intronic
1094396931 12:30016999-30017021 CTGCGAGAAGAGAGGCAGAAAGG - Intergenic
1094526115 12:31232388-31232410 CTCGGAGGAGGGAGGCAAGAGGG - Intergenic
1094702342 12:32881918-32881940 CTGTGGGAAAGGAGGCTAGCAGG + Intronic
1095141818 12:38673134-38673156 ATGTGAGAGGGCAGGAAAGAGGG - Intronic
1095496553 12:42790514-42790536 TTGTCAGAAGGTAGTCAAGAGGG - Intergenic
1096399417 12:51292799-51292821 GTTTGAGAACGGAAGCAAGAAGG - Intronic
1096573588 12:52539157-52539179 CTGGGACAAGGGAGGGTAGAGGG - Intergenic
1096594012 12:52682799-52682821 CTGTGAGAAGGGAGAAATGCAGG + Intergenic
1096615754 12:52832609-52832631 GGGTGAGGAGGCAGGCAAGACGG + Intronic
1097635042 12:62112580-62112602 CTGGGAGAAGGGAACCAAGTTGG - Intronic
1098230031 12:68363846-68363868 GTGAGAGAAGGGAGGACAGATGG - Intergenic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1098573720 12:72016945-72016967 GTGAGAGGAGGGAGGCAAAAGGG + Intronic
1099505242 12:83467499-83467521 ATGAAAGAAGGAAGGCAAGAAGG + Intergenic
1099712766 12:86248234-86248256 CTGAGAGAAGGAAGGAAGGAAGG - Intronic
1101146350 12:101844424-101844446 CTGTGAGAAGGGATGCAGCTAGG + Intergenic
1101251484 12:102939947-102939969 CTGAGAGGATGGAGGCAAGCAGG + Intronic
1101348527 12:103907058-103907080 CTGTTGGAAGGGAGGAAGGAAGG + Intergenic
1102444949 12:112994818-112994840 CTTTGAGGAGGCAGGCAAGGTGG - Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102825125 12:115942585-115942607 CTGCCAGAAGGGAGGGGAGAGGG + Intergenic
1103356874 12:120328098-120328120 CTGGGATAAGGGAGACAAGAAGG + Intergenic
1103581388 12:121918218-121918240 CGGTGAGGAGGCAGGCAGGACGG + Exonic
1104234557 12:126921019-126921041 CTTATAAAAGGGAGGCAAGAGGG - Intergenic
1104319239 12:127735006-127735028 CTATGAGAGAGGAGGCAAGCAGG - Intergenic
1104612430 12:130240700-130240722 CCGGGTGAAGGGAGGGAAGAGGG + Intergenic
1105614470 13:21999785-21999807 CTGGGTGCAGGAAGGCAAGAGGG + Intergenic
1105705270 13:22964423-22964445 CTGTGAGCAGGGAGTCAGGGCGG - Intergenic
1105817210 13:24047513-24047535 TTGTGAGAATAGAAGCAAGATGG + Intronic
1106013700 13:25848291-25848313 CTGGGAGGGGAGAGGCAAGATGG + Intronic
1106606269 13:31232001-31232023 CTGTCAGGATTGAGGCAAGATGG + Intronic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1106667769 13:31870603-31870625 AAGTGAGAGAGGAGGCAAGAGGG + Intergenic
1107114125 13:36728086-36728108 TTGTGAGATGGGAGGCATGTAGG + Intergenic
1107448964 13:40491630-40491652 ATGTTTGCAGGGAGGCAAGAAGG + Intergenic
1107780535 13:43897269-43897291 CTGTAAGAAGGGATTCAATAAGG - Intergenic
1108067860 13:46597212-46597234 GTATGAGAACTGAGGCAAGAAGG - Intronic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1108530677 13:51324562-51324584 CAGAGAGAAGGCAGGCAAGAAGG + Intergenic
1108777222 13:53781436-53781458 CGGTGAGCAGGGAGGCACGAAGG - Intergenic
1109846801 13:68003921-68003943 TTGTGAGGGGGGAGGTAAGAAGG - Intergenic
1110644862 13:77870570-77870592 CCGTGAGAAGGGAAGTAAGATGG + Intergenic
1110760854 13:79228868-79228890 CTGTGACAAAGGGGGAAAGATGG - Intergenic
1110806886 13:79765218-79765240 CTGTGAGCAGGTTGGCAAGGTGG - Intergenic
1111006388 13:82255346-82255368 CTGATGGAAGGAAGGCAAGAAGG + Intergenic
1112293208 13:98163315-98163337 CTTGGAGAAGGGTGGCAGGAGGG + Intronic
1114029259 14:18561551-18561573 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1114424790 14:22612430-22612452 CTGAGAGAAGGGAGTCCTGAGGG + Exonic
1114498213 14:23148597-23148619 CTTTCAAGAGGGAGGCAAGAAGG + Intronic
1114717286 14:24840464-24840486 CTGGGACAAGCAAGGCAAGAAGG - Intronic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1116553825 14:46277664-46277686 CAGAGAGACGGGATGCAAGAGGG - Intergenic
1116582729 14:46662669-46662691 CAGAGAGAAGGCAGGGAAGAAGG + Intergenic
1116689396 14:48085325-48085347 CGGGGAGAATGGAAGCAAGAGGG + Intergenic
1116994068 14:51304023-51304045 CAGTGAGAAGGAAGGAAGGAAGG - Intergenic
1117035450 14:51723309-51723331 CTTTGGGAAGGGAGGTATGAGGG + Intronic
1118110872 14:62718115-62718137 AAGAGAGAAGGGAGGCAAGGGGG + Intronic
1118422523 14:65622636-65622658 TTGAGATAAGGGAGGCAATAAGG + Intronic
1119216983 14:72876596-72876618 CTGAGGGAAGGAAGGCCAGATGG - Intronic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1120515605 14:85465926-85465948 TGGTGAGAGAGGAGGCAAGACGG - Intergenic
1121895102 14:97639662-97639684 GTGAGGGAAGGGAGGCAAGAAGG - Intergenic
1121982183 14:98464432-98464454 CTGTCAGAAGGGTGAAAAGATGG + Intergenic
1122563688 14:102635943-102635965 CTGTCAGAAGGGAGGGAGGGAGG - Intronic
1122623013 14:103070491-103070513 CAGTGATGAGGGAGGCAGGAGGG + Intergenic
1123683560 15:22781567-22781589 CCGTGAGACTGGAAGCAAGATGG - Intronic
1124335763 15:28855937-28855959 CCGTGAGACTGGAAGCAAGATGG - Intergenic
1125532725 15:40424112-40424134 CTGGAAGAAGGAAGGCAAGTTGG - Intronic
1126107578 15:45156803-45156825 ACATGAGAAGGGAGGCAACATGG - Intronic
1126107627 15:45157091-45157113 CTGAGAGAAGGCAGGTCAGATGG - Intronic
1126108494 15:45162308-45162330 CTTTGAGGATGGAGGCAAAAGGG - Exonic
1126175665 15:45733157-45733179 CTGTAAGAAGTAAGGCAAGTAGG + Intergenic
1126419657 15:48457912-48457934 ATATGATAAGGGAGGCAGGATGG - Intronic
1127484969 15:59410499-59410521 CTGGGATGAGTGAGGCAAGAAGG + Intronic
1127873310 15:63091068-63091090 CTGGGAGCAGAGAGGCCAGACGG + Intergenic
1128498506 15:68211394-68211416 CTGGGAGAAGGGTGGTCAGAGGG - Intronic
1128699863 15:69796302-69796324 TTGTGAGAAGAGATGGAAGAAGG + Intergenic
1128795875 15:70466268-70466290 AAGCGAGAAGGGAGGCAACAGGG - Intergenic
1129506044 15:76082388-76082410 GTGGTAGAAGGGAGGGAAGAAGG + Intronic
1129608316 15:77035485-77035507 CTGGGAACAGGGAGGAAAGAGGG - Intronic
1129744395 15:78007990-78008012 CTGTGAGCAGGCAGGCCAGGCGG + Intronic
1129966828 15:79743450-79743472 CTGTTAGAACAGAGGCAAGTGGG - Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130185256 15:81674486-81674508 CTGAGAGAGAGGAGCCAAGATGG - Intergenic
1130476056 15:84268699-84268721 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130483477 15:84382753-84382775 CGGTGAGAATGGAGGCAAGTTGG - Intergenic
1130696504 15:86136776-86136798 CTGGGAGGAGGAAGGCAACAGGG + Intergenic
1130854153 15:87826195-87826217 CTCTGTGATGTGAGGCAAGATGG + Intergenic
1131027980 15:89161353-89161375 CTTTGAGAGGGGATGCCAGAAGG - Intronic
1131185473 15:90270397-90270419 CTGGCAGAAGGGAGGAGAGAAGG - Intronic
1132772932 16:1574685-1574707 AGGTGGGAAGGGAGGCAGGAGGG - Intronic
1133231532 16:4369312-4369334 CTGTGTGAAGAGAGCCAAGCTGG + Intronic
1134448175 16:14346412-14346434 CTTACAGCAGGGAGGCAAGAGGG + Intergenic
1135263453 16:21000970-21000992 CTGGGACAAGGGAGACAAGTTGG - Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1135887271 16:26321686-26321708 CAGCCAGAAGGGAGGGAAGAAGG - Intergenic
1136489224 16:30594782-30594804 CTTATAAAAGGGAGGCAAGAGGG + Intergenic
1136687279 16:32002856-32002878 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1136881890 16:33907382-33907404 CTGGGAGTGGGGAGGCAGGAGGG - Intergenic
1137443879 16:48520193-48520215 CTGAGTGCTGGGAGGCAAGAAGG - Intergenic
1137628066 16:49921974-49921996 CTGTGAGGAGGCAGGCAAGAGGG - Intergenic
1137658828 16:50185439-50185461 CTGTGAGGAGGGAGGAGGGAAGG + Intronic
1137773966 16:51040680-51040702 CAGGGAGGAGGGAGGCAGGAAGG + Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138222112 16:55260723-55260745 CTGTGAGAAGGGAAGACAGTAGG - Intergenic
1138488483 16:57362077-57362099 CTGTGAAAAGGGGGTCACGATGG - Intronic
1138511046 16:57508551-57508573 GTGTTAGAGGGGAGGCAGGAGGG - Intergenic
1138825682 16:60316488-60316510 CTCTGAGAAGGAAGGGAGGAAGG - Intergenic
1138907413 16:61353949-61353971 CTGTGTTAAGTGAGGCAGGAAGG - Intergenic
1139136324 16:64208660-64208682 CAGGGAGAAGGGAGGCAAAAAGG + Intergenic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140405803 16:74710609-74710631 CTGTGAAAACGCAGGCAATATGG + Intergenic
1141217153 16:82035322-82035344 CTGTGAACAGAGAGTCAAGAAGG - Exonic
1141240256 16:82259314-82259336 CTTTGAGCAAGGGGGCAAGAGGG + Intergenic
1141284481 16:82659037-82659059 CTGTGAGCAGGGAGGCCACCAGG + Intronic
1141343919 16:83228069-83228091 CCGTGAGAAGGGAGGCCAGATGG + Intronic
1141473083 16:84252615-84252637 CTGTGAGATGGGAGGCCTGGAGG + Intergenic
1141473787 16:84258219-84258241 CTGTGAGAGGGGAAGCCAGCTGG + Intergenic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141932634 16:87216242-87216264 CTGTGAGCTGAGAGGCAAGTCGG - Intronic
1142123066 16:88396685-88396707 CCGTCTGAAGGGAGGCCAGATGG + Intergenic
1203090121 16_KI270728v1_random:1208064-1208086 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1142752586 17:1997874-1997896 CTCTGAGAAGGGAGGTGACAAGG + Intronic
1143249794 17:5514777-5514799 CTGGGAGAAGGGCAGCAAAAAGG - Exonic
1143527893 17:7482971-7482993 CTGTGAGAGGGAAGGGAAGGTGG + Exonic
1143854509 17:9838830-9838852 CTGTGAGATGGGAGAGAGGAAGG + Intronic
1144032721 17:11336636-11336658 CTGTTAGAGGGGAGGAGAGAAGG - Intronic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1144579543 17:16450666-16450688 CTGTGTGGAGGGAAGCAAGGCGG + Intronic
1144875781 17:18396457-18396479 CTTTGGGAAGGAAGGAAAGAAGG - Intergenic
1145156447 17:20547964-20547986 CTTTGGGAAGGAAGGAAAGAAGG + Intergenic
1145931583 17:28689829-28689851 CTGTTAGAAAGGAGGAAAGGGGG - Intronic
1146534481 17:33638379-33638401 CTGTGAGGATAGAAGCAAGATGG + Intronic
1147383961 17:40071110-40071132 CTGAGAAAAGGGTGGAAAGATGG - Intronic
1147656737 17:42095424-42095446 CTCTGAGAAGGGCAGCCAGAGGG + Intergenic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1148241673 17:46003216-46003238 GTATGAGGAGGGAGGAAAGAGGG - Intronic
1148385462 17:47231289-47231311 CTGTGAGAACAAAGCCAAGAAGG + Intergenic
1148954555 17:51343047-51343069 CTGTGACAATGGCTGCAAGAGGG + Intergenic
1149123279 17:53196272-53196294 CTCTGGGAAGAGAGGCAGGATGG + Intergenic
1149866637 17:60154773-60154795 CTGTGAGACGCTAGCCAAGAAGG + Intronic
1150440179 17:65184837-65184859 CAGTGAGAAGGAAGGAAAGAAGG - Intronic
1150824367 17:68461731-68461753 CTGGGACAATGGAGCCAAGAGGG + Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151751559 17:76041538-76041560 GTGTCAGAATGGAGGCATGAAGG - Intronic
1152181601 17:78825597-78825619 CTGTGAGATGGGAGGAATGCAGG - Intronic
1152494388 17:80660829-80660851 CTGAGAGAAGGGTGGGGAGATGG - Intronic
1153282207 18:3425229-3425251 CTGTGAGGATAGAAGCAAGATGG - Intronic
1153668483 18:7387643-7387665 CTGTGAGAGGTGAGGCCAGCTGG + Intergenic
1153760914 18:8331101-8331123 CTGTGAAAAGGAATGCAAAAAGG - Intronic
1155156701 18:23163551-23163573 CTGAGAGAAAGGATGGAAGAGGG + Intronic
1155705058 18:28799856-28799878 ATGAGAGAAGGAAGGAAAGAAGG - Intergenic
1156203996 18:34866027-34866049 CAGTGTGAAGGAACGCAAGATGG - Intronic
1156377948 18:36531509-36531531 ATTTAGGAAGGGAGGCAAGATGG - Intronic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157002936 18:43549142-43549164 CTGGAAGAAGGGAGGAGAGAAGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157749385 18:50164739-50164761 CTGTTGGAGGGGTGGCAAGAGGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158376473 18:56875465-56875487 CAGTGGGAAGGTATGCAAGATGG - Intronic
1158882337 18:61792535-61792557 CTGTGGGGAGTGAGACAAGATGG - Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1159938349 18:74386452-74386474 ATGTGAGCAGAGAGGCCAGACGG + Intergenic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161201837 19:3019464-3019486 CTGCTAGAAAGGAGGCAGGATGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161970853 19:7579283-7579305 GTGTGGGAAGGCAGGAAAGAGGG - Intergenic
1162040985 19:7971028-7971050 CAGAGAGAAGGGAGCCAGGAGGG - Intronic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1162243796 19:9381803-9381825 AAGTGAGAAAGGAGGCATGAGGG - Exonic
1162550725 19:11356988-11357010 CTGGGAGAATGGATGCAAGCAGG + Intronic
1162697346 19:12486423-12486445 CTGTCAGAAGGAAGGAAGGAAGG + Intronic
1162791738 19:13066535-13066557 CTGTGAGCAGGGAGGGAATGAGG + Intronic
1163159107 19:15454326-15454348 CCCAGAGTAGGGAGGCAAGAAGG - Intronic
1163737173 19:18988518-18988540 CTGTGTGGAGGGAGGCAGCAAGG + Intergenic
1163908826 19:20170507-20170529 CAGTGAGCAGTGAGTCAAGATGG + Intronic
1164121094 19:22266047-22266069 CAGTGAGAAGGGATGGATGAAGG - Intergenic
1164357967 19:27464373-27464395 CTGGGAGAATGGAGCCAAGTTGG + Intergenic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1167175320 19:47860633-47860655 CCTGGAGAAGGGAGGGAAGAGGG - Intergenic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167758368 19:51427234-51427256 CTGTGAGAATGGAGGAAGGGAGG + Intergenic
1168489111 19:56792992-56793014 ATGTGAGAAGGAAGGTGAGAAGG - Intronic
1202703721 1_KI270713v1_random:5686-5708 GTTTGAGAAGTGTGGCAAGAGGG + Intergenic
925281833 2:2690419-2690441 GTGTGAGTAGGGAGGAGAGAGGG - Intergenic
925443316 2:3907062-3907084 AGGGAAGAAGGGAGGCAAGATGG - Intergenic
925895846 2:8471267-8471289 CTGTGAAATGTGAGGCCAGATGG - Intergenic
925964014 2:9046251-9046273 CTTTGAGAAGGAAGGAAGGAAGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927149899 2:20189563-20189585 CAGTGAGAAGTGAGGCTGGAGGG - Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927351907 2:22125738-22125760 CTGTGAGGAGGGAGCAGAGAAGG - Intergenic
927655625 2:24943070-24943092 CTGTGACCAGGGAGGAAAGATGG + Intergenic
928199764 2:29240097-29240119 CAGGGAGGAGGGAGGGAAGAAGG + Intronic
928599465 2:32889558-32889580 CTAAGAGAAGGCAGTCAAGAAGG - Intergenic
928885505 2:36143707-36143729 CTGTGAGACTGGGGGCAACAGGG - Intergenic
928901403 2:36322143-36322165 ATGTGAGAAGGGACCCAAGAGGG + Intergenic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
929904897 2:46037023-46037045 CTGTGGGAAGGCAGGCGAGGAGG - Intronic
930197947 2:48528296-48528318 CTGAGAGAAGTGGAGCAAGAAGG - Intergenic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
930929489 2:56862873-56862895 TTTGGAGAAGGGAGCCAAGATGG - Intergenic
932140519 2:69273382-69273404 CTGAGAGAAGAGAGGCCAGTTGG + Intergenic
932499881 2:72174047-72174069 CTGTGAGAAAAGGGGCAAGGTGG + Intergenic
932574208 2:72954009-72954031 CTGTAAGTGGGGAGGCAGGAAGG + Intronic
933318580 2:80744201-80744223 CTGTGAGACGGGTGGTACGATGG + Intergenic
933554372 2:83813445-83813467 CTGTGAGAAGGGATGGCAGGAGG - Intergenic
934232053 2:90192943-90192965 CTATGTTAAGGGAGGCAAGAAGG - Intergenic
934331824 2:92075314-92075336 ATGAGAGAAGGGAGGGAGGAAGG + Intergenic
935317023 2:101844992-101845014 GCGTGGCAAGGGAGGCAAGATGG + Intronic
935411636 2:102770585-102770607 CTGTGAGAAGAGAAGAAAGGAGG - Intronic
936252444 2:110877044-110877066 CTGTGATATGGGGGGCAACAGGG - Intronic
936529393 2:113265232-113265254 CTGTGGCAAGAGAGCCAAGAAGG + Intronic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
937065837 2:119016984-119017006 CTGTGAGAAAGGAGCCAGGGAGG - Intergenic
937078554 2:119124590-119124612 CTATCAGAAGGGAGCCAAGCTGG + Intergenic
937160298 2:119754781-119754803 CTTATAAAAGGGAGGCAAGAGGG + Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
937260032 2:120579455-120579477 CTGGGAGAACCGAGGCACGATGG - Intergenic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
937696211 2:124811307-124811329 ATGTGAGGAGGAAGGCGAGAGGG + Intronic
937799106 2:126060702-126060724 CTGTGAGAGGAGTGGCTAGAGGG - Intergenic
937888244 2:126915195-126915217 CTCCAAGAAGGAAGGCAAGAGGG + Intergenic
937962142 2:127468358-127468380 GTGTGAGGAGGGAGGCAGAATGG - Intronic
938186187 2:129234085-129234107 CTGTGAGAAAAAAGGCAAGTGGG + Intergenic
938472973 2:131582789-131582811 CTTTGAGAAGAAAAGCAAGATGG + Intergenic
938516120 2:132009493-132009515 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
939222661 2:139322518-139322540 CTGTGAAAATGGAAGCCAGATGG - Intergenic
939879656 2:147615535-147615557 CTTTGAGAAGGGAGGGGAAAGGG + Intergenic
940175458 2:150872957-150872979 CTGTGAGAAGGGAGGCAGATGGG - Intergenic
940401950 2:153257461-153257483 CTGTTAGAGAGGAGCCAAGATGG - Intergenic
940992371 2:160110790-160110812 CTGTGAGACGGGAGACAGGAGGG + Intronic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
942033335 2:171986190-171986212 GTGTGAGAAGGGAGGGAAAAAGG + Intronic
942360651 2:175168277-175168299 CCCTCAGAAGGAAGGCAAGAAGG - Intronic
942409758 2:175696488-175696510 CTAAGAGAATGGAGGAAAGAAGG + Intergenic
942766206 2:179460277-179460299 CTGTGAGAATAGAAGCAAGATGG - Intronic
942777800 2:179605873-179605895 CTGTGAAAAGGAAGGAAAGTTGG - Intronic
943499199 2:188666032-188666054 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499228 2:188666112-188666134 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
944545466 2:200795152-200795174 GTGAGAGAAGGTAGGCAATAAGG + Intergenic
945063155 2:205925851-205925873 CTGAGAGAAGGGTGGAAACACGG + Intergenic
945309672 2:208296633-208296655 GTGTGAAAAGGGAGGAAATAAGG + Intronic
945499873 2:210558599-210558621 CTGTGAGAAGGTAGGTATGTAGG + Intronic
946068807 2:217013300-217013322 GTGAGAGAAGGGAGGCAGGTAGG + Intergenic
946907244 2:224429153-224429175 CTGAGAGAAGTGGGGCAACAAGG - Intergenic
946984405 2:225256075-225256097 CTCTCATAAGGGATGCAAGATGG + Intergenic
947404672 2:229762496-229762518 ATGTGAGAAGGGCAGGAAGAAGG - Intergenic
947434372 2:230060297-230060319 ATGAGAGGAGGGAGGCTAGATGG + Intronic
948082254 2:235215948-235215970 GTGTGAGAAGGCAGGCCAGGAGG + Intergenic
948456777 2:238108185-238108207 CTGCGCGAAGGGAGGGAGGATGG - Intronic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169363639 20:4972911-4972933 ATGTCAGAAGGGAGGCACAAAGG + Intronic
1169801831 20:9518512-9518534 ATATAAGAAGGGAGGGAAGAAGG - Intronic
1169855872 20:10102243-10102265 AGGTGGAAAGGGAGGCAAGAGGG - Intergenic
1170144032 20:13153414-13153436 CTAATAGAAGGGAGGAAAGAGGG - Intronic
1170978311 20:21187546-21187568 CAGGGAGAAGGGAAACAAGAAGG - Intronic
1171033773 20:21700447-21700469 ATTTGTGAAGGGAGGCGAGAGGG - Intergenic
1172104846 20:32510791-32510813 GTGTGGGAAGGCAGGCGAGAGGG + Intronic
1172481435 20:35274166-35274188 CTGTGGCAAGGGAGGCAAGGTGG - Intronic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1173223909 20:41150658-41150680 GGATGAGAAGGGAGGGAAGATGG - Intronic
1173530880 20:43768622-43768644 CTATGGGAGGGGAGGCATGAGGG - Intergenic
1174109216 20:48186421-48186443 CAGTGAGAAGAGAGGCCAGCAGG - Intergenic
1174109455 20:48188177-48188199 CAGTGAGAAGGGAGGCTGGCAGG - Intergenic
1174548073 20:51341567-51341589 ATGAGAGAAGGAAGGCAAGTTGG - Intergenic
1175039602 20:56035753-56035775 CTTAGAGAAGGGAGGCAGGAGGG - Intergenic
1175189499 20:57201821-57201843 CTTTGAGAAGGGAAGAAGGAAGG - Intronic
1175637962 20:60601334-60601356 CTGCGACAAGGCAGGCAAGTTGG + Intergenic
1175700342 20:61132268-61132290 GTGTGAGAAGGGAGGCAGGGAGG - Intergenic
1176081927 20:63277838-63277860 CGGGGAGAGGTGAGGCAAGAGGG - Intronic
1176127038 20:63480205-63480227 CTGTGAGAAACCAGGGAAGAGGG - Intergenic
1178096643 21:29222642-29222664 CTGAGAGTAGGGAGTCAAAATGG + Intronic
1179567246 21:42256906-42256928 ATGTGAGAAGGACGGCAAGAGGG - Intronic
1179582754 21:42353845-42353867 CTGAGAGAAGGGAAACAATAGGG + Intergenic
1180120965 21:45747819-45747841 CTCAGAGGAGGGAGGAAAGAAGG - Intronic
1180453375 22:15488614-15488636 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1180594815 22:16966184-16966206 CTGTGAGTGGGGAGCCAAGCAGG + Exonic
1180729380 22:17970186-17970208 TGGTGAGAAGGGAGGACAGATGG + Intronic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1182021684 22:27086903-27086925 CTGTGAGAAAGGAGGCGTGCCGG + Intergenic
1182264202 22:29100056-29100078 TAGTGAGAAGGGAAGAAAGAAGG - Intronic
1182539767 22:31032494-31032516 CTGTAAGGAGTGAGCCAAGATGG - Intergenic
1183069759 22:35387819-35387841 CTGGGAGTAGGGAGCCAGGAGGG - Intronic
1183541028 22:38429568-38429590 GTGTGGGAAGGAAGGCAGGAGGG - Intronic
1183763131 22:39843634-39843656 CAGTGAGGAGGGAGGCAGGCAGG + Intronic
1183792762 22:40086984-40087006 CTGTGAGAGGGGAGCCTACAGGG - Intronic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1184614760 22:45630534-45630556 CTGGAAGAAGAGAGGCAAGGGGG + Intergenic
1184873735 22:47258937-47258959 GGGTGAGCAGGGAGGCAGGAAGG + Intergenic
949647192 3:6109533-6109555 CTGTCAGAAGGAAGGAAGGAAGG - Intergenic
949699780 3:6743180-6743202 CTATGAGAAAGGATGCAAAAAGG - Intergenic
949720027 3:6978211-6978233 ATGTGTAGAGGGAGGCAAGATGG + Intronic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950109292 3:10408254-10408276 CAGGGAGAAGGGAGCCAAGAAGG + Intronic
950454119 3:13082634-13082656 CAGTAAGAAGGGAGGCAGGAAGG - Intergenic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953852297 3:46473712-46473734 CTTACAGGAGGGAGGCAAGAAGG - Intronic
954298110 3:49685350-49685372 GTTTGAGAAGTGTGGCAAGAGGG - Exonic
955252161 3:57294587-57294609 GAATGAGAAGGGAGGGAAGAAGG + Intronic
955694032 3:61617639-61617661 CTCTGGCAAGGAAGGCAAGAGGG - Intronic
955977363 3:64491221-64491243 ATGTGAGAAGGTAAGCAAGCAGG + Intergenic
956283419 3:67583302-67583324 CAGTGAGGAGGCAGGCAAGCGGG - Intronic
956727967 3:72172091-72172113 CTGGGAGACGGGAGTCAAGATGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958932884 3:100226203-100226225 GTGGGAGGAGGGAGGAAAGATGG + Intergenic
959633842 3:108538928-108538950 GTGAGAGAAAGAAGGCAAGAGGG + Intergenic
960493068 3:118340934-118340956 CTGTGAGAAGTGGGGAAAAAAGG + Intergenic
961175075 3:124828497-124828519 CTGGGGTAAGGGAGGCAGGAGGG + Intronic
961587861 3:127948859-127948881 CAGTGAAAGGGGAGGAAAGAGGG + Intronic
962126626 3:132626212-132626234 CTGAGAGTAGAGAGGCAATATGG - Intronic
962350950 3:134655270-134655292 ATATGAGAAGGAAGGCAACACGG - Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
962979316 3:140473488-140473510 TTATAAGAGGGGAGGCAAGAGGG + Intronic
963037099 3:141040199-141040221 CTGAGAGAAGGGAGGCCAAGGGG + Intergenic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
964268530 3:154929529-154929551 CTGTGAGCCAGGAGGCAAGAGGG + Intergenic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
967303347 3:188038164-188038186 ATGTGAGAAGGGAGGCAGAAGGG - Intergenic
967640289 3:191854725-191854747 CTTAGAGAAGGGAGTGAAGAAGG - Intergenic
968148562 3:196319622-196319644 CTGAAAGAATGGAGGCAAGAAGG + Intronic
968937125 4:3617298-3617320 GTGAGAGATGGGAGGGAAGAAGG - Intergenic
969036366 4:4256994-4257016 CTGTGAGAAGGCATGCATAATGG - Intergenic
969460202 4:7324993-7325015 CCGTGAGATGGGAGGGCAGAAGG + Intronic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972426584 4:38938687-38938709 CTGTGAAAAGGGTAACAAGAGGG - Intronic
974390421 4:61259678-61259700 GTGTGAGAAAGGAGGAAAGCAGG + Intronic
974757387 4:66228104-66228126 CTGGAAGAATGGAGTCAAGAGGG + Intergenic
975219607 4:71799264-71799286 CGCTGAGCTGGGAGGCAAGAAGG - Intronic
975485724 4:74932984-74933006 CTGAGAGAAGGAAGGCCAGGGGG + Intergenic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
975811611 4:78175746-78175768 CAGTAGGAAGGGAGGCAGGAAGG + Intronic
975813736 4:78195904-78195926 CAGGGAGAGGGGAGCCAAGATGG - Intronic
975837627 4:78441328-78441350 TTGAGAGAAGGGAGGGGAGAGGG + Intronic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
976655171 4:87481048-87481070 CTGTGACAAGGTATTCAAGACGG + Intronic
976669240 4:87633635-87633657 ATGTGTGAAGGGAGGAAAAAGGG - Intergenic
976876015 4:89854631-89854653 TGGTGAGAAAGGAAGCAAGAGGG + Intergenic
977064679 4:92299789-92299811 ATTTTAGAAGGGAGGGAAGAGGG + Intronic
977178434 4:93842767-93842789 CTGTTAGAAGGGAGGTAACAGGG + Intergenic
977756252 4:100675723-100675745 CTGTGAGAAACTAGGCAACAGGG - Intronic
979132891 4:117070627-117070649 CAGGGATAATGGAGGCAAGAAGG - Intergenic
979301418 4:119091826-119091848 CTGTGACAATGGCGGCAAGCAGG - Intergenic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
981521063 4:145663005-145663027 CTTTAAGAATGGAGGCAATAAGG + Intergenic
981547458 4:145909235-145909257 CTATGAGCAGGGAATCAAGAAGG - Intronic
981563040 4:146067692-146067714 CTGTGAGAAGGAAGGAGAGAAGG - Intergenic
981844158 4:149147491-149147513 CCGTAAGAAGGGAGGCTATAAGG - Intergenic
982045208 4:151438184-151438206 CTTAGAGATGGGAGGCAACACGG - Intronic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
983183684 4:164677428-164677450 CTGGGAGAATGGAGCCAAGTTGG + Intergenic
983889092 4:173012694-173012716 TTGAGAGAAGGAAGGCAGGAGGG - Intronic
985894718 5:2741406-2741428 CTGTTAGAATGGAGGCAAGGAGG + Intergenic
985905574 5:2832834-2832856 CTTTGAGGAGTGAAGCAAGAGGG - Intergenic
987017171 5:13832486-13832508 AGCAGAGAAGGGAGGCAAGAAGG - Intronic
989289123 5:39741136-39741158 CAGGGAGAAGGCAGGAAAGAGGG - Intergenic
989788231 5:45357958-45357980 TGGTGAGAAAGGAAGCAAGAGGG - Intronic
990209386 5:53466106-53466128 CTTTGAGAAGGAAGGCAGGTAGG - Intergenic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
992175612 5:74146299-74146321 CAGTCAGAAGGGAAGGAAGATGG - Intergenic
994032587 5:95161434-95161456 CTGGGGGAAGGGGGTCAAGAGGG + Intronic
994771627 5:103988962-103988984 CAGTGAGAAGAGATACAAGAAGG + Intergenic
995583678 5:113624960-113624982 CTCGGAGAAGAGAGGCGAGAAGG + Intergenic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
996265455 5:121534513-121534535 CTTTGAGGAGGGAGCCAAGATGG + Intergenic
997731895 5:136187568-136187590 CTGTGATTGGGGAGGCAATATGG + Intronic
997782541 5:136674842-136674864 CACTGAGGAGGGAGGCAAGGTGG + Intergenic
997809990 5:136957643-136957665 CTATGAGTAGCAAGGCAAGAGGG + Intergenic
998326598 5:141286445-141286467 CGATGAGAAAGGAGGCAAGAGGG + Intergenic
998555880 5:143123302-143123324 CAGTGAAAAAGGAGTCAAGATGG - Intronic
999371716 5:151059491-151059513 CTTTGTGAAGGGAGGCAGCAGGG + Intronic
999432757 5:151538309-151538331 TTTGGAGAAGGAAGGCAAGATGG + Intronic
1000232569 5:159329811-159329833 CTGTGAGAAGGGGGAAAAAAAGG - Intronic
1000561014 5:162789466-162789488 CTGTGAGAGGGGAGCCTACAGGG - Intergenic
1000867388 5:166531801-166531823 TTGAGAGAAGGAAGGGAAGAAGG - Intergenic
1001571481 5:172733185-172733207 CTGGGAGAGAGGAGGCAGGATGG + Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002292551 5:178209742-178209764 CTGTGAGCAGGTAGGCAGAAGGG + Intronic
1004232691 6:13847303-13847325 CTGTGAGATTAGAAGCAAGATGG - Intergenic
1004564991 6:16787952-16787974 TGATGAGAAGGGAGGCAAGTGGG + Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005298065 6:24446028-24446050 CTGTCAGTTGGGAGGCAGGATGG - Intronic
1005487823 6:26317943-26317965 CTGTGAGGTGAGAAGCAAGACGG + Intergenic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1006173259 6:32107590-32107612 CTGTGGGGAGGGTGCCAAGAGGG - Intronic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006727620 6:36211231-36211253 CAGGGAGAAGGGAGGACAGAAGG - Intronic
1006920751 6:37625666-37625688 CAGAAAGAAGGGAGGGAAGAGGG - Intergenic
1007176500 6:39901378-39901400 CTCTGAGAAGGCCTGCAAGAAGG - Exonic
1007958945 6:45941373-45941395 CTGTGTCAAGGGGGACAAGATGG + Intronic
1008585973 6:52949685-52949707 CTCTGAGAAGGGAGAGAGGAAGG + Intergenic
1008675029 6:53810126-53810148 CTGCAAGAAGGAAGGCAGGAAGG + Intronic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1009727707 6:67556953-67556975 CTGGGAGAATGGAAGCAAGTTGG - Intergenic
1011979223 6:93351323-93351345 CAGAGAGAAGGGAAGCAAGCAGG - Intronic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012925512 6:105263357-105263379 CTGTGAGAGGGGAGGACACAGGG + Intergenic
1013055085 6:106575419-106575441 CTGTGAGAACGTAGGGACGACGG + Intronic
1013838541 6:114362021-114362043 CTCTGAGAAGGAAGGAAGGAGGG - Intergenic
1014677045 6:124379364-124379386 AGGAGAGAAGGGAGGAAAGAAGG + Intronic
1014960620 6:127679598-127679620 GAATGTGAAGGGAGGCAAGATGG - Intergenic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1018026885 6:159813822-159813844 CTTTGGAAACGGAGGCAAGAGGG - Intronic
1018134511 6:160766992-160767014 CTGTGAGAAGTGAGGGTTGAAGG - Intergenic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1018181405 6:161226599-161226621 CTCTGAGAAGTGAGAGAAGATGG - Intronic
1018274103 6:162111602-162111624 GTGTGAGAAGGAAGGCAAGTGGG + Intronic
1018417305 6:163612217-163612239 CTGGGAGAAGGTAGCCAAGCAGG + Intergenic
1018487926 6:164261148-164261170 GTGGGAGAAGGAAGGCAAGGGGG - Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018873329 6:167799453-167799475 CTGTCAGGAGGGAAGCCAGATGG - Intergenic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1019002118 6:168763146-168763168 TGGCGAGAATGGAGGCAAGAGGG + Intergenic
1019706635 7:2500046-2500068 CTGAAAGAAGGGAGCCAGGAGGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1020148927 7:5666681-5666703 CTGTGAGAAGCTCGGCAGGAAGG - Intronic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021783544 7:24130247-24130269 GGGTGATCAGGGAGGCAAGAAGG - Intergenic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1022502238 7:30889093-30889115 GTGGCAGAAGGGAGGCAGGAAGG - Intronic
1023834510 7:44060397-44060419 CTGTGACAAGGGTGGCAACTGGG - Intronic
1024228496 7:47346357-47346379 CTGTTAAAAGGGAGACAAGCAGG + Intronic
1024462957 7:49678987-49679009 CTCTGAGAATGGTGTCAAGATGG + Intergenic
1024580598 7:50797407-50797429 CAGAGAGACGGGAGGCACGACGG - Intergenic
1024762596 7:52618247-52618269 GTATGAGAAGGGAGGCAGAAAGG - Intergenic
1025093134 7:56079330-56079352 CTGGGAGAAAGGGGACAAGAAGG - Intronic
1025480904 7:60981620-60981642 AAGTGAGAAAGGAGGCAGGAAGG + Intergenic
1027287145 7:76658364-76658386 CTCTTAGAAGGGAGGCAACATGG - Intergenic
1027518486 7:79172105-79172127 GTGTAAGAAGGAAGGGAAGAGGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028618832 7:92801629-92801651 AAGAGAGAAGGGAGGGAAGAAGG - Intronic
1029974987 7:104825348-104825370 CTGTGAAAAGAGAAGCAACATGG + Intronic
1030214569 7:107031110-107031132 TTGAGAGAAGCGAGGCCAGATGG - Intergenic
1030346040 7:108433655-108433677 TGGTGAGAAGGCAAGCAAGAGGG - Intronic
1031184589 7:118460482-118460504 CTGTGGGAAGGCAGGAAATAAGG - Intergenic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1031976247 7:128095410-128095432 CTGTGAGCAGGTGGGGAAGAAGG + Intergenic
1032007615 7:128315955-128315977 CTGTGGGAAGGAAGGCATCAAGG + Intronic
1034453032 7:151148028-151148050 CTTTGTAAAGAGAGGCAAGATGG + Intergenic
1034662657 7:152785521-152785543 GAGAGAGAAGAGAGGCAAGAGGG + Intronic
1034884751 7:154790792-154790814 CTAAGAGAAGGGAGGAAAGGAGG + Intronic
1035158082 7:156930336-156930358 CTGGGAGAAGGGGAGGAAGACGG - Intergenic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035819405 8:2576379-2576401 CTGTGAGAAAGCATGAAAGACGG - Intergenic
1036718819 8:11153295-11153317 CTGTTAGAAGTGAGGAAATATGG + Intronic
1037580548 8:20243487-20243509 CTGTGAGAAGGGAGACAGTTGGG - Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1037805387 8:22055716-22055738 CAGAGAGAAGGGAGGAAGGAAGG - Intronic
1038367537 8:26951599-26951621 GAGAGAGAAGGGAGGAAAGAAGG - Intergenic
1038599869 8:28929352-28929374 TTGTGAGAAGGGAAGTGAGAAGG + Intronic
1041499870 8:58528950-58528972 CTGTGAGAATGGAAGCAGGATGG - Intergenic
1041592533 8:59605692-59605714 GTGTAAGAAGAGAGGGAAGAAGG + Intergenic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1044399266 8:91751267-91751289 ATGTGAGAAGTTAGGAAAGAGGG - Intergenic
1044599956 8:93993623-93993645 CTGTGAGCTGGGAGGCTCGATGG - Intergenic
1044773215 8:95659526-95659548 ATCTGGGAACGGAGGCAAGAAGG + Intergenic
1045249909 8:100474621-100474643 TTGCGAGAAGGGAGGCGAAAAGG + Intergenic
1045870105 8:106916882-106916904 ATGGAAGAAGGGAGGGAAGAAGG - Intergenic
1045871483 8:106932379-106932401 CTGTGAAATGGAAGGCAAGGAGG + Intergenic
1046795310 8:118365154-118365176 TGGTCAGAAGGGAGGGAAGATGG - Intronic
1046812288 8:118546085-118546107 CTGTGTGAAGGCAGGAATGATGG - Intronic
1047061860 8:121235800-121235822 GAGTGAGAAGGAAGGAAAGAAGG - Intergenic
1047497999 8:125422275-125422297 ATGTGAGGAGGGAGGAGAGAGGG + Intergenic
1047622337 8:126620697-126620719 TTGTGAGAAGGCATCCAAGAGGG - Intergenic
1050013748 9:1211402-1211424 CTATGAGAATGGAGACAACAAGG - Intergenic
1050697007 9:8290769-8290791 CTGAGAGAAAGGAGGCTACAGGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050933716 9:11366426-11366448 CTGGGAGAAGGGAGGAAGAAGGG + Intergenic
1050965484 9:11795959-11795981 TTGAGAGGAGGGAGCCAAGATGG - Intergenic
1051039248 9:12785936-12785958 CTGAGAGAAGTGGAGCAAGACGG - Intronic
1051130679 9:13856600-13856622 CTGTGAAGAGGTAGGAAAGATGG - Intergenic
1051165953 9:14262136-14262158 GAGTGAGAAGGGCAGCAAGAGGG - Intronic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051894731 9:21975194-21975216 CTGGGAGCAGGGAGGCCGGAGGG - Intronic
1052844449 9:33322649-33322671 CTGAGAGAAGCAAGCCAAGAAGG + Intronic
1053009917 9:34627292-34627314 GTGTGAGAAGGTAGGCAGGGTGG + Intronic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053310053 9:37012222-37012244 CTGTGAGATGAGAGACAAGAGGG - Intronic
1054943832 9:70773107-70773129 ATGAGAGAAGGGAGAGAAGATGG + Intronic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055430822 9:76241602-76241624 ATGTGAGAAGGGAAGAAAGAAGG - Intronic
1055513790 9:77018366-77018388 CAGAGAGAAGAGAAGCAAGAAGG + Intergenic
1055553988 9:77457544-77457566 GTGTGAGAAAGCAGCCAAGAGGG + Intronic
1055561063 9:77522237-77522259 GTAGGAGAAGGCAGGCAAGAAGG + Intronic
1055581927 9:77715041-77715063 ATGTGAGAAGGCAGGAAAGATGG + Intergenic
1056298543 9:85218469-85218491 CTGTGAGAAGAGACACCAGAGGG + Intergenic
1056332598 9:85534259-85534281 CTGTGAGTAGGGGGGCGAGGAGG - Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1056950161 9:91035375-91035397 CTGGGAGATGGGAGGCTTGAGGG - Intergenic
1057312304 9:93950035-93950057 CTGTGGAAAGGGAGGCCTGAGGG - Intergenic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1057496764 9:95567422-95567444 CTGTGAGAAGGGGGACCAGGAGG - Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058590231 9:106557729-106557751 CTCTGAGAATGGAGGCAGGGAGG - Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059571763 9:115445329-115445351 CTGTCAGGAGGGAGGAAGGATGG - Intergenic
1059710638 9:116864778-116864800 ATGGGAGAAGGTATGCAAGATGG - Intronic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060656157 9:125374157-125374179 CACTGAGGAGGGAGGCAGGAGGG - Intergenic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061472978 9:130842066-130842088 CTGAGAGAAGGGAGACAAAGAGG + Intronic
1061604471 9:131698579-131698601 CTGTTAGAAGGGCGGGTAGAAGG + Intronic
1062059496 9:134487367-134487389 CAGGGAGAAGGGGGGCAAGAGGG - Intergenic
1062315073 9:135963091-135963113 CTGTGGGAGGGGAGGCCAGCAGG + Intergenic
1062514677 9:136926682-136926704 CTGTGAGAGGAGAGGCCAGGAGG - Intronic
1062699734 9:137892627-137892649 CTGTGAGACTGCAGGCAGGAGGG + Intronic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186359864 X:8829576-8829598 GTGAGAGAAGGGAGGAAAGGAGG - Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186501599 X:10055262-10055284 CTTTGAGAATGGAGGAAGGAAGG + Intronic
1186817922 X:13256250-13256272 CAGGGAGAAAGGAGACAAGAAGG - Intergenic
1187311145 X:18144207-18144229 CTGTGAGGAGGGAGACATGAGGG - Intergenic
1187505320 X:19874472-19874494 GTGAGAGAAGAGAGGCAGGAGGG + Intronic
1187771816 X:22706874-22706896 AAGAGAGAAGGGAGGGAAGATGG + Intergenic
1188327526 X:28823789-28823811 ATGTGATCAGGGAGGCAAGAAGG - Intronic
1189124832 X:38435475-38435497 CAGAGAGAAGGGAGGAAGGAAGG - Intronic
1189317223 X:40064600-40064622 CTGGGGGAGGGGAGACAAGAGGG + Intronic
1189343523 X:40222653-40222675 CCCTGAGAAGGAAGGAAAGAAGG + Intergenic
1189371932 X:40435549-40435571 AAATGAGAAGGGAGGCAAGAGGG + Intergenic
1190462883 X:50696119-50696141 CTTTGAGGAAGGAGGCAACATGG + Intronic
1190795537 X:53737738-53737760 CCATGAGGAGGGAGGCAAAAAGG + Intergenic
1191025552 X:55909146-55909168 CTTTAAGAAGCCAGGCAAGATGG - Intergenic
1192172916 X:68867867-68867889 CCGTGAGACGGGAGGCCAGCAGG - Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1194605745 X:95975848-95975870 CTGTGAGAGGTGGAGCAAGATGG + Intergenic
1194717671 X:97305856-97305878 ATGGGAAATGGGAGGCAAGAAGG + Intronic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195501956 X:105612602-105612624 CTGGAAGAAGGCAGGAAAGACGG + Intronic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1195604338 X:106785492-106785514 ATGTGACAAGGGAAGCAAGAGGG + Intronic
1195829461 X:109040084-109040106 CTCTGAGAAGGAAGGCCACAGGG - Intergenic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1197300547 X:124774862-124774884 CTGTGAAGAGGGAGATAAGAGGG - Intronic
1197994022 X:132352832-132352854 ATGGGAGAAGAGAGACAAGAGGG + Intergenic
1198599826 X:138270343-138270365 CAGTGAGAACGGAGGAAAGTAGG - Intergenic
1198954725 X:142115960-142115982 TGGTGAGGAGGCAGGCAAGATGG + Intergenic
1198954826 X:142117225-142117247 TGGTGAGGAGGCAGGCAAGATGG + Intergenic
1199095944 X:143738663-143738685 CTGTTGGAGGGGTGGCAAGAGGG + Intergenic
1199215946 X:145260502-145260524 GTGTGAGAAGGGAGGCAAGAGGG + Intergenic
1199432433 X:147776552-147776574 TTGTGGGAAGGGAAGCTAGAAGG + Intergenic
1199433766 X:147789687-147789709 CTGAGAGAAGGGAGGGGAGTGGG - Intergenic
1199955781 X:152741047-152741069 GTGTGAGAAGGGAGGGAGGTGGG + Intergenic