ID: 936694280

View in Genome Browser
Species Human (GRCh38)
Location 2:114928383-114928405
Sequence CTGATTTTCAGACTTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1197
Summary {0: 1, 1: 9, 2: 40, 3: 201, 4: 946}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936694280 Original CRISPR CTGATTTTCAGACTTGTGTG GGG (reversed) Intronic
900191118 1:1352678-1352700 CTGATTTTTAGACTTGTCCCAGG - Exonic
900817416 1:4859094-4859116 CTGAATTTTGGACTTGTATGGGG + Intergenic
900852365 1:5154061-5154083 TTGGATTTCAGACTTGTGTAGGG + Intergenic
901272279 1:7961714-7961736 TTCATTTTCAGCCTGGTGTGGGG + Exonic
901885809 1:12222277-12222299 CTGGGTTTCAGACTTGCATGGGG - Intergenic
901925549 1:12563929-12563951 CTGGGTTTTGGACTTGTGTGGGG + Intergenic
904283418 1:29437301-29437323 CCGGGTTTCAGACTTGTGTGAGG + Intergenic
904387419 1:30152640-30152662 CTGGGTTTCAGACTTGTGCAGGG + Intergenic
905290319 1:36917154-36917176 CTGGATTTCAGACTTGCATGGGG + Intronic
905965624 1:42093031-42093053 CTGGGTTTCAGACTTTTATGGGG - Intergenic
906894748 1:49758596-49758618 CTGGATTTCAGACTTGCATGGGG + Intronic
907259488 1:53206625-53206647 CTGGATTTCAGGCTTGCGTGGGG + Intronic
907579497 1:55558768-55558790 CTGTTCTACAGACATGTGTGTGG - Intergenic
907685720 1:56609433-56609455 CTGAATTTCAGACTTGCATGGGG - Intronic
908539712 1:65111224-65111246 CTGGATTTCAGACTTGCATGGGG - Intergenic
908871648 1:68620116-68620138 CTGGATTTCAGACTTGCTTGGGG - Intergenic
908882071 1:68743471-68743493 CTGGATTTCAGACTTGCATGGGG + Intergenic
909054299 1:70804285-70804307 CTGGATTTCAGACTTGCTTGGGG + Intergenic
909063515 1:70905583-70905605 CTGGATTTCGGACTTGTATGGGG + Intronic
909086141 1:71172149-71172171 CTGGATTTCAGACTTGCATGGGG - Intergenic
909197107 1:72641374-72641396 ATGATTTTCATAATTGTGTCTGG - Intergenic
909257846 1:73447751-73447773 CTAAGTTTCAGACTTGCATGGGG - Intergenic
909333051 1:74437892-74437914 CTGCTTTTTAGAATTATGTGGGG - Intronic
909350659 1:74649525-74649547 GTGATTTCCATACTTGTCTGTGG - Intronic
909436443 1:75647721-75647743 CTGGATTGCAGACTTGTGTGAGG + Intergenic
909699833 1:78510900-78510922 CTGGGTTTTGGACTTGTGTGGGG - Intronic
909700327 1:78514389-78514411 CTGGGTTTAGGACTTGTGTGGGG + Intronic
909710784 1:78647064-78647086 CTGGATTTCAGACTTGCATGGGG - Intergenic
909810301 1:79924613-79924635 CTGGATTTCAGACTTGCATGGGG + Intergenic
910013721 1:82496064-82496086 CTGAGTTTCAGACTTGCATGGGG - Intergenic
910377851 1:86593128-86593150 CTGGGTTTCACACTTGTGTGAGG - Intergenic
910409315 1:86924120-86924142 CTGGATTTCAGACTTGCATGGGG - Intronic
910423831 1:87099867-87099889 CTGGGTTTTAGACTTGTGTGGGG - Intronic
911007543 1:93242787-93242809 CTGAATTTCAGACTTGCATGGGG - Intronic
911114491 1:94232607-94232629 TTTATTTACAGGCTTGTGTGAGG + Intronic
911512821 1:98828089-98828111 CTAAGTTTCAGACTTGCCTGAGG + Intergenic
911741013 1:101386845-101386867 CTGGATTTCAGACTTGCATGGGG - Intergenic
911855645 1:102872009-102872031 CTGGATTTCAGACTTGCATGGGG - Intergenic
911880042 1:103225322-103225344 CTGGTTTTTAGACTTGTGTGGGG + Intergenic
911880888 1:103236848-103236870 CTGGATTTCAGACTTGCATGGGG + Intergenic
912080698 1:105932476-105932498 CTGGATTTCAGACTTGCGTGGGG + Intergenic
912112816 1:106363987-106364009 CTAGGTTTCAGACTTGCGTGGGG + Intergenic
912182776 1:107238223-107238245 CTGGATTTCAGACTTGCATGGGG + Intronic
912222989 1:107699295-107699317 CTGGATTTCAGACTTGCATGGGG - Intronic
912333067 1:108836662-108836684 CTGATATTCAAACTTGAATGAGG - Intronic
913794232 1:122584623-122584645 TGGATTTTCAGACTTCTTTGAGG + Intergenic
913897589 1:124438012-124438034 CGGATATTCAGACTTCTTTGAGG + Intergenic
914905185 1:151738049-151738071 CCCGGTTTCAGACTTGTGTGGGG + Intergenic
915147666 1:153804934-153804956 CTGATTTTCTGCATTGTGTTTGG - Exonic
915787041 1:158624484-158624506 TTGGATTTCAGACTTGTATGAGG + Intronic
916288092 1:163132766-163132788 CAGAGTTCCAGATTTGTGTGGGG + Intronic
916400950 1:164448203-164448225 CTGGGTTTCAGACTTCTGTGAGG - Intergenic
916724244 1:167508780-167508802 CTAATTTTCATCATTGTGTGGGG - Intronic
916790397 1:168120295-168120317 CTGGGTTTCAGACTTGCATGGGG + Intronic
917060687 1:171033741-171033763 CTAATTTTAAGAATTTTGTGGGG - Intronic
917114484 1:171588731-171588753 CTCATTATCAGAGCTGTGTGGGG - Intronic
917152047 1:171956365-171956387 CTGGATTTCAGACTTGCATGGGG - Intronic
917235548 1:172888351-172888373 CTGGGTTTTGGACTTGTGTGGGG - Intergenic
917777358 1:178351817-178351839 CTGGGTTTCAGACTTGTATGGGG - Intronic
917802214 1:178581233-178581255 ATGATGTTCAGACTTGGTTGGGG + Intergenic
917894617 1:179475508-179475530 CTGGATTTCAGACTTGCATGGGG + Intronic
918164524 1:181931780-181931802 CTATTTTTCAAATTTGTGTGTGG - Intergenic
918274715 1:182942612-182942634 CTGATTTTCAGACAAGTGCAGGG - Intronic
918322991 1:183382663-183382685 CTGGGTTTCAGACTTGCATGGGG - Intronic
918668145 1:187178131-187178153 CTGGGTTTCAGACTTGTGTGAGG - Intergenic
918820925 1:189253195-189253217 CTGAATTTCAGACTTGCGTAGGG - Intergenic
918886670 1:190202247-190202269 CTGGATTTCAGACTTGCATGAGG + Intronic
918931358 1:190860097-190860119 CTGGGTTTCAGACTTGCATGGGG - Intergenic
918936692 1:190930284-190930306 CTGGATTTCAGACTTGTATAGGG + Intergenic
918990696 1:191694488-191694510 TTGGATTTCAGACTTGCGTGTGG - Intergenic
919030818 1:192239779-192239801 CTGCTTTTCAGACATGTGGCAGG - Intergenic
919156734 1:193775610-193775632 CTGAGTTTCAGACTTGCATGGGG - Intergenic
919179153 1:194059179-194059201 CTGATTTTCAGACTTGCATGGGG - Intergenic
919242790 1:194936314-194936336 TTGGATTTCAGACTTGTATGTGG + Intergenic
919254549 1:195104886-195104908 CTGGGTTTCAGACTTGCATGGGG - Intergenic
919262069 1:195208866-195208888 CTGAAAATCAGATTTGTGTGGGG + Intergenic
919311737 1:195917918-195917940 CTGGGTTTCAGACTTGTATGGGG + Intergenic
919398697 1:197081975-197081997 CTGGATTTCAGACTTGCATGGGG + Intergenic
920379411 1:205527067-205527089 CTGATGTTCAGAGTTGAGAGTGG - Intronic
920594455 1:207255168-207255190 TTGGATTTCAGACTTGTGTGGGG - Intergenic
920598013 1:207292283-207292305 CTGGATTTCAGACTTGTGTGGGG + Intergenic
921613592 1:217240814-217240836 CTGATTTACAGATTTGTGTAAGG + Intergenic
922320104 1:224479656-224479678 CTGGATTTCAGACTTGCATGGGG - Intronic
922666203 1:227471517-227471539 CTGCATTTTAGACTTGTATGGGG + Intergenic
923139746 1:231151319-231151341 CTGGGTTTCGAACTTGTGTGGGG - Intergenic
923899093 1:238305680-238305702 CTGAATGTTGGACTTGTGTGGGG + Intergenic
923941607 1:238833009-238833031 CTGAGTTTCAGACTTGCATGGGG + Intergenic
924021655 1:239789977-239789999 CTGGATTTCAGACTTGCATGGGG + Intronic
924314825 1:242784884-242784906 CTGCTTTTCTGTCTTTTGTGAGG - Intergenic
1063481424 10:6380056-6380078 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1064211840 10:13366443-13366465 CAGGTTTTCAGACTTGGGTGTGG - Intergenic
1064821436 10:19339100-19339122 CTGTTTTTCAGACTTTTGACAGG - Intronic
1066034103 10:31463486-31463508 GTGATTTTCAGGCTTCTGAGAGG + Intronic
1066554205 10:36593271-36593293 GTGGTTTTCAAACTTGAGTGTGG - Intergenic
1066636899 10:37511983-37512005 CTGGATTTCAGACTTGCATGGGG + Intergenic
1067666024 10:48280031-48280053 CTGGATTTCAGACTTGTATGGGG - Intergenic
1067814780 10:49465241-49465263 CTGGACTTCAGACTTGTGTGGGG + Intronic
1067922829 10:50477284-50477306 CTGGGTTTCAGACTTGCATGGGG + Intronic
1067966841 10:50923032-50923054 CTAAATTTCAGACTTGCATGGGG - Intergenic
1068114146 10:52718367-52718389 CTGCACTTCAGACCTGTGTGAGG + Intergenic
1068243630 10:54337045-54337067 CTGGATTTCAGACTTGTATAGGG + Intronic
1068432385 10:56949485-56949507 CTAGGTTTTAGACTTGTGTGGGG + Intergenic
1068597519 10:58919113-58919135 TTCATTTTCACACTTGTTTGAGG + Intergenic
1068908269 10:62351379-62351401 CTGGATTTCAGACTTGCATGGGG - Intergenic
1069175004 10:65279720-65279742 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1069368077 10:67714410-67714432 CTGGCTTTCAGACTTGTGTGGGG + Intergenic
1070206167 10:74264609-74264631 TTCATTTTAAAACTTGTGTGAGG - Intronic
1070637710 10:78142438-78142460 CTGGATTTCAGACTTGCATGGGG + Intergenic
1071034925 10:81233439-81233461 CTGTTTTTCAGACTTACATGGGG + Intergenic
1071098837 10:82011703-82011725 CTGGATTTCAGACTTGCATGGGG - Intronic
1071169533 10:82848360-82848382 CTGGATTTCAGACTTGCATGGGG + Intronic
1072280689 10:93862796-93862818 CTGAGTTTCAGACTTGTGTGGGG + Intergenic
1072963482 10:99951635-99951657 CTGGATTTCAGACTTGCGTGGGG + Intronic
1073701811 10:105935504-105935526 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1073717170 10:106120877-106120899 CTACTTTTCAGATTTGTGTGAGG + Intergenic
1073734139 10:106326663-106326685 ATGAATTTCAGACTTGCATGAGG - Intergenic
1073785071 10:106879938-106879960 CTGATCTACAGAATTGTGTGAGG + Intronic
1073864663 10:107787730-107787752 CTGGATTTCAGACTTGCATGGGG + Intergenic
1074223702 10:111462691-111462713 CTGGATTTCAGACTTGTATGGGG + Intergenic
1074622263 10:115138033-115138055 CTGGATTTCAGACTTGCATGAGG - Intronic
1074803997 10:117029181-117029203 CTGGGTTTCAGACTTGCATGGGG + Intronic
1074948798 10:118307941-118307963 CTGATTTACAGTCTTGGCTGAGG + Exonic
1075530480 10:123224980-123225002 CTGGATTTCAGACTTGCATGGGG - Intergenic
1076689823 10:132217276-132217298 CTGGATTTCAGACTTGCATGGGG + Intronic
1077735201 11:4783343-4783365 CTGGATTTCGGATTTGTGTGGGG + Intronic
1077941615 11:6848997-6849019 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1078146840 11:8727462-8727484 CTACTTTTCAGACTCTTGTGAGG + Intronic
1078201794 11:9190030-9190052 CTGGATTTCAGACTTGCATGGGG + Intronic
1078365107 11:10699983-10700005 CTGGATTTCAGACTTGCATGGGG + Intergenic
1078379631 11:10828757-10828779 CTGGATTTCAGACTTGCGTGGGG - Intronic
1078959452 11:16248048-16248070 TTGGATTTCAGACTTGCGTGGGG - Intronic
1078978675 11:16506324-16506346 CTGGGTTTCAGACTTGCATGGGG + Intronic
1079181876 11:18201108-18201130 CTGGATTTCAGACTTGCATGGGG - Intronic
1079536907 11:21526188-21526210 TTGGATTTCAGACTTGTGTGGGG - Intronic
1079652041 11:22942230-22942252 CTGAATTTTTGACTTGTATGGGG - Intergenic
1079753490 11:24227918-24227940 TTGAGTTTCAGACTTGCATGAGG - Intergenic
1079790417 11:24730914-24730936 CTGATTTTGTGACTTGTGCCAGG + Intronic
1079872962 11:25822744-25822766 CTGAGTTTCAGTCTTGCATGGGG + Intergenic
1079903921 11:26222206-26222228 CTGTGTTTCAGACTTGTGTGGGG - Intergenic
1079915569 11:26365112-26365134 CTGTGTTTCAAACTTGTGTGTGG - Intronic
1079957016 11:26878664-26878686 TTGGATTTCAAACTTGTGTGGGG - Intergenic
1079962375 11:26940559-26940581 CTGGATTTCAGACTTGCATGGGG - Intergenic
1080717509 11:34818503-34818525 CTGGATTTCAGACTTGTATGGGG - Intergenic
1080843263 11:36004341-36004363 CTGGGTTTCAGACTTGTGTGGGG - Intronic
1080946664 11:36981667-36981689 TTGGATTTCAGACTTGTATGCGG - Intergenic
1081077611 11:38696098-38696120 CTCTATTTCAGACTTGCGTGGGG - Intergenic
1081261948 11:40971892-40971914 CTGGTTTTCAGACTTGCGTGGGG + Intronic
1081315494 11:41625093-41625115 CTGGATTTCAGACCTGTATGGGG - Intergenic
1081598797 11:44477515-44477537 CTGGATTTCGGACTTGCGTGGGG + Intergenic
1082736910 11:56866036-56866058 CTGGATTTCAGACTTGCATGGGG + Intergenic
1082780584 11:57284441-57284463 CTGGGTTTCAGATTTGTATGGGG + Intergenic
1082862288 11:57868015-57868037 CTGGGTTTTGGACTTGTGTGAGG - Intergenic
1083495886 11:63052638-63052660 CTTGGTTTCAGACTTGGGTGGGG + Intergenic
1083966723 11:66048046-66048068 CGGATTTTCTGGCTGGTGTGGGG + Intronic
1084626640 11:70312829-70312851 CTGCTTTTCAGAGTAGAGTGGGG + Intronic
1084670922 11:70606167-70606189 CTGATTTCCAGACATGGGTTGGG - Intronic
1084682890 11:70677415-70677437 CTAATTTTCAGAATCGTGGGTGG - Intronic
1085215451 11:74826733-74826755 CTGGATTTCAGACTTGCATGGGG - Intronic
1085219105 11:74858517-74858539 CTGCATTTCAGACTTGAGTAGGG + Intronic
1085501636 11:77029981-77030003 CTGTTTTTCAGACTAGGGTGTGG + Intergenic
1085818927 11:79771190-79771212 CTGGTTTTCAGACTTGCATGAGG + Intergenic
1086288040 11:85271716-85271738 CTGGCTTTCAGACTTGCATGGGG + Intronic
1086769611 11:90745439-90745461 CTCAATTTCAGACTTGCATGGGG + Intergenic
1086826669 11:91507474-91507496 CTGCATTTCAGACTTGCATGGGG - Intergenic
1087341879 11:96916550-96916572 CTGGATTTCAGACTTGCATGGGG + Intergenic
1087412448 11:97808845-97808867 CTGAGTTTCAAACTTGCATGGGG + Intergenic
1087457756 11:98408722-98408744 CTCATTTTCAGTTTTGTCTGTGG - Intergenic
1087781090 11:102302251-102302273 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1087793719 11:102433387-102433409 CTGGATTTCAGACTTGCATGGGG + Intronic
1088048442 11:105481016-105481038 CTGGATTTCAGACTTGCATGAGG + Intergenic
1088426883 11:109714322-109714344 CTGGATTTCAGACTTGCATGGGG - Intergenic
1088567204 11:111184556-111184578 CTAGATTTCAGACTTGTGTGGGG + Intergenic
1089820935 11:121225759-121225781 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1089952021 11:122536569-122536591 CTGGCTTTCAGACTTGCATGGGG + Intergenic
1091086276 11:132724812-132724834 CTGGATTTCAGACTTGCATGGGG - Intronic
1091146265 11:133282873-133282895 CTGAGTTTGAGACTTGTGTGTGG + Intronic
1091533846 12:1387012-1387034 CTGGATTTCAGACTTGCTTGGGG + Intronic
1091552970 12:1550721-1550743 CTGGGTTTCAGACTTCCGTGGGG + Intronic
1092091877 12:5810334-5810356 CTGATTTCCATGCTTGTTTGGGG - Intronic
1092642962 12:10537303-10537325 CTGGATTTCAGACTTGTATGGGG - Intergenic
1092652302 12:10647375-10647397 CTGGATTTCAGACTTGTATGGGG + Intronic
1092724880 12:11475276-11475298 CTGGGTTTCAGAATTGCGTGAGG + Intronic
1093014721 12:14144515-14144537 CTGGATTTCAGACTTGCCTGGGG - Intergenic
1093185494 12:16014947-16014969 CTGGATTTCAGACTTGCATGGGG + Intronic
1093688183 12:22079936-22079958 CTGTTTTTCTGACTTCTCTGGGG - Intronic
1093967190 12:25340269-25340291 CTGGATTTCAGACTTGCATGGGG - Intergenic
1093974013 12:25401227-25401249 CTGGATTTCAGACTTGTATGGGG + Intergenic
1093989004 12:25569271-25569293 CTGGGTTTCAGACTTGCATGGGG + Intronic
1094471274 12:30804019-30804041 CTGGATTTCAGACTTTTATGGGG - Intergenic
1095122547 12:38436854-38436876 CTGGATTTCAGACTTGCATGGGG - Intergenic
1095340249 12:41081095-41081117 CTGGATTTTGGACTTGTGTGGGG + Intergenic
1095430769 12:42132273-42132295 CTGATTTTAAGACTTATCTGCGG - Intronic
1095516924 12:43016167-43016189 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1095803378 12:46292662-46292684 CTGGATTTCAGACTTGCATGGGG - Intergenic
1096050797 12:48605903-48605925 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1096886810 12:54726650-54726672 CTGAGTTTTAGACTTGCGTGGGG - Intergenic
1097668759 12:62512422-62512444 CTGAATTTCGGACTTGCATGGGG - Intronic
1098435174 12:70461007-70461029 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1098509116 12:71291323-71291345 CTGGATTTCAGACTTGCGTGGGG - Intronic
1098660464 12:73087333-73087355 CTGGATTTCGGACTTGTGTGGGG - Intergenic
1099190348 12:79555100-79555122 CTGATTTGATGACTTGTCTGAGG - Intergenic
1099352642 12:81592130-81592152 CTGGATTTCAGACTTGCATGGGG + Intronic
1099379618 12:81938419-81938441 CTGGATTTCAGACTTGCATGGGG - Intergenic
1099386510 12:82019245-82019267 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1099501527 12:83419468-83419490 CTGAATTTCAGACGTGCATGGGG + Intergenic
1099526841 12:83726866-83726888 ATGGGTTTCAGACTTGCGTGGGG + Intergenic
1099663419 12:85596158-85596180 CTGGATTTCAGACTTGCATGGGG - Intergenic
1099668523 12:85660560-85660582 CTGGATTTCAGACTTGCATGGGG + Intergenic
1099672829 12:85717237-85717259 CTGCATTTCAGACTTGCATGGGG - Intergenic
1099898825 12:88682016-88682038 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1100052099 12:90461309-90461331 CTGAGTTTCAGACTTCTGTGGGG - Intergenic
1100427619 12:94501845-94501867 CTGGATTTCAGACTTGCATGGGG - Intergenic
1100598001 12:96088113-96088135 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1100933073 12:99632663-99632685 TTGGGTTTCAGACTTGTTTGGGG + Intronic
1101222684 12:102657617-102657639 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1101814057 12:108131597-108131619 CTGCTTTTGGGTCTTGTGTGGGG + Intronic
1103588511 12:121973713-121973735 CTGGATTTCAGACTTGCATGAGG + Intronic
1104240456 12:126984393-126984415 CTGGATTTCAGACTTGTATGGGG - Intergenic
1105318485 13:19291310-19291332 CCTATTTTCAGACTAGTGAGGGG - Intergenic
1106318080 13:28612754-28612776 CTGACTTTTAGACTTGCCTGAGG - Intergenic
1106483627 13:30154880-30154902 CTTACCTTCAGAGTTGTGTGGGG - Intergenic
1106529167 13:30572230-30572252 GTTATTTTCTGACATGTGTGGGG - Intronic
1107209683 13:37837526-37837548 CTGGATTTCAGACTTGCATGGGG + Intronic
1107472501 13:40703694-40703716 CTGGATTTCAGACTTGTGTGGGG + Intergenic
1107554690 13:41507589-41507611 CTGGATTTCAGACTTGCATGGGG - Intergenic
1107972208 13:45654578-45654600 CTGGGTTTCAGACTTGTGCGAGG - Intergenic
1108855828 13:54791535-54791557 CTGGGTTTCAGATTTGTGTGGGG - Intergenic
1108991856 13:56668465-56668487 CTGATTTTCAGAGTTATTTTAGG + Intergenic
1109091583 13:58052677-58052699 TTGAGTTTCAGATTTGAGTGGGG + Intergenic
1109169211 13:59075318-59075340 CTGGATCTCAGACTTGCGTGGGG - Intergenic
1109218553 13:59617211-59617233 CTGTTTCTCAGACCTGGGTGTGG - Intergenic
1109342301 13:61076772-61076794 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1109346863 13:61125441-61125463 CTGGATTTCAGACTTGCATGGGG - Intergenic
1109384313 13:61607689-61607711 CTGGGTTTCAGATGTGTGTGGGG - Intergenic
1109423631 13:62145517-62145539 CTGAATTTCAGACTTGTATGTGG - Intergenic
1109702650 13:66047562-66047584 CTGGATTTCAGACTTGTATGGGG - Intergenic
1109717463 13:66234852-66234874 CTGAGTTTCTGATTTGTATGGGG + Intergenic
1109810803 13:67509854-67509876 CTGGATTTCAGGCTTGTATGGGG + Intergenic
1109832629 13:67812183-67812205 CTGGATTTCAGACTTGCATGGGG - Intergenic
1110157927 13:72341422-72341444 CTGGATTTCAGACTTGCATGGGG + Intergenic
1110618821 13:77572053-77572075 ATTATTTTCAGACATGTGGGTGG + Intronic
1110635727 13:77765669-77765691 CTGGGTTTCAGACCTGTATGTGG - Intergenic
1110793096 13:79606847-79606869 CTGGATTTCAGACTTGTGTGGGG - Intergenic
1110881368 13:80576844-80576866 CTAATGTGCAGACTAGTGTGGGG + Intergenic
1111072628 13:83188254-83188276 CTGGATTTCAGACTTGCATGGGG + Intergenic
1111217423 13:85162913-85162935 CTGAGTTTCAGACTTGCATGGGG - Intergenic
1111308511 13:86448929-86448951 CTGCTTTTAATAATTGTGTGGGG + Intergenic
1111334321 13:86801079-86801101 CTGGATTTCAGACTTGCATGGGG + Intergenic
1111457966 13:88508505-88508527 CTGGATTTCAGACTTGTGTAGGG - Intergenic
1111539817 13:89655769-89655791 CTGGATTTCATACTTGTATGGGG + Intergenic
1111615136 13:90652841-90652863 CTGAATTTCAGAATTGCATGGGG + Intergenic
1111803212 13:93005607-93005629 CTGAGTTTCAGACTTGCATGAGG - Intergenic
1112084622 13:96017021-96017043 CTGTGTTTCAGACTTGCATGGGG + Intronic
1112162980 13:96888677-96888699 CTGGATTTCAGACTTGCATGGGG - Intergenic
1112582783 13:100690818-100690840 CTGGATTTCAGACTTGCTTGGGG + Intergenic
1112799251 13:103092551-103092573 CTGGATTTCAGACTTGCATGGGG - Intergenic
1113212734 13:108001958-108001980 CTGGATTTCAGACTTGCATGGGG + Intergenic
1113497056 13:110739209-110739231 CTGGATTTCAGACTTGTATGGGG + Intergenic
1113803868 13:113102222-113102244 CTGCTTTTCACCCTTGTCTGGGG - Intergenic
1114431542 14:22665961-22665983 CTAGGTTTCAGACTTGTGTGGGG - Intergenic
1114918458 14:27296369-27296391 CTGGGTTTCAGATTTGTGTGGGG - Intergenic
1115541791 14:34427759-34427781 CTGGATTTCAGACTTGCATGGGG + Intronic
1115608977 14:35034052-35034074 CTGGATTTCAGACTTGCATGGGG - Intergenic
1115893738 14:38061136-38061158 CTGGATTTCAGACTTGCATGGGG - Intergenic
1115916478 14:38320985-38321007 CTGAGTTTCAGACTTGCATGGGG - Intergenic
1116255350 14:42547972-42547994 CTGGGTTTTGGACTTGTGTGGGG - Intergenic
1116263639 14:42661294-42661316 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1116281477 14:42914391-42914413 CTGGATTTCAGACTTGCTTGGGG - Intergenic
1116296580 14:43119256-43119278 CTGGATTTCGGACTTGCGTGGGG - Intergenic
1116420161 14:44722855-44722877 CTGGATTTCAGACTTGCATGGGG + Intergenic
1116694186 14:48150801-48150823 CTGGGTTTCAGACTTGCATGAGG + Intergenic
1116696470 14:48183788-48183810 CTGGGTTTCAGACTTGTATAAGG + Intergenic
1116998376 14:51347446-51347468 CTGGGTTTCATACTTGCGTGGGG + Intergenic
1117042197 14:51777579-51777601 GTTATTTTCAGTCTTGTGGGAGG + Intergenic
1117427836 14:55620089-55620111 CTGGATTTCAGATTTGTATGGGG - Intronic
1118029312 14:61804843-61804865 CTGAGGTTCAGACTCGTGTGTGG - Intergenic
1118151506 14:63195342-63195364 CTGGATTTCAGACTTGCATGGGG + Intergenic
1118460163 14:65980040-65980062 CTGAATTTCAGACTTGCATGGGG + Intronic
1118533066 14:66728602-66728624 CTGGCTTTCAGACTTGCGTGGGG + Intronic
1118598086 14:67451574-67451596 CTGGATTTCAGACTTGCATGGGG + Intronic
1119025851 14:71151587-71151609 CTGGGTTTCAGACTTGCATGTGG + Intergenic
1120082955 14:80236427-80236449 CTGGATTTCAGACTTGCATGGGG - Intronic
1120103889 14:80473234-80473256 CTGGATTTCAGACTTGCGTGGGG - Intergenic
1120230636 14:81836988-81837010 CTGGGTTTCAGACTTGCGTGGGG + Intergenic
1120247844 14:82027296-82027318 CTGGTTTTCAGACTTGCATGGGG - Intergenic
1120343024 14:83245606-83245628 CTGGGTTTCAGACTTGCATGAGG + Intergenic
1120591026 14:86373226-86373248 CTGGATTTCAGACTTGTGTGGGG + Intergenic
1120637049 14:86965545-86965567 CTGGATTTCAGACTTGCATGGGG + Intergenic
1120956828 14:90090340-90090362 CTGGATTTCAGACTTGCATGGGG + Intronic
1121130296 14:91439675-91439697 CTGCATTTCAGACTTGAATGGGG + Intergenic
1121140660 14:91538965-91538987 CTGGGTTTCAAACTTGTGTGGGG - Intergenic
1121215483 14:92244504-92244526 TTGAGTTTTGGACTTGTGTGGGG - Intergenic
1122654336 14:103247372-103247394 GTGCTTTTCAGAATTGTGTTGGG + Intergenic
1123826933 15:24091962-24091984 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1124066352 15:26347511-26347533 CTGGATTTCAGACTTGCATGGGG + Intergenic
1124717054 15:32073261-32073283 CTGGGTTTCAGACTTGTGTGTGG + Intronic
1125049360 15:35279119-35279141 CTGAGTTTCAGACTTGTGTGGGG + Intronic
1125251868 15:37713881-37713903 CTGGGCTTCAGACTTGTGTGGGG + Intergenic
1125625437 15:41104994-41105016 TTGATTTTCAGACTTCTTTGAGG - Intronic
1126436481 15:48644018-48644040 CTGGTTTTTTGAGTTGTGTGGGG - Intronic
1126514376 15:49519064-49519086 CTGGATTTCAGACTTGCATGGGG - Intronic
1126873156 15:53010941-53010963 CTGGATTTCAGACTTGCATGGGG - Intergenic
1126942755 15:53784388-53784410 CTGGATTTCAGACTTGCATGGGG - Intergenic
1127012834 15:54649225-54649247 CTGTCTTTCAGACTTGTATGGGG - Intergenic
1127043539 15:55002669-55002691 CTGGATTTCAGACTTGCATGGGG - Intergenic
1128027710 15:64452276-64452298 CAGATTTTCAGATTTGTGGCAGG - Intronic
1128044123 15:64602536-64602558 ATTATTTTCAGACTTCTTTGTGG + Intronic
1128491907 15:68155764-68155786 CTGTTTTTCATAGTTGTGAGGGG - Intronic
1129620267 15:77137548-77137570 CTGGATTTCGGACTTGTGTGGGG + Intronic
1130739038 15:86578272-86578294 CTGGATTTCAGACTTGCATGGGG + Intronic
1130824714 15:87532397-87532419 CTGGATTTCAGACTTGCATGGGG - Intergenic
1131410283 15:92201572-92201594 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1131743580 15:95420970-95420992 CTGGATTTCAGACTTGTGTGGGG - Intergenic
1131752559 15:95525712-95525734 CTGGATTTCAGCCTTGTGTGGGG - Intergenic
1131767853 15:95700249-95700271 CTGGATTTCAGACTTGCATGGGG - Intergenic
1133794245 16:9033392-9033414 TTGGATTTCAGACTTGCGTGGGG + Intergenic
1134660514 16:15980993-15981015 CTGGATTTCAGACTTGCATGGGG - Intronic
1135658765 16:24276057-24276079 CTATTTGTCAAACTTGTGTGAGG + Intronic
1136663178 16:31783464-31783486 CTGGATTTCAGACTTGCATGGGG - Intronic
1136680485 16:31958874-31958896 CTGGATTTCAGACTTGCATGGGG + Intergenic
1136780827 16:32900420-32900442 CTGGATTTCAGACTTGCATGGGG + Intergenic
1136889587 16:33959249-33959271 CTGGATTTCAGACTTGCATGGGG - Intergenic
1137638641 16:50009218-50009240 CTGGGTTTCAGACTTGCATGAGG + Intergenic
1137829584 16:51531262-51531284 CTTCTTTTCAAACTTTTGTGGGG - Intergenic
1138770042 16:59652412-59652434 CTGGGTTTCAGACTTGTGTGGGG - Intergenic
1138970108 16:62133606-62133628 TTGGGTTTCATACTTGTGTGAGG - Intergenic
1139030868 16:62878766-62878788 CTGAATTTCAGACTTGCATAGGG + Intergenic
1139113332 16:63919300-63919322 CTGGATTTCAGACTTGCATGGGG - Intergenic
1139133939 16:64178788-64178810 CTGGATTTCAGACTTGCGTGGGG + Intergenic
1203083479 16_KI270728v1_random:1164449-1164471 CTGGATTTCAGACTTGCATGGGG + Intergenic
1142582438 17:950438-950460 CTGGTTTTCAGGGGTGTGTGGGG + Intronic
1144122119 17:12165448-12165470 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1144187222 17:12808017-12808039 CTGGATTTCAGACTTGCATGAGG - Intronic
1144708500 17:17385295-17385317 ATGGTTTTCAGCCATGTGTGAGG - Intergenic
1147155616 17:38543256-38543278 CTGCTTTTCAGCCTTGTGTTTGG - Intronic
1148390451 17:47268518-47268540 CTGGATTTCAGACTTGCGTGGGG - Intronic
1148640831 17:49185910-49185932 CTGAATTTCGGACTTGCATGGGG + Intergenic
1148762513 17:50014263-50014285 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1149025165 17:52018488-52018510 CTGTGTTTCAGACTTGCATGGGG + Intronic
1149079177 17:52633090-52633112 CTGAATTTCAGACTTTCATGGGG + Intergenic
1149234023 17:54570027-54570049 CTGGATTTCAGACTTGCATGGGG - Intergenic
1149260788 17:54877539-54877561 CTGGATTTCAGACTTGCATGGGG + Intergenic
1149308726 17:55373715-55373737 CTGGATTTCAGACTTGCATGAGG + Intergenic
1149978873 17:61293379-61293401 ATGATTTTCAAACTGGGGTGAGG - Intronic
1150622555 17:66819046-66819068 CTGTGTTTCAGACTTGTGTGGGG + Intergenic
1150978773 17:70119070-70119092 CTAAGTTTTAAACTTGTGTGGGG - Intronic
1150995304 17:70310414-70310436 CTGAATTTCACATTTGTGTTCGG + Intergenic
1151631733 17:75315709-75315731 CTCACCTTCAGACTTGAGTGTGG - Intergenic
1153245756 18:3071667-3071689 CTGATTTTTAACCTTGTGTTTGG + Intronic
1153846149 18:9051453-9051475 CTGGATTTCAGACTTGCATGGGG + Intergenic
1154049843 18:10943465-10943487 CTGGATTTCAGACTTGCATGGGG + Intronic
1154312685 18:13279607-13279629 CTGATTTTCCCCCTTATGTGGGG + Intronic
1154372166 18:13774260-13774282 CTTGGTTTCAGACTTGTGTGGGG - Intergenic
1155108088 18:22687436-22687458 CTGGGTTTCAGACTTGCGTGGGG - Intergenic
1155772714 18:29722822-29722844 CTGGATTTCAGACTTGCATGGGG - Intergenic
1155793098 18:29998199-29998221 CTGGATTTCAAACTTGTGTGGGG + Intergenic
1155795863 18:30035635-30035657 CTGGATTTCAGACTTGCATGGGG + Intergenic
1156122609 18:33863525-33863547 CTGGGTTTCAGACTTGTATGGGG - Intronic
1156191516 18:34726562-34726584 CTGGGTTTCAGACTTGCATGGGG - Intronic
1156467640 18:37357845-37357867 CTGGATTTCGGACTTGTGTGGGG + Intronic
1156522838 18:37736194-37736216 CTGGTCCTCAGACATGTGTGAGG + Intergenic
1156694427 18:39749470-39749492 CTGGGTTTCAGATTTGTGTGTGG + Intergenic
1156702241 18:39839870-39839892 CTGATTTTCAGGATAGTGTGAGG + Intergenic
1156910711 18:42408564-42408586 CTGGGTTTCAGGCTTGTGTGGGG - Intergenic
1157071271 18:44411649-44411671 CTTAATTTCAGACTTGTTTTAGG - Intergenic
1157548218 18:48562840-48562862 CTGGTTTTCATATTTGTGTGGGG - Intronic
1157941184 18:51930486-51930508 CTGGATTTCAGACTTGCATGGGG + Intergenic
1158374543 18:56848235-56848257 CTGGGTTTCAGACTTGCATGGGG + Intronic
1158773160 18:60546408-60546430 CTCATTTTCAGTCTGGCGTGTGG + Intergenic
1158904706 18:62000889-62000911 CTGGGTTTCAGACTTGTTTGAGG - Intergenic
1159067986 18:63590724-63590746 CTGAATTTCAGCTTTGTGTAAGG + Intronic
1159196524 18:65122875-65122897 CTGGATTTCAGACTTGCATGGGG + Intergenic
1159204633 18:65233539-65233561 CTGGATTTCAGACTTGCATGGGG + Intergenic
1159289960 18:66404316-66404338 GGGATTTGCAAACTTGTGTGAGG + Intergenic
1159508121 18:69361490-69361512 CTGGATTTCAGACTTGCATGGGG + Intergenic
1159650326 18:70970746-70970768 CTGGATTTCAGACTTGCATGGGG - Intergenic
1159759616 18:72408353-72408375 CTGAGTTTCAAACATGTATGGGG + Intergenic
1159760570 18:72420399-72420421 TTGGATTTCAGACTTGTGTGGGG + Intergenic
1159761231 18:72429606-72429628 CTGGATTTCAGACTTGCATGGGG - Intergenic
1159805773 18:72957089-72957111 CTGGATTTCAGACTTGCCTGGGG - Intergenic
1160122694 18:76144996-76145018 CTGAGATGCAGGCTTGTGTGCGG + Intergenic
1160244155 18:77143834-77143856 CTGGATTTTAGACTTGTGTGGGG + Intergenic
1163087391 19:14992130-14992152 CTGCTTTTCAGGCTCCTGTGTGG + Intronic
1163404895 19:17116116-17116138 CTGATGTTCAGCCCTGTGAGGGG - Intronic
1165977646 19:39691378-39691400 CTTAGTTCCAGACCTGTGTGAGG - Intergenic
1166438528 19:42789957-42789979 CTGATGGTCAGACCTGTGTGGGG + Intronic
1166467419 19:43044609-43044631 CTGATGGTCAGACCTGTGTGGGG + Intronic
1166473553 19:43100690-43100712 CTGATGGTCAGACCTGTGTGGGG + Intronic
1166487492 19:43225799-43225821 CTGATGGTCAGACCTGTGTGGGG + Intronic
1166494338 19:43287688-43287710 ATGATGGTCAGACCTGTGTGGGG + Intergenic
1166638056 19:44469409-44469431 CTGGATTTCAGACTTGCATGGGG - Intergenic
1167306921 19:48714830-48714852 CTGAAGTTCCAACTTGTGTGGGG + Exonic
1168362995 19:55758656-55758678 ATGATTTTGAGAGTTGAGTGTGG + Intergenic
1168363950 19:55768656-55768678 ATGATTTTGAGAGTTGAGTGTGG + Intergenic
1168443861 19:56395021-56395043 TTGAATTTCACACTTGTGAGCGG + Intergenic
1168702514 19:58449666-58449688 CTGCATTTCAGACTTTCGTGGGG + Intergenic
924971125 2:127899-127921 CTGATTGACAGACTTTTCTGAGG + Intergenic
925114588 2:1367700-1367722 CTGAGCCACAGACTTGTGTGGGG - Intergenic
925292002 2:2754270-2754292 CTGGATTTCAGACTTGCATGGGG + Intergenic
925455992 2:4017142-4017164 CTGGATTTCAGACTTGCATGGGG - Intergenic
925816960 2:7763247-7763269 CTGGATTTCAGACTTGCATGGGG - Intergenic
926484508 2:13438061-13438083 CTGGATTTCAGACTTGTATGGGG - Intergenic
926563611 2:14445190-14445212 TTGGGTTTCAGACTTGTGTGAGG - Intergenic
926768836 2:16350084-16350106 CTGATTATCAGAGATGTCTGAGG - Intergenic
926930550 2:18035119-18035141 CTGATTTTCAGAATTATGATTGG + Intronic
927007679 2:18866933-18866955 CTGTATTTCAGACTTTTATGGGG + Intergenic
927030509 2:19116484-19116506 CTGGATTTCAGACTTGCTTGAGG - Intergenic
927033689 2:19150268-19150290 CTGGGTTTCGGACTTGTGTGGGG - Intergenic
927380806 2:22477060-22477082 CTGGATTTCAAACTTGTGTAGGG + Intergenic
927381202 2:22481010-22481032 TTGATTTTCAGACCTGTCTTAGG - Intergenic
928709361 2:33987226-33987248 CTGAGTTTCAGACTTGTGTGGGG - Intergenic
928812607 2:35247701-35247723 CTGGATTTCAGACTTGCATGGGG - Intergenic
928897359 2:36280892-36280914 CTGGATTTCAGACTTGTATGGGG - Intergenic
929020255 2:37546246-37546268 CTGGATTTCAGACTTGCATGGGG - Intergenic
930230202 2:48835449-48835471 TTGGATTTCAGACTTGTGTGGGG + Intergenic
930310298 2:49731826-49731848 CTGAATTTCAGACTTGGATGGGG - Intergenic
930359024 2:50355210-50355232 CTGAATTTCTGAATTGGGTGGGG - Intronic
930419744 2:51135471-51135493 TTGAATTTCAGACTTGCATGGGG + Intergenic
930469366 2:51793375-51793397 CTGGTTTTCAAATATGTGTGAGG - Intergenic
930484907 2:51999296-51999318 CTGGATTTCAGACTTGCATGGGG + Intergenic
931079514 2:58753321-58753343 CTAGATTTCAGACTTGCGTGGGG + Intergenic
931154626 2:59614511-59614533 CTGGATTTCAGACTTGCATGGGG - Intergenic
931272208 2:60712984-60713006 CTGGATTTCAGACTTGCATGGGG + Intergenic
931490720 2:62743642-62743664 CTGATTATGACACATGTGTGAGG - Intronic
932659426 2:73639555-73639577 CTGGGTTTCAGACATGTGTGGGG + Intergenic
932665990 2:73699226-73699248 CTGGGTTTCAGACATGTGTGGGG + Intergenic
933065100 2:77782230-77782252 CTGGATTTCAGACTTGCATGGGG + Intergenic
933085189 2:78046547-78046569 CTGGATTTCAGACTTGTGTGGGG + Intergenic
933209669 2:79552232-79552254 CTGGATTTCAGACTTGCATGGGG - Intronic
933268065 2:80203463-80203485 CTGGATTTCAGACTTGCATGGGG - Intronic
933578035 2:84092386-84092408 CTGGATTTCAGACTTGCATGAGG - Intergenic
934144234 2:89075750-89075772 CTGGATTTCAGACTTGTCTGGGG + Intergenic
934225008 2:90124798-90124820 CTGGATTTCAGACTTGTCTGGGG - Intergenic
936225775 2:110649323-110649345 CTGATTTTCAAACTTTTATCTGG - Exonic
936694280 2:114928383-114928405 CTGATTTTCAGACTTGTGTGGGG - Intronic
936721231 2:115254730-115254752 TTGAATTTCAGACTTGCGTGGGG - Intronic
936728870 2:115357362-115357384 TTGAATTTCGGACTTGTATGGGG - Intronic
937380826 2:121374732-121374754 CTGGGTTTCAGACTTGCATGGGG + Intronic
937462715 2:122103268-122103290 CTGGGTTTCAGACTTGAGTGAGG - Intergenic
937806424 2:126150799-126150821 TTGAATTTCAGACTTATATGGGG - Intergenic
938222284 2:129580727-129580749 CTGGGTTTCAGACTTGTGTAGGG - Intergenic
939431038 2:142108108-142108130 TTGATTTTCAGAAATGTGTTAGG - Intronic
939842460 2:147205830-147205852 CTGGATTTCAGACTTGTATGGGG - Intergenic
940135998 2:150436321-150436343 CTGGATTTCAGACTTGCATGGGG + Intergenic
940381274 2:153017752-153017774 CTGGATTTCAGATTTGTGTGGGG - Intergenic
940430808 2:153587979-153588001 CTGGATTTCAGACTTGCATGGGG - Intergenic
940450295 2:153827954-153827976 TTGGATTTCAGACTTGCGTGGGG - Intergenic
940502028 2:154504927-154504949 CTGGATTTCAGACTTGCCTGGGG + Intergenic
940621804 2:156122149-156122171 CTGGATTTCAGACTTGTATGAGG + Intergenic
940783551 2:157958792-157958814 CTGGGTTTCAGACTTGGATGGGG - Intronic
940785908 2:157980825-157980847 CTGGATTTCAGACTTGCATGGGG + Intronic
940814911 2:158287530-158287552 CTGGATTTTGGACTTGTGTGGGG - Intronic
940825690 2:158409467-158409489 CTGGATTTCAGACTTGCATGGGG + Intronic
941319824 2:164041005-164041027 CTGGATTTCAGACTTGCATGGGG - Intergenic
941349405 2:164413883-164413905 CTGAATTTCAGACTTGCATGGGG - Intergenic
941431790 2:165422592-165422614 CTGGGTTTCAGACTTGCATGGGG - Intergenic
941544371 2:166829625-166829647 CTCATTGTCAGAATTTTGTGAGG - Intergenic
941701248 2:168606252-168606274 CTGGGTTTCAGACTTGTATAGGG + Intronic
942123693 2:172802870-172802892 CTGGATTTCAGACTTGCATGGGG - Intronic
942203175 2:173592649-173592671 CTGGATTTCAGACTTGCATGGGG - Intergenic
942601426 2:177644405-177644427 CTGGATTTCAGACTTGCATGGGG + Intronic
942643555 2:178086778-178086800 CTGATTTTCCTACTTTTATGTGG - Intronic
942649722 2:178154255-178154277 CTGGGTTTCAGACTTGCATGGGG - Intergenic
942825376 2:180169301-180169323 CTGGTTTTCAGAATTGCATGGGG - Intergenic
943288783 2:186042201-186042223 CTGGGTTTCAGATTTGTTTGGGG - Intergenic
943315723 2:186385607-186385629 CTGGGTTTCAGACTTGCATGTGG - Intergenic
943481765 2:188428095-188428117 CTGGGTTTCAGACTTGTGTGAGG + Intronic
943543285 2:189243904-189243926 TTGGATTTCAGACTTGTGTAGGG - Intergenic
943557916 2:189427865-189427887 CTGAGTTTCAGACTTGCATGGGG + Intergenic
943609396 2:190014841-190014863 CTGGATTTCAGACTTGCATGGGG - Intronic
943879982 2:193131157-193131179 CTGGATTTCAGACATGTATGGGG - Intergenic
944921096 2:204413604-204413626 CTGGATTTCAGACTTGCATGGGG + Intergenic
945360200 2:208887164-208887186 CTGGATTTCAGACTTGCATGAGG + Intergenic
945623489 2:212171205-212171227 CTGGATTTCAGACTTGCATGGGG + Intronic
946760512 2:222988982-222989004 CTGGATTTCAGACTTGCATGGGG - Intergenic
946854272 2:223937515-223937537 CTGCTTTACAGAGTTTTGTGAGG - Intronic
947248635 2:228077526-228077548 CTGGATTTCAGACTTGCATGGGG + Intronic
947296362 2:228635270-228635292 CTGGATTTCAGACTTGCTTGGGG - Intergenic
947328167 2:229000153-229000175 CTGGGTTTCAGACTTGCATGGGG + Intronic
947345543 2:229186077-229186099 CTGGATTTCAGACTTGCATGGGG - Intronic
948104312 2:235400737-235400759 CTGGGTTTCAGACTTGCATGGGG + Intergenic
948221092 2:236270244-236270266 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169164972 20:3415298-3415320 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1169583875 20:7058583-7058605 CTGGTTTTCAGACTTGTGTGGGG - Intergenic
1169609750 20:7365214-7365236 CTGGATTTCAGACTTGCATGAGG + Intergenic
1170037593 20:12005171-12005193 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1170439482 20:16364227-16364249 CTGTTTTACAGACTTGTGGTTGG - Intronic
1170475091 20:16706559-16706581 CTGGATTTCAGACTTGCATGGGG + Intergenic
1170482034 20:16775385-16775407 CTGGGTTTCACACTTGTGTGTGG + Intergenic
1170499552 20:16960828-16960850 CTGGATTTCAGACTTGCATGGGG - Intergenic
1171001809 20:21422875-21422897 CTGGGTTTCAGACTTGGATGGGG - Intergenic
1171020194 20:21577794-21577816 GTGATTTTCACATTTTTGTGGGG - Intergenic
1171072957 20:22092830-22092852 CAGATTTTCAGGCTTGAGGGTGG + Intergenic
1171118642 20:22549138-22549160 CTGAATTTCAGACTTGCATGGGG - Intergenic
1171490745 20:25515287-25515309 CTGGGTTTCAGACTTGCATGGGG + Intronic
1171571552 20:26256013-26256035 CTGGATTTCAGACTTGCATGGGG + Intergenic
1172307793 20:33893895-33893917 CTGTTGCTAAGACTTGTGTGGGG - Intergenic
1172323742 20:34018282-34018304 CTTATTTCTAGACTTCTGTGGGG + Intronic
1172720324 20:36995020-36995042 CTCAATTTCAGACTTGCATGGGG + Intergenic
1172893108 20:38281073-38281095 TTGGATTTCAGACTTGTATGGGG - Intronic
1173314771 20:41933114-41933136 CTGGGTTTTGGACTTGTGTGGGG + Intergenic
1173941051 20:46911709-46911731 CTCATGTTCCCACTTGTGTGTGG + Intronic
1176690561 21:9903561-9903583 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1176925547 21:14745070-14745092 CTGGGTTTCAGACTTGTGTGGGG - Intergenic
1177085173 21:16694635-16694657 CTGGGTTTCAGACTTGTGTGGGG - Intergenic
1177188569 21:17824476-17824498 CTGGATTTCAGACTTGCATGGGG - Intergenic
1177267091 21:18798927-18798949 CTGGATTTCAGACTTGCGTGGGG + Intergenic
1177312363 21:19413645-19413667 CTGGATTTCAGACTTGCATGGGG + Intergenic
1177334729 21:19708224-19708246 CTGGATTTCAGACTTGCATGGGG + Intergenic
1177367141 21:20153185-20153207 CTGAGTTTCAGACTTGCATAAGG - Intergenic
1177393120 21:20501871-20501893 CTGGATTTCAGACTTGCATGGGG - Intergenic
1177522161 21:22239602-22239624 CTGGATTTCAGACTTGCCTGGGG + Intergenic
1177632518 21:23746081-23746103 CTGGATTTCAGACTTGTATGGGG - Intergenic
1177722754 21:24928561-24928583 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1177773561 21:25544108-25544130 CTGGGTTTAGGACTTGTGTGGGG - Intergenic
1177881203 21:26696948-26696970 CTCATGGTCAGACTTGCGTGGGG - Intergenic
1177965365 21:27720084-27720106 CTGGGTTTCAGAAATGTGTGGGG + Intergenic
1178052116 21:28759310-28759332 CTGGATTTCAGACTTGCATGGGG + Intergenic
1178805714 21:35837450-35837472 CTGGATTTCAGACTTGCATGGGG + Intronic
1178827535 21:36029291-36029313 CTGGTTTTCAGAGGTGTGGGAGG - Intergenic
1180573737 22:16753030-16753052 CTGGATTTCAGACTTGCATGGGG + Intergenic
1182182432 22:28363791-28363813 CTGGATTTCAGACTTGTATGGGG + Intronic
1182431142 22:30299540-30299562 TTGATTTTCAGATTCGTCTGCGG - Exonic
1182816889 22:33172117-33172139 CTGGGTTTCAGACTTGCATGGGG + Intronic
1182866840 22:33611439-33611461 CTGGGTTGCAGACTTGTGTGGGG + Intronic
1182928970 22:34154826-34154848 CTGAACTCCAGACTTGTGTATGG - Intergenic
1182999661 22:34844568-34844590 CTGGATTTCAGACTTGCATGGGG + Intergenic
1183473927 22:38025568-38025590 CTCATTTCCAGACTTCTCTGGGG + Intronic
1183847604 22:40554967-40554989 CTGGGTTTCAGACTTGCATGGGG + Intronic
1184188280 22:42878762-42878784 CTGAGCTTCAGACCTGAGTGGGG - Intronic
1184312012 22:43651828-43651850 CTGGATTTCAGACTTGCATGGGG + Intronic
950178960 3:10897501-10897523 CTGGATTTCAGACTTGCATGAGG - Intronic
950326047 3:12110762-12110784 CTGTATTTCAGACTTGCATGGGG + Intronic
950503612 3:13379435-13379457 CTGATTTTCAGACCGTTGAGGGG + Intronic
950828045 3:15846296-15846318 CTGGGTTTCAGACTTGCATGGGG - Intronic
950974183 3:17223333-17223355 CTAATTTTCTGACTTTTTTGCGG - Intronic
951241133 3:20287554-20287576 CTGGGTTTCAGACTTGCTTGAGG - Intergenic
951805560 3:26640307-26640329 CTGATTTGCAGACTTGGGGCAGG - Intronic
951931017 3:27967241-27967263 TTATTTTTCACACTTGTGTGTGG - Intergenic
952066084 3:29572813-29572835 CTATTTTTCAGAATTGTTTGAGG + Intronic
952111158 3:30125058-30125080 CTGGGTTTCAGACTTGCATGGGG - Intergenic
952221313 3:31326902-31326924 CTGGGTTTCGGACTTGAGTGGGG - Intergenic
952543690 3:34395893-34395915 CTGTTTTTCGGGCTTGTGTGTGG + Intergenic
953191547 3:40692059-40692081 CTGACCTTCACACTTATGTGGGG - Intergenic
953202245 3:40787831-40787853 CTGAGTTTCGGACTTGTATGGGG + Intergenic
953535546 3:43774322-43774344 CTGAGTCTCAGAGTGGTGTGTGG + Intergenic
954517010 3:51187271-51187293 CTGGATTTCAGACTTGCATGGGG + Intronic
956150466 3:66236743-66236765 GGGATTTTCAGAATGGTGTGTGG + Intronic
956558737 3:70550643-70550665 CTGGATTTCAGACTTGCGTGGGG - Intergenic
956563933 3:70614799-70614821 CTGGGTTTCAGACTTGTGTGGGG - Intergenic
956855758 3:73273314-73273336 TTGATTTTAAGTCTTCTGTGCGG + Intergenic
956938512 3:74131451-74131473 CTGGATTTCAGACTTGCATGGGG - Intergenic
957300540 3:78387308-78387330 CTGGATTTCAGACTTGCATGGGG - Intergenic
957477052 3:80739011-80739033 CTGGATTTCAGACTTGCATGGGG - Intergenic
957495183 3:80982802-80982824 CTGTGTTTCAGACTTGCATGGGG + Intergenic
957501502 3:81064283-81064305 CTGATTTTCAAACTTTACTGTGG - Intergenic
958117578 3:89241281-89241303 CTGATTTACTGATTGGTGTGTGG - Intronic
958445576 3:94210736-94210758 CTGAATTTGGGACTTGTGTGGGG + Intergenic
958553235 3:95643097-95643119 CTGGATTTCAGACTTGCATGGGG - Intergenic
958638983 3:96780244-96780266 CTGGATTTCAGACTTGCATGGGG + Intergenic
958831842 3:99099204-99099226 CTGGATTTCAGACTTGCATGGGG + Intergenic
958836933 3:99157078-99157100 CTGGGTTTCAGACTTGTGTGGGG + Intergenic
958893373 3:99804709-99804731 CTGAGTTTCAGACTTGCATGGGG - Intergenic
959171290 3:102847587-102847609 CTGGATTTTGGACTTGTGTGGGG - Intergenic
959283713 3:104380137-104380159 CTGGGTTTCAGACTTGTGTGGGG + Intergenic
959303405 3:104630723-104630745 CTGGGTTTCAGACTTGCATGTGG - Intergenic
959305968 3:104666361-104666383 CTGGATTTCAGACTTGCATGGGG + Intergenic
959390183 3:105763061-105763083 CTGGATTTCGGACTTGTGTGGGG + Intronic
959508135 3:107177694-107177716 CTGGGTTTCAGACTTGCATGGGG - Intergenic
959719434 3:109470279-109470301 CTGGATTTCAGACTTGCGTGGGG + Intergenic
959729934 3:109590180-109590202 CTGGATTTCAGACTTGCATGGGG - Intergenic
959804364 3:110533274-110533296 CTGGATTGCAGACTTGTGTGGGG + Intergenic
959808783 3:110592185-110592207 CTGAGTTTCAGACTTGTTTGGGG - Intergenic
959862345 3:111230107-111230129 CTGAGTTTCACACTTGCATGGGG + Intronic
959874006 3:111360525-111360547 CTGGTTTTCAGACTGGCATGGGG + Intronic
959900956 3:111661612-111661634 CTGGTGTTCAGACTTGCATGGGG - Intronic
960256435 3:115516210-115516232 CTGGGTTTCAGACTTGCATGGGG - Intergenic
960837996 3:121926952-121926974 CTGTGTTTCAGACTTGCCTGGGG + Intronic
960843016 3:121979111-121979133 CTGGATTTCAGACTTGCATGGGG + Intergenic
961254254 3:125533566-125533588 TTGATTTTCAGAAATGTGTTAGG - Intronic
961406805 3:126685360-126685382 CTGAGTTTCAGACTTGTGTGGGG + Intergenic
962576991 3:136763810-136763832 CTGGATTTCAGACTTGCATGGGG + Intergenic
963471534 3:145747987-145748009 CTGATTTTTAAACTTGCATGGGG - Intergenic
963539407 3:146566663-146566685 CTGGATTTCAGATTTGTGTGGGG - Intergenic
963824080 3:149932590-149932612 CTAGGTTTCAGACTTGTGTGGGG - Intronic
964088603 3:152847347-152847369 CTGGATTTCAGACTTGTATGGGG + Intergenic
964275567 3:155005232-155005254 CTGGATTTCAGACTTGAATGGGG + Intergenic
964562180 3:158010082-158010104 CTGGATTTCAGACTTGCATGGGG - Intergenic
964638790 3:158886130-158886152 CTGGGTTTCAGACTGGTGTGGGG + Intergenic
964719297 3:159755828-159755850 CTGGATTTCAGACTTGAATGGGG - Intronic
964793069 3:160470985-160471007 CTGGATTTCAGACTTGCATGAGG + Intronic
964926485 3:161964089-161964111 CTGGATTTCAGACTTGGATGGGG + Intergenic
965013274 3:163124920-163124942 CTGGATTTCAGACTTGCATGGGG - Intergenic
965232400 3:166071116-166071138 TTGGGTTTCAGACTTGTTTGGGG - Intergenic
965233903 3:166090771-166090793 CTGGATTTCAGACTTGCATGGGG - Intergenic
965264964 3:166531534-166531556 TTGAATTTCAGACTTGCATGAGG - Intergenic
965395110 3:168153244-168153266 CTGGGTTTCAGACTTGCATGGGG + Intergenic
965809829 3:172579785-172579807 CTGGATTTCAGACTTGCATGGGG + Intergenic
966031268 3:175350707-175350729 CTCACTTTAAGACATGTGTGTGG + Intronic
966035646 3:175411390-175411412 CTGATTTTCAGAGAAGAGTGCGG + Intronic
966325182 3:178745770-178745792 CTGGATTTCAGACTTGCATGGGG - Intronic
966518942 3:180851747-180851769 ATGATTTTCAGTCTTGTATGAGG - Intronic
966760936 3:183418642-183418664 TTGGATTTCAGACTTGTGTGAGG - Intronic
967048080 3:185755707-185755729 CTGGGTTTCAGACTTGCATGGGG + Intronic
967260153 3:187634134-187634156 CTGAGTTTTGGACTTGTGTGGGG - Intergenic
967505191 3:190245688-190245710 CTGGATTTCAGACTTGCATGAGG - Intergenic
967559988 3:190906141-190906163 CTGGATTTCAGACTTGCATGAGG + Intergenic
967564723 3:190959958-190959980 CTGAATTTCAGACTTGCGTGGGG + Intergenic
967565109 3:190963147-190963169 CTGGATTTCAGACTTGCATGGGG + Intergenic
967577276 3:191108328-191108350 CTAATTTTCACACTTGCATGGGG + Intergenic
967586717 3:191222410-191222432 CTGGATTTCAGACTTGCATGGGG + Intronic
968014794 3:195319592-195319614 CTGGGTTTCGAACTTGTGTGGGG + Intronic
968354497 3:198093796-198093818 CTGGATTTCAGACTTGCATGAGG - Intergenic
969103688 4:4789145-4789167 CTGAGTTTCTGACTTGCATGGGG + Intergenic
969198502 4:5582412-5582434 CTGCATTTCAGACTTGCCTGGGG + Intronic
970036254 4:11738791-11738813 CTGAGTTTCAGACTTGCACGGGG + Intergenic
970046365 4:11859153-11859175 CTGGATTTCAGACTTGCATGGGG + Intergenic
970142015 4:12993514-12993536 CTGGATTTCAGACTTGTATGGGG - Intergenic
970157154 4:13153055-13153077 CTGTATTTCAGACTTGCGTGGGG - Intergenic
970307896 4:14752161-14752183 CTGGATTTCAGACTTGCATGGGG - Intergenic
970462092 4:16284674-16284696 CTGAATTTCTGACTTGCATGGGG + Intergenic
970750369 4:19352685-19352707 CTGGATTTCAGACTTGCATGGGG - Intergenic
970863696 4:20734872-20734894 CTAGTTTTCAGACTTCTCTGTGG + Intronic
971545395 4:27879603-27879625 CTGGGTTTCAGACTTGCATGGGG - Intergenic
971621622 4:28861354-28861376 CTGAATTAGAGACTTGTGTTTGG + Intergenic
971744915 4:30566876-30566898 TTGGATTTCGGACTTGTGTGGGG + Intergenic
971753394 4:30678802-30678824 CTGGATTTCAGACTTGCATGAGG + Intergenic
971948750 4:33315795-33315817 CTGGATTTCAGACTTGTATGGGG + Intergenic
972057776 4:34826299-34826321 CTGGATTTCAGACTTGCATGGGG - Intergenic
972061768 4:34883176-34883198 CTGGGTTTCAGACTTGCATGAGG - Intergenic
972087894 4:35242319-35242341 CTGGATTTCAGACTTGCATGGGG + Intergenic
972094618 4:35333812-35333834 CTGGATTTCAGACTTGCATGGGG - Intergenic
972096180 4:35349889-35349911 ATGAGTTTCAGAATTGTATGGGG - Intergenic
972220543 4:36949787-36949809 CTGAATTTCAGAATTGCATGGGG - Intergenic
972251218 4:37304627-37304649 CTGGGTTTCAGACTTGCATGAGG - Intronic
972370471 4:38418994-38419016 CTGGATTTCAGACTTGCATGGGG - Intergenic
972467588 4:39371771-39371793 CTGGATTTCAGACTTGCATGGGG + Intergenic
972582511 4:40407164-40407186 CTGGATTTCAGACTTGCATGGGG + Intergenic
972748936 4:41969378-41969400 CTGGATTTCAGACTTGCATGGGG + Intergenic
972880497 4:43417009-43417031 CTGGATTTCAGACTTGCATGGGG - Intergenic
972894482 4:43602653-43602675 CTGGATTTCAGACTTGCATGGGG + Intergenic
972895938 4:43620116-43620138 CTGGATTTCAGACTTATATGGGG - Intergenic
972911431 4:43822179-43822201 CTGAGTTTTGGATTTGTGTGGGG - Intergenic
972945840 4:44254404-44254426 CTGATTCTCAGGCTTGTAGGAGG + Intronic
972988893 4:44799187-44799209 CTGGGTTTCAGACTTGCATGGGG + Intergenic
973213101 4:47638102-47638124 CTGGATTTCAGACTTGCATGGGG + Intronic
973552242 4:52047725-52047747 CTGGATTTCAGACTTGCATGGGG - Intergenic
973665259 4:53152855-53152877 CTGGGTTTTAGACTTGTGTAGGG - Intronic
974013111 4:56625159-56625181 CTGGGTTTCAGACTTATATGGGG + Intergenic
974248956 4:59360291-59360313 CTGGGTTTCGGACTTGTATGGGG + Intergenic
974269542 4:59633008-59633030 CTGGATTTCAGACTTGCATGGGG - Intergenic
974540395 4:63225993-63226015 CTTGGTTTCAGACTTGTGTGGGG + Intergenic
974577861 4:63751437-63751459 CTGATTTTCAGGATAGTGTGTGG + Intergenic
974620959 4:64353889-64353911 CTCATTTTCAGACTTCTTTGAGG - Intronic
974897672 4:67958466-67958488 ATGGATTTCAGACTTGTATGGGG + Intronic
974925378 4:68291926-68291948 CTGGATTTCAGACTTGCATGGGG - Intergenic
974969668 4:68808076-68808098 CTGGATTTCAGACTTGCGTGGGG + Intergenic
975506450 4:75143967-75143989 CTGGGTTTCAGACTTGTATGGGG - Intergenic
975516995 4:75258671-75258693 CTGTGTTTCAGTTTTGTGTGAGG - Intergenic
975522013 4:75311354-75311376 CTGGGTTTCAGACTTCTGTGGGG + Intergenic
975804234 4:78096138-78096160 CTGAATTTCAGAATTGTATGGGG - Intronic
976000697 4:80370612-80370634 CTGGGTTTCAGACTTGCCTGGGG - Intronic
976075875 4:81298493-81298515 TTGAATTTCAGACTTGCATGGGG + Intergenic
976678198 4:87726100-87726122 CTGGATTTCAGACTTGCATGGGG + Intergenic
976853494 4:89576273-89576295 CTGGGTTTCAGACTTGCATGGGG + Intergenic
976875531 4:89849907-89849929 CTGGATTTCAGACTTGCATGGGG - Intergenic
976881564 4:89932157-89932179 CTGGATTTCGGACTTGCGTGAGG - Intronic
977014738 4:91678403-91678425 CTGGATTTCAGACTTGCATGAGG + Intergenic
977015908 4:91693252-91693274 CTGGATTTCAGACTTGCATGGGG - Intergenic
977075711 4:92446481-92446503 CTGCTTTGCAGACTTCTGTGTGG + Intronic
977378392 4:96237872-96237894 CTGGGTTTCAGACTTGCATGAGG + Intergenic
977395689 4:96468351-96468373 CTGGATTTCAGACTTGCATGGGG - Intergenic
977503871 4:97878014-97878036 CTGAATTTCAGACTTGCATGGGG - Intronic
977722065 4:100250748-100250770 CTGGGTTTCAGACTTGTATGGGG - Intergenic
978044303 4:104107278-104107300 CTGGGTTTCAGACTTGCATGGGG + Intergenic
978696262 4:111584068-111584090 CTGAGTTTCAGACTTGCATGGGG - Intergenic
978749948 4:112234901-112234923 CTGATTTTCAGATTTCTCAGGGG - Intronic
978949272 4:114537965-114537987 CTAGGTTTCAGACTTGTATGGGG - Intergenic
979079086 4:116311796-116311818 CTGGGTTTCAGACTTGCATGGGG - Intergenic
979327797 4:119399739-119399761 CTGGATTTCAGACTTGCATGGGG - Intergenic
979341205 4:119526320-119526342 CTTATGATCAGGCTTGTGTGAGG - Intronic
979601449 4:122590599-122590621 CTGGGTTTTGGACTTGTGTGGGG - Intergenic
979721535 4:123905660-123905682 CTGGATTTCAGACTTGCATGGGG + Intergenic
979881458 4:125964279-125964301 CTGGGTTTTGGACTTGTGTGGGG + Intergenic
979896097 4:126158985-126159007 CTGATTTGAAGACTTTTATGTGG - Intergenic
979986820 4:127325566-127325588 CTAGGTTTCAGACTTGTGTGGGG + Intergenic
980090735 4:128440740-128440762 CTGGGTTTCAGACTTGTATGGGG - Intergenic
980120160 4:128719628-128719650 CTAATTTTGACAATTGTGTGAGG + Intergenic
980368681 4:131839179-131839201 CTGGATTTCAGACTTGCATGGGG + Intergenic
980379434 4:131992633-131992655 CTGCTTTTCAGTCAGGTGTGAGG - Intergenic
980383612 4:132058729-132058751 CTGGGTTTCAGACTTGCATGGGG + Intergenic
980458360 4:133073706-133073728 CTGGGTTTCAGGCTTGTGTGGGG + Intergenic
980602840 4:135047017-135047039 TTGATTTTCTGTTTTGTGTGTGG + Intergenic
980641487 4:135585855-135585877 CTGGTTTTCAGACTTGCCTGGGG + Intergenic
980765469 4:137297692-137297714 CTGAGTGTTAGACTTGTGAGTGG + Intergenic
980767024 4:137320654-137320676 CTGGATTTCAGACTTGCATGTGG - Intergenic
981061766 4:140432303-140432325 CTGGATTTCAGACTTGCATGGGG + Intergenic
981120919 4:141050584-141050606 CTGGATTTCAGACTTGCATGGGG - Intronic
981210205 4:142094446-142094468 CTGTTTTTCAGACTTCTGTGTGG - Intronic
981240196 4:142467409-142467431 CTGGGTTTCTGACTTGTGTGGGG + Intronic
981355535 4:143785202-143785224 CTGGATTTTAGACTTCTGTGGGG + Intergenic
981356800 4:143798763-143798785 CTGGGTTTGGGACTTGTGTGGGG - Intergenic
981407135 4:144385095-144385117 TTGAATTTCAGACTTGCATGAGG - Intergenic
981483289 4:145259582-145259604 CTGGGTTTCAGACTTGCATGGGG - Intergenic
981862978 4:149379527-149379549 CTGGATTTCAGACTTGCATGAGG + Intergenic
981872992 4:149508512-149508534 CTGGATTTCAGACTTGCATGGGG + Intergenic
982019738 4:151191093-151191115 CTGGATTTCAGACTTGCATGGGG + Intronic
982097095 4:151933226-151933248 TTGATTTTCAGACATGCCTGAGG - Intergenic
982188993 4:152834530-152834552 CTGGGTTTCAGATTTGTGTGGGG - Intronic
982279218 4:153666517-153666539 CTGGATTTCAGACTTGTAAGGGG + Intergenic
982299959 4:153868203-153868225 CTGGATTTCAGACTTGCATGGGG + Intergenic
982390842 4:154862518-154862540 ATGGATTTCAGAGTTGTGTGGGG - Intergenic
982520929 4:156416253-156416275 CTGGGTTTCAGACTTGCATGGGG - Intergenic
982805328 4:159755620-159755642 CTGGGTTTCAGACTTGCATGGGG + Intergenic
982886450 4:160788392-160788414 CTGGATTTCAGACTTGCATGGGG + Intergenic
982911190 4:161144612-161144634 CCAGCTTTCAGACTTGTGTGGGG + Intergenic
982987700 4:162231919-162231941 CTGAATTTCAGACTTGTATAGGG - Intergenic
983088496 4:163475723-163475745 CTGATTTTAAGACTTGTTGCAGG + Intergenic
983236632 4:165187680-165187702 CTGGATTTTGGACTTGTGTGGGG - Intronic
983245548 4:165283460-165283482 CTGGATTTCAGACTTGCATGGGG - Intronic
983271597 4:165568510-165568532 CTGAGTTTCAGACTGCAGTGAGG + Intergenic
983430446 4:167643292-167643314 AAGATTTTCTGACTTATGTGGGG - Intergenic
983431716 4:167659456-167659478 CTGTATTTCAGACTTGCATGGGG - Intergenic
983460628 4:168022485-168022507 CTGGATTTCAGACTTGCCTGGGG - Intergenic
983660882 4:170129960-170129982 CTGTTTGTCAAACTTCTGTGGGG - Intergenic
983718562 4:170816623-170816645 CTGGATTTCAGACTTGCGTGGGG + Intergenic
983856412 4:172651724-172651746 ACGATTTTCAGCCTTGTCTGGGG - Intronic
984173575 4:176389484-176389506 CCCATTTTCAGACTTGTTTCAGG - Intergenic
984725913 4:183020607-183020629 CTGATTTTCAGAATTTTTTCTGG - Intergenic
985155905 4:186987116-186987138 CTGGATTTCGGACTTGTATGGGG - Intergenic
985160042 4:187034608-187034630 CTGGATTTCAGACTTGCGTGGGG + Intergenic
985373811 4:189313745-189313767 CTGAGTTGCAGACTCCTGTGAGG - Intergenic
985809640 5:2073532-2073554 CTGGGTTTCAGACTTGTATGGGG + Intergenic
986113854 5:4750180-4750202 CTGGATTTCAGACTTGCATGGGG - Intergenic
986250523 5:6053638-6053660 CTGGGTTTCAGACTTGCATGGGG + Intergenic
986281981 5:6330760-6330782 CTGGGTTTCAGACTTGCATGGGG + Intergenic
986360787 5:6975942-6975964 CTAGGTTTCAGACTTATGTGGGG + Intergenic
986837194 5:11651749-11651771 CTGGGTTTCAGACTTGCATGAGG + Intronic
987082317 5:14436708-14436730 CTGGATTTCAGACTTGCATGGGG - Intronic
987265956 5:16255442-16255464 CTGGGTTTCAGACTTGCATGGGG + Intergenic
987433625 5:17865831-17865853 CTGGATTTCAGACTTGCATGGGG + Intergenic
987464286 5:18253365-18253387 CTGGATTTTGGACTTGTGTGGGG + Intergenic
987493718 5:18616108-18616130 CTGAATTTGAGACTTGCATGGGG - Intergenic
987494803 5:18630004-18630026 CTGGGTTTCAGACTTGCATGGGG - Intergenic
987908058 5:24105128-24105150 CTGGGTTTCAGACTTGCTTGGGG - Intronic
987968859 5:24915520-24915542 CTGACTTTCATGTTTGTGTGAGG + Intergenic
988009676 5:25465530-25465552 CTGATTTTCAGACTTGCATGGGG + Intergenic
988014168 5:25530959-25530981 CTGGATTTCAGACTTGCTTGGGG + Intergenic
988061536 5:26176120-26176142 CTGGATTTCAGGCTTGTTTGTGG + Intergenic
988070685 5:26284815-26284837 CTGGATTTCAGACTTGCATGGGG - Intergenic
988099190 5:26656477-26656499 CTGAATTTTAGACTTGCATGGGG - Intergenic
988113623 5:26855144-26855166 CTGAGTTTTAGACTTGCATGGGG - Intergenic
988256301 5:28823787-28823809 CTGGGTTTCAGACTTGCATGGGG + Intergenic
988261147 5:28887256-28887278 CTGAGTGTCAGACTTGCATGAGG + Intergenic
988298883 5:29396315-29396337 CTCATTTACAGACTGCTGTGGGG - Intergenic
988386658 5:30574215-30574237 CTGGGTTTCAGACTCGTATGGGG + Intergenic
988519920 5:31936701-31936723 CCGATTTTCAGGCTTGACTGTGG + Intronic
988603029 5:32656896-32656918 CTGGATTTCAGACTTGCATGGGG - Intergenic
988647363 5:33108918-33108940 CTGAGTTTTAGACTTGCATGGGG + Intergenic
988666023 5:33328682-33328704 CTCATTTTCAGCCTTTTATGAGG - Intergenic
988925183 5:35982473-35982495 CTGGGTTTCAGACTTGCATGGGG + Intronic
990204170 5:53410893-53410915 CTGGATTTCAGACTTGTGCGGGG - Intergenic
990213647 5:53507654-53507676 CTGGGTTTCAGACTTGCATGTGG - Intergenic
990494614 5:56335041-56335063 CTGGGCTTCAGACTTGTATGGGG - Intergenic
990784965 5:59408792-59408814 TTGTGTTTCAGACTTGGGTGGGG + Intronic
990887621 5:60612586-60612608 CTGATTTTTATGCTTGTCTGAGG + Intronic
990939686 5:61189037-61189059 CTGGATTTCAGACTTGCATGGGG + Intergenic
991586820 5:68210480-68210502 GTGGATTTCAGACTTGCGTGGGG - Intergenic
991600748 5:68349277-68349299 CTGGGTTTCAGACTTGCATGAGG + Intergenic
992138166 5:73768508-73768530 CTGAATTTCAGACTTGCGTAGGG + Intronic
992448580 5:76855526-76855548 CTGGGTTTCAGACTTGTGTGGGG + Intronic
992817836 5:80462855-80462877 CTGGATTTCAGACTTGCATGGGG - Intronic
992854787 5:80849082-80849104 CTGAATTTCAGACTTGCATAGGG - Intronic
992969543 5:82042708-82042730 CTGGGTTTCAGACTTGCATGGGG - Intronic
993000875 5:82379491-82379513 CTGGATTTCAGACTTGCATGGGG - Intronic
993084528 5:83347941-83347963 CTGGTTTTCGGACTTGCATGGGG - Intronic
993156616 5:84232987-84233009 CTGATTTTATGACTTCTGAGAGG - Intronic
993208873 5:84921846-84921868 CTGGATTTCAGACTTGCATGAGG + Intergenic
993253069 5:85553262-85553284 CTGGGTTTCAGACTTGCATGGGG - Intergenic
993285575 5:85991580-85991602 CTGAATTTCAGACTTGTGTGGGG + Intergenic
993812621 5:92501154-92501176 CCAATTTTCATAATTGTGTGAGG + Intergenic
993820542 5:92609594-92609616 CTAATTCTCAGACTTGACTGTGG + Intergenic
993890222 5:93463763-93463785 CTGGATTTCAGACTTGCATGTGG + Intergenic
994234171 5:97342401-97342423 CTGGATTTCAGACTTGCTTGGGG - Intergenic
994325612 5:98442012-98442034 CTGGATTTCAGACTTGGATGGGG - Intergenic
994552857 5:101259186-101259208 CTGAATTTCAGACTTTCATGAGG + Intergenic
994570207 5:101505682-101505704 CCAACTTTCAGACTTGTGTGGGG + Intergenic
994621867 5:102172968-102172990 CTGGATTTCAGACTTGGATGGGG + Intergenic
994849415 5:105035561-105035583 CTGGATTTCAGACTTGCATGGGG - Intergenic
994878204 5:105451685-105451707 CTGGATTTCAGACTTGCATGGGG + Intergenic
994878825 5:105460535-105460557 CTGAATTTCAGACTTGCATGGGG - Intergenic
995132818 5:108648109-108648131 CTGAGTTTCAGACTTGCATGGGG + Intergenic
995147853 5:108806674-108806696 CTGGATTTCAGACTTGCATGGGG + Intronic
995287222 5:110403809-110403831 TTGATTTTCAGTTGTGTGTGGGG + Intronic
995456052 5:112353563-112353585 CCCATTTTCAGACCTGTGGGAGG + Intronic
995477659 5:112563997-112564019 CTGGGTTTCAGACTTGCATGGGG + Intergenic
995667116 5:114554834-114554856 CTGGATTTCAGACTTGCATGGGG - Intergenic
995702898 5:114955685-114955707 TTGAATTTTAGACTTGTATGGGG + Intergenic
995986867 5:118187245-118187267 CTGATTTTCAGACCAGTTTTAGG + Intergenic
996150086 5:120023927-120023949 CTGGATTTCAGACTTGCATGGGG + Intergenic
996159425 5:120144892-120144914 CTGGGTTTCAGACTTGCATGGGG - Intergenic
996177685 5:120379287-120379309 CTGGATTTCAGACTTGTAGGGGG + Intergenic
996232821 5:121087586-121087608 CTGGGTTTCAGACTTGCATGGGG - Intergenic
996255952 5:121403126-121403148 CTGGATTTCAGACTTGTATGGGG + Intergenic
996356335 5:122600101-122600123 CTGGATTTCAGACTTGCATGGGG - Intergenic
996623536 5:125540704-125540726 CTAATTTTCAAATTTGTGTGTGG + Intergenic
996636213 5:125692540-125692562 CTGGATTTCAGACTTGCATGGGG + Intergenic
996701146 5:126451427-126451449 CTGGGTTTCAGACCTGTGTGGGG + Intronic
996897722 5:128504567-128504589 CTGGATTTCAGACTTGCATGAGG + Intronic
997425074 5:133797602-133797624 CAGATTTTCAGATTTCTCTGGGG + Intergenic
997613521 5:135231265-135231287 CTGATTTTCAGACTCAAGTGTGG - Intronic
997698920 5:135882695-135882717 CTGGCTCTCAGACTTGTCTGTGG + Intronic
998380848 5:141724358-141724380 CTGGGTTTCAGACTTGCATGGGG - Intergenic
998487773 5:142517820-142517842 CTGGGTTTCAGACTTGCATGGGG + Intergenic
998633146 5:143923323-143923345 TTGATTTTCAACCTTGAGTGTGG + Intergenic
998873393 5:146575339-146575361 CTGGATTTCAGACTTGCATGGGG - Intergenic
998946010 5:147339764-147339786 CTGGATTTCAGACTTGCATGAGG + Intronic
999051771 5:148530930-148530952 CTGTATTTCAGACTTGCATGGGG + Intronic
999068490 5:148716990-148717012 CTGGATTTCAGACTTGCATGGGG + Intergenic
999177277 5:149640344-149640366 CTGCTGTTGAGACTTGTGTTTGG - Intergenic
999280699 5:150363502-150363524 CAGTTTTTGAGACATGTGTGAGG + Intronic
999755781 5:154663490-154663512 CTGGGTTTCAGACTTGTGTGGGG - Intergenic
999842964 5:155449162-155449184 CTGATTTTCAAACTTGCTTGGGG - Intergenic
1000430258 5:161143263-161143285 CTGGATTTCGGACTTGCGTGGGG + Intergenic
1000492099 5:161926423-161926445 CTGGATTTCAGACTTGCATGGGG + Intergenic
1000546643 5:162610871-162610893 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1000769495 5:165335074-165335096 ATGAGATTCAGACTTGTCTGGGG - Intergenic
1000784703 5:165529001-165529023 CTGAATTTCAGACTTCCATGGGG + Intergenic
1001795586 5:174499423-174499445 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1001836517 5:174837108-174837130 CTGGATTTCAGACTTGCATGGGG + Intergenic
1001944349 5:175766514-175766536 CTGGATTTCAGACTTGCATGGGG - Intergenic
1002002870 5:176207954-176207976 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1002223635 5:177703299-177703321 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1003237363 6:4307938-4307960 CTGATTTTCAGATTGATTTGGGG - Intergenic
1003245669 6:4379940-4379962 CTGACTTTCAGAGAAGTGTGGGG - Intergenic
1003259713 6:4506290-4506312 CTGAGTTTCAGACTTGCATAGGG - Intergenic
1003979616 6:11377494-11377516 CTAGGTTTCAGATTTGTGTGGGG + Intronic
1004217831 6:13718845-13718867 GTGATTTTCAGACTTGAATGTGG + Intergenic
1004316001 6:14588239-14588261 TTGGGTTTCAGACTTGTGTGGGG - Intergenic
1004430303 6:15536942-15536964 CTGGATTTCAGACTTGCTTGGGG + Intronic
1004624107 6:17358551-17358573 CTGAGTTTCAGACTTGCATGGGG + Intergenic
1005232761 6:23723327-23723349 CTGATTTTCAAACTTCTATCTGG + Intergenic
1005983072 6:30852196-30852218 CTGTATTTCAGACTTGTATGGGG + Intergenic
1006693332 6:35909309-35909331 CTGAATTTCAGACTTTAATGGGG + Intronic
1006754923 6:36407504-36407526 TTTATCTTGAGACTTGTGTGTGG - Intronic
1007202402 6:40121030-40121052 CTGATATTCTGACTAGTCTGTGG + Intergenic
1007742979 6:44024039-44024061 CTGCTTGTCAGCCTTGTCTGGGG - Intergenic
1007975198 6:46094525-46094547 CTGGTTTTCAGACTTGCATGGGG - Intergenic
1007984764 6:46196959-46196981 CTAAATTTCAGACTTGCATGGGG - Intergenic
1008033342 6:46720802-46720824 CTGATGTTCAGTCTTGGGTTTGG + Intronic
1008090788 6:47291746-47291768 GTGATTTTCAGACTTGTTTTAGG - Intronic
1008242312 6:49128050-49128072 CTGGATTTCAGACTTGCATGGGG + Intergenic
1008631379 6:53365777-53365799 CTGGGTTTCAGACTTGTATGGGG - Intergenic
1008676934 6:53829015-53829037 CAGGTTTTCAGAATAGTGTGTGG - Intronic
1008681381 6:53876646-53876668 CTGGATTTCAGACTTGTATGGGG - Intronic
1008848131 6:55993241-55993263 CTGGATTTCAGACTTGCATGGGG - Intergenic
1009058992 6:58374949-58374971 CTGGCTTTCAGACTTGCATGAGG - Intergenic
1009231849 6:61072174-61072196 CTGGCTTTCAGACTTGCATGAGG + Intergenic
1009594553 6:65717357-65717379 CTGGATTTCAGACTTGCATGGGG + Intergenic
1009726131 6:67537764-67537786 CTGGATTTCAGACTTGCATGGGG + Intergenic
1010268336 6:73892195-73892217 CTGGGTTTCAGACTTGCATGTGG + Intergenic
1010282674 6:74038938-74038960 CTGGATTTCAGACTTGCATGGGG + Intergenic
1010345118 6:74801389-74801411 CTGGATTTCAGACTTGCATGTGG + Intergenic
1010611101 6:77954344-77954366 CTGGTTTTCAGACTTACATGGGG + Intergenic
1010645761 6:78386417-78386439 CTGTTTTTCAGACTTGTGTGGGG - Intergenic
1010678167 6:78768276-78768298 CTGAGTTTCAGACTTGCATGGGG + Intergenic
1010835900 6:80587056-80587078 CTGGATTTCAGACTTGCATGGGG + Intergenic
1010883010 6:81202315-81202337 CTGGATTTCAGACTTGCATGAGG + Intergenic
1011041232 6:83032368-83032390 CTGGATTTCAGACTTGCATGGGG + Intronic
1011294015 6:85807834-85807856 CTGGATTTCAGACTTGCATGAGG - Intergenic
1011421889 6:87181558-87181580 CTGGTCTTCAGACTTGAGTGTGG + Intronic
1011544572 6:88469359-88469381 TTGGGTTTCAGACTTGCGTGAGG + Intergenic
1012108714 6:95198659-95198681 CTGGATTTCAGACTTGCATGAGG + Intergenic
1012148614 6:95718087-95718109 CTGGATTTCAGACTTGCATGGGG - Intergenic
1012362665 6:98402881-98402903 CAGATGTACATACTTGTGTGTGG + Intergenic
1013077099 6:106781185-106781207 CTGGATTTCAGACTTGTATGGGG + Intergenic
1013558686 6:111283233-111283255 CTGGATTTCAGACTTGCATGGGG - Intergenic
1013688159 6:112609743-112609765 CTGAATTCCAGACTTGCATGGGG + Intergenic
1013927660 6:115492953-115492975 CTGGATTTCAGACTTGCATGGGG - Intergenic
1014509949 6:122308402-122308424 ATGAGTTTCAGACTTGCATGAGG + Intergenic
1014520791 6:122439539-122439561 CTGTATTTCAGACTTGGATGGGG + Intergenic
1014721195 6:124920365-124920387 CTGGATTTCAGACTTGCCTGGGG - Intergenic
1015110591 6:129588081-129588103 TTGGATTTCGGACTTGTGTGGGG - Intronic
1015178690 6:130338705-130338727 CTGGATTTCAGACTTGCGTGAGG + Intronic
1015777723 6:136831727-136831749 CTGGGTTTCAGACTTGCATGGGG - Intronic
1015852917 6:137593193-137593215 CTGGATTTCAGACTTGCGTGGGG - Intergenic
1016122825 6:140364612-140364634 CTGGATTTCAGACTTGCATGGGG + Intergenic
1016151581 6:140747919-140747941 CTGGATTTCAGACTTGTATGGGG + Intergenic
1016261365 6:142174343-142174365 TTGGTTTTTGGACTTGTGTGGGG + Intronic
1016424247 6:143916713-143916735 CTGGGTTTCAGATTTGTGTGGGG + Intronic
1016575669 6:145567358-145567380 CAGAATTTGAGGCTTGTGTGTGG - Intronic
1016811950 6:148269931-148269953 ATCATTTTCACACTTGTGGGAGG - Intergenic
1017342120 6:153336134-153336156 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1017580529 6:155859737-155859759 CTGGATTTCAGACTTGCATGGGG + Intergenic
1017989086 6:159470767-159470789 CTGGGTTTCAGACTTGTGTGGGG - Intergenic
1018155788 6:160983942-160983964 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1018433520 6:163742099-163742121 CTGATTTGCAGGCTAGGGTGAGG - Intergenic
1018482497 6:164205866-164205888 CTGGATTTCAGACTTGCATGGGG + Intergenic
1018573813 6:165237130-165237152 CTGGATTTCAGACTTGCATGGGG + Intergenic
1018662527 6:166101634-166101656 CTGGCTTTTAGGCTTGTGTGAGG - Intergenic
1018922627 6:168186043-168186065 CTGGATTTCAGACTTGCATGGGG - Intergenic
1019039433 6:169091276-169091298 CTGGATTTCAGACTTGCATGGGG + Intergenic
1019081703 6:169435596-169435618 CTGGATTTCAGACTTGCATGGGG + Intergenic
1019107263 6:169678361-169678383 CTGGGTTTCAGACTTGCATGGGG + Intronic
1020546686 7:9541425-9541447 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1020732064 7:11892777-11892799 TTGGATTTCAGGCTTGTGTGTGG + Intergenic
1020755227 7:12192605-12192627 CTGGGTTTTAGACTTGTGTGAGG + Intergenic
1020881129 7:13764385-13764407 CTAATTTCTGGACTTGTGTGGGG + Intergenic
1020909876 7:14115675-14115697 CAGATTTTCAGGCTTTTCTGGGG - Intergenic
1020975851 7:15005469-15005491 CTTATTTTCAAACTTGAGTTTGG + Intergenic
1021134505 7:16948932-16948954 CTGGATTTCAGACTTGCATGGGG + Intergenic
1021170583 7:17394107-17394129 CTGGATTTCAGACTTGCATGGGG - Intergenic
1021401013 7:20209460-20209482 CTGGATTTCAGACTTGCATGGGG + Intronic
1021519752 7:21527277-21527299 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1021529744 7:21631581-21631603 CTGGATTTCAGACTTGCATGGGG - Intronic
1021646620 7:22795636-22795658 CTGGATTTCGGACTTGTGTGGGG - Intergenic
1021882943 7:25111596-25111618 CTAAATTTCAGACTTGCATGGGG + Intergenic
1022352373 7:29578050-29578072 CTGGATTTCAGACTTGCATGGGG + Intergenic
1022861921 7:34376464-34376486 CTGGGTTTTGGACTTGTGTGGGG + Intergenic
1022964215 7:35457708-35457730 CTGGATTTCAGACTTGCATGGGG - Intergenic
1023216160 7:37865314-37865336 CTGGATTTCAGACTTGCTTGGGG - Intronic
1023275748 7:38516912-38516934 CTGGGTTTCAGACTTGCATGGGG + Intronic
1023383758 7:39634330-39634352 ATGAAATTCAGACTTGGGTGGGG + Intronic
1023759457 7:43450340-43450362 CTGTTTTTCAGATTTTTGAGGGG - Intronic
1024083907 7:45878033-45878055 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1024137854 7:46429320-46429342 CTGGAGTTCAGACTTGTGTGGGG - Intergenic
1024158219 7:46647922-46647944 CTGGATTTCAGACTTGCATGGGG - Intergenic
1024439408 7:49398590-49398612 CTGAATTTCTGAATTGTTTGAGG + Intergenic
1024876996 7:54037319-54037341 CTGGGTTTCAGACTTGTGTGGGG - Intergenic
1024967549 7:55037527-55037549 CTCATTTGAATACTTGTGTGAGG + Intronic
1025121141 7:56304779-56304801 CTGACGATCTGACTTGTGTGTGG + Intergenic
1025285850 7:57660061-57660083 CTGGATTTCAGACTTGCATGGGG + Intergenic
1025861881 7:65338041-65338063 CTGGATTTCAGACTTAAGTGTGG + Intergenic
1026292242 7:69018267-69018289 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1027605283 7:80292246-80292268 CTGGATTTCAGACTTGCATGGGG - Intergenic
1028014317 7:85687494-85687516 CTTGGTTTCAGATTTGTGTGAGG + Intergenic
1028143666 7:87298506-87298528 CTGGATTTCAGACTTGCATGGGG - Intergenic
1028935605 7:96460392-96460414 ATGATACTCAGCCTTGTGTGGGG + Intergenic
1028960970 7:96749605-96749627 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1029007430 7:97225441-97225463 CTAATTTTTAAACTTGGGTGGGG + Intergenic
1029204842 7:98863422-98863444 CTGTGTTTCAGAATGGTGTGTGG + Intronic
1030108417 7:106006553-106006575 CTGGATTTCAGACTTGCATGGGG - Intronic
1030459124 7:109808523-109808545 CTGGATTTCAGACTTGCATGAGG + Intergenic
1030527568 7:110672693-110672715 CTGGATTTCAGACTTGCATGGGG - Intronic
1030754610 7:113272703-113272725 TTGGATTTCAGACTTGTGTGGGG - Intergenic
1030755019 7:113276956-113276978 CACATTTTCACACTTGTGTGAGG + Intergenic
1030841551 7:114359696-114359718 CTGGATTTCAGACTTGCATGCGG + Intronic
1031258665 7:119488897-119488919 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1031652134 7:124303906-124303928 CAGGATTTCAGACTTCTGTGGGG + Intergenic
1031668980 7:124519469-124519491 GTGGTTTTCAGACTTGCATGGGG + Intergenic
1031807687 7:126327700-126327722 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1032330580 7:130975358-130975380 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1032561058 7:132893286-132893308 CTGGATTTCAGACTTGCGTGGGG + Intronic
1033031523 7:137831940-137831962 TTGAATTTCAGACTTGCATGGGG - Intronic
1033871830 7:145763107-145763129 CTGGATTTCAGACTTGCATGAGG + Intergenic
1034124404 7:148657913-148657935 CTGTTGTTCAGACTGGAGTGTGG - Intergenic
1034573177 7:151973500-151973522 CTGGGTTTCAGACTTGCATGGGG + Intronic
1034876084 7:154725932-154725954 CTGGGTTTCAGACTTGCATGTGG - Intronic
1035261484 7:157664353-157664375 TTCATTATCAGACTTCTGTGGGG + Intronic
1035371253 7:158380402-158380424 CTAGATTTCAGACTTGCGTGGGG - Intronic
1036021731 8:4853917-4853939 CTGGGTTTCAGAATTATGTGGGG + Intronic
1036041615 8:5088747-5088769 CTAATTTTCAGCCTTCTTTGAGG - Intergenic
1036282101 8:7409028-7409050 CTGAGTTTCTGACATGTGTGGGG + Intergenic
1036339368 8:7902543-7902565 CTGAGTTTCTGACATGTGTGGGG - Intergenic
1036470255 8:9046634-9046656 CTCATTTCCAGAGTTGTTTGGGG - Intronic
1036518572 8:9468929-9468951 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1036798844 8:11774790-11774812 CTGGATTTCAGACTTGCATGGGG - Intronic
1037214015 8:16426387-16426409 CTGGATTTCAGACTTGCATGGGG + Intronic
1037299156 8:17433229-17433251 CAGATTTTTAGATGTGTGTGGGG + Intergenic
1037439899 8:18904511-18904533 CTGGGTTTCAGACTTGTGTGGGG + Intronic
1038005444 8:23425997-23426019 CAGATGTGCAGAGTTGTGTGTGG - Intronic
1038280375 8:26158867-26158889 CTGGATTTCAGACTTGCATGGGG - Intergenic
1038960645 8:32515290-32515312 CTTCTTTTCTGACTGGTGTGAGG + Intronic
1039666957 8:39544086-39544108 CTGGATTTCAGACTTGCATGGGG - Intergenic
1040797235 8:51299707-51299729 CTGGATTTCAGACTTATATGGGG - Intergenic
1041339153 8:56823340-56823362 CTGAATTTCAGACTTGCATGGGG + Intergenic
1041479713 8:58306799-58306821 CTGGATTTCAGACTTGCATGGGG - Intergenic
1041491572 8:58438536-58438558 CCGGGTTTCAGACTTCTGTGGGG + Intronic
1041510412 8:58649216-58649238 CTGGGTTTCAGACTTCAGTGAGG + Intronic
1041825856 8:62095765-62095787 CTGGATTTCAGACTTGCATGTGG - Intergenic
1041905131 8:63024487-63024509 CTGTTTTTCAGAATAGTCTGTGG - Intronic
1041977542 8:63817148-63817170 CTGGATTTCAGACTTGCATGGGG - Intergenic
1042501564 8:69514808-69514830 CTGGGTTTCAGACTTGCATGGGG - Intronic
1042519327 8:69694466-69694488 ATGATTTTAAGACTTGCATGTGG - Intronic
1042621992 8:70716978-70717000 CTGCATTTCAGACTTGCATGGGG - Intronic
1042868046 8:73372736-73372758 TTGGATTTCAGACTTGTGTCGGG + Intergenic
1043092940 8:75928020-75928042 CTGGATTTCAGACTTGCATGGGG - Intergenic
1043145483 8:76648392-76648414 CTGGATTTCAGACTTGCATGGGG + Intergenic
1043262473 8:78219775-78219797 CTGGATTTCAGACTTGCATGGGG - Intergenic
1043309037 8:78835280-78835302 CTAAATTTCAGACTCCTGTGAGG + Intergenic
1043345892 8:79297218-79297240 CTGTATTTCAGACTTGCATGGGG + Intergenic
1043993201 8:86781106-86781128 CTGGATTTCAGACTTGCATGGGG + Intergenic
1044378778 8:91507095-91507117 CTGATTCTCAGATTTTTGTTGGG + Intergenic
1045258133 8:100546890-100546912 CTGGGTTTCAGACTTGCATGAGG + Intronic
1045297883 8:100888249-100888271 CTGATTTTCAGAGGTGCCTGAGG + Intergenic
1045597126 8:103669639-103669661 CTGGATTTCAGACTTGCATGGGG - Intronic
1045617812 8:103938827-103938849 CTGGATTTCAGACTTGCATGGGG - Intronic
1046004046 8:108458048-108458070 CTGGATTTCAGACTTGCATGGGG - Intronic
1046129346 8:109947168-109947190 CTGGATTTCAGACTTGCATGGGG + Intergenic
1046300080 8:112276134-112276156 CTGGATTTTGGACTTGTGTGGGG - Intronic
1046359542 8:113132024-113132046 CTGGGTTTCAGACTTGCATGGGG + Intronic
1046506679 8:115146218-115146240 CTGGATTTCAGACTTGTCTGGGG - Intergenic
1046552203 8:115731280-115731302 CTGGATTTCAGACTTGCATGGGG + Intronic
1046668782 8:117035359-117035381 CTGGGTTTCAGACTTGCATGGGG - Intronic
1046735246 8:117769225-117769247 CTGGGTTTCAAACTTGTGTGGGG + Intergenic
1046889037 8:119400961-119400983 CTGAATTTCAGACTTGTGTGGGG + Intergenic
1046929115 8:119825240-119825262 CTGTATTTCAGACTTGCATGGGG + Intronic
1047836214 8:128696138-128696160 TTGTTTTTCAAATTTGTGTGTGG - Intergenic
1047940525 8:129824050-129824072 CTGGGTTTCAGACCTGTATGGGG + Intergenic
1048038931 8:130706558-130706580 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1048043248 8:130750742-130750764 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1048116779 8:131532328-131532350 CTGGATTTCAGACTTGCATGGGG + Intergenic
1048137490 8:131760198-131760220 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1048190562 8:132284579-132284601 CTGTGTTTCAGACTTGTTTTGGG - Intronic
1048478840 8:134769362-134769384 CTGGATTTCAGACTTGCATGGGG - Intergenic
1048657481 8:136557220-136557242 CTGATTCTTAGACTTTTGAGAGG + Intergenic
1048758709 8:137767549-137767571 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1048839432 8:138551880-138551902 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1049449200 8:142650111-142650133 CTGGATTTCAGACTTGCATGGGG + Intergenic
1050695486 9:8275397-8275419 CTGGATTTCAGACTTGCATGGGG - Intergenic
1050875013 9:10623362-10623384 CTGAGTTTCAGACTTGTGAGGGG - Intergenic
1050915147 9:11122225-11122247 CTGGATTTCAGACTTGCATGAGG - Intergenic
1050918069 9:11162432-11162454 CTGTGTTTCAAACTTGTGTACGG + Intergenic
1050938131 9:11424590-11424612 CTGGATTTCAGACTTGCATGGGG - Intergenic
1051619588 9:19037064-19037086 CTGGATTTCAGACTTGCATGGGG + Intronic
1051644086 9:19250729-19250751 CTGGATTTCAGACTTGCATGGGG - Intronic
1051925281 9:22317457-22317479 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1051926851 9:22338455-22338477 CTTATTTTCAGATGTCTGTGAGG - Intergenic
1052008933 9:23383251-23383273 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1052087886 9:24290691-24290713 CTGGATTTCAGACTTGCATGGGG - Intergenic
1052093322 9:24356398-24356420 CTGGTTTTCAGACTTGCATGGGG - Intergenic
1052124334 9:24756387-24756409 CTGGATTTCAGACTTGCATGGGG + Intergenic
1052169369 9:25374820-25374842 CTGGTTTTCAGACTTGCATGGGG - Intergenic
1052208238 9:25869689-25869711 CTAGGTTTCAGACTTGCGTGGGG - Intergenic
1052294627 9:26882904-26882926 CTGGATTTCAGACTTGCATGGGG + Intronic
1052428692 9:28338234-28338256 CTGGATTTCAGACTTGCATGGGG + Intronic
1052846333 9:33339799-33339821 CTGAATTTCGGACTTGCATGGGG - Intronic
1052969353 9:34367570-34367592 CTGGATTTCAGACTTGCATGGGG - Exonic
1053219033 9:36296025-36296047 CTGTTGTTCAGACTGGAGTGTGG - Intronic
1053627286 9:39888075-39888097 CTGGGTTTCAGACTTGCATGCGG - Intergenic
1053664079 9:40305294-40305316 CTGAGTTTTGGACTTGTGTTGGG + Intronic
1053665045 9:40311499-40311521 CTGAGTTTTGGACTTGTGTTGGG + Intronic
1053778707 9:41577950-41577972 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1053914627 9:42936549-42936571 CTGAGTTTTGGACTTGTGTTGGG + Intergenic
1054166669 9:61788190-61788212 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1054216601 9:62362628-62362650 CTGGGTTTCAGACTTGCATGCGG + Intergenic
1054376206 9:64451529-64451551 CTGAGTTTTGGACTTGTGTTGGG + Intergenic
1054519570 9:66064785-66064807 CTGAGTTTTGGACTTGTGTTGGG - Intergenic
1054520536 9:66070991-66071013 CTGAGTTTTGGACTTGTGTTGGG - Intergenic
1054670881 9:67792715-67792737 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1054963439 9:70995141-70995163 CTAATTTTCAGCCTAGTGTAAGG - Intronic
1055495684 9:76852320-76852342 CTGATATTGAAACTTGAGTGGGG + Intronic
1055595528 9:77861613-77861635 CTGGATTTTGGACTTGTGTGGGG - Intronic
1055701617 9:78950482-78950504 CTGGATTTCAGACTTGCATGGGG + Intergenic
1055782216 9:79832252-79832274 CTGAGTTTCAGACTTGGGCAGGG - Intergenic
1056087134 9:83161390-83161412 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1056192609 9:84199081-84199103 CTGGGTTTCAGACTTACGTGGGG - Intergenic
1056284013 9:85069887-85069909 CTGGATTTCAGATTTGCGTGGGG + Intergenic
1056312289 9:85352758-85352780 CTGGGTTTCAGACTTGTGTGGGG - Intergenic
1056397363 9:86193900-86193922 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1056463680 9:86832969-86832991 CTGATTTTATGCATTGTGTGTGG + Intergenic
1058082155 9:100712031-100712053 CTGGATTTCAGACTTGCCTGGGG - Intergenic
1058086389 9:100752795-100752817 CTGGATTTCAGACTTGCATGGGG - Intergenic
1058090237 9:100797800-100797822 TTAATTTTAAGACTTGTTTGTGG + Intergenic
1058222049 9:102314420-102314442 CTGGATTTCAGACTTGCATGGGG + Intergenic
1058223085 9:102326355-102326377 TTGAATTTCAGACTTGGATGGGG + Intergenic
1058292169 9:103256554-103256576 CTGGTTTCCAGACTTGCATGGGG - Intergenic
1058380512 9:104372245-104372267 CTGAATTTCGGACTTGCATGGGG + Intergenic
1058810091 9:108630850-108630872 CTGGATTTCAGACTTGCATGGGG + Intergenic
1059022959 9:110596607-110596629 CTGGATTTCAGACTTGCATGGGG - Intergenic
1059082514 9:111265577-111265599 CTGAATTTCAGACTTGCATGGGG - Intergenic
1059562295 9:115347338-115347360 CTGGTTTTCAAACTTGCATGGGG - Intronic
1059617484 9:115967044-115967066 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1060030498 9:120210864-120210886 CAGATTTGCAGATGTGTGTGAGG + Intergenic
1060348464 9:122837236-122837258 CTGAGTTTCAGACTTGCATAGGG - Intergenic
1060653492 9:125351619-125351641 CTGGATTTCAGACTTGGATGGGG - Intronic
1060895927 9:127217217-127217239 CTGATTTTCAGACCTGGAGGAGG + Intronic
1186333833 X:8564973-8564995 CTGAGTTACAGGGTTGTGTGGGG + Intronic
1186671474 X:11771359-11771381 CTGAATTTCAGAACTGTGGGTGG - Intronic
1186742693 X:12534665-12534687 CTGGATTTCAGACTTGCATGGGG + Intronic
1186797566 X:13061878-13061900 CTGGATTTCAGACTTGGATGAGG - Intergenic
1186807640 X:13155905-13155927 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1187070037 X:15879153-15879175 CTGGATTTCAGACTTGCATGGGG - Intergenic
1187072282 X:15900595-15900617 CTGGATTTCAGACTTGCATGGGG - Intergenic
1187619071 X:21030307-21030329 CTGGATTTCAGACTTGCATGGGG - Intergenic
1187634470 X:21211599-21211621 CTGGGTTTCAGACTTGCATGCGG + Intergenic
1187654674 X:21457781-21457803 CTGCTTTTGAAATTTGTGTGTGG + Intronic
1187663135 X:21573089-21573111 CTGGATTTCAGACTTGCATGTGG - Intronic
1187973327 X:24680469-24680491 CTGATTTTAAGACTTCTATAAGG + Intergenic
1188018856 X:25135089-25135111 CTGCATTTCAGACTTGTATGGGG + Intergenic
1188169995 X:26912163-26912185 CTGGATTTCAGACTTGCATGGGG + Intergenic
1188187231 X:27130389-27130411 CTGGATTTCAGACTTGAGTGGGG - Intergenic
1188238169 X:27754170-27754192 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1188397842 X:29706533-29706555 CTGTATTTCAGACTTGCATGAGG - Intronic
1188849062 X:35110075-35110097 CTGGGTTTCAGACTTGTGTGAGG - Intergenic
1188856949 X:35208703-35208725 CTGGATTTCAGACTTGCATGAGG - Intergenic
1188865325 X:35306484-35306506 TTGGGTTTCAGACTTGTATGGGG + Intergenic
1188924151 X:36018894-36018916 CTGTTTTTCAGAATAGTTTGAGG + Intergenic
1188961814 X:36501982-36502004 CTGGATTTCAGACTTGCATGGGG - Intergenic
1189087927 X:38046884-38046906 CTGGATTTCAGACTTGCATGGGG - Intronic
1189431311 X:40950095-40950117 CTGGGTTTCAGACTTGTGTGGGG - Intergenic
1189656559 X:43250960-43250982 CTAGGTTTCAGACTTGTGTGGGG - Intergenic
1189720197 X:43907869-43907891 CTGATTTTCGTACTTTTGTAGGG - Intergenic
1189999005 X:46666969-46666991 CTGATTTTCAGAGTTCTCTTTGG + Intronic
1190387678 X:49898506-49898528 CTGGATTTCAGACTTGCATGGGG + Intergenic
1190425150 X:50328878-50328900 CTGGGTTTCAGACTTATGTGGGG - Intronic
1190794177 X:53725695-53725717 CTGGGTCTCAGACTTGTGTGGGG + Intergenic
1191598386 X:62973888-62973910 CTGGATTTCAGACTTGCATGGGG - Intergenic
1191680079 X:63831641-63831663 TTGAATTTCAGACTTGCATGGGG + Intergenic
1191694796 X:63978657-63978679 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1191783939 X:64897381-64897403 CTGAATTTCAGAGTTGCATGAGG - Intergenic
1191995901 X:67094851-67094873 CTGGTTCTCAGGCTTGTGTGGGG + Intergenic
1191999011 X:67127729-67127751 CTGGATTTCAGACTTGCATGGGG + Intergenic
1192060114 X:67816224-67816246 CTGATTTTCAGCTTTATTTGGGG - Intergenic
1192309504 X:69998315-69998337 CTGGATTTCAGACTTGCATGGGG + Intronic
1192705683 X:73527150-73527172 TTGGGTTTAAGACTTGTGTGAGG + Intergenic
1192919968 X:75696302-75696324 CTGGATTTCAGACTTGCGTGGGG - Intergenic
1192937054 X:75871095-75871117 CTGGGTTTCAGACTTGTATGGGG + Intergenic
1193008203 X:76644406-76644428 TTGAATTTCAGACTTGCTTGGGG + Intergenic
1193026266 X:76849396-76849418 CTGGATTTCAGACTTGCATGGGG - Intergenic
1193192158 X:78583517-78583539 CTGGGTTTCGGACTTGTGTAGGG + Intergenic
1193199044 X:78666193-78666215 TTGGATTTCAGACTTGTATGGGG + Intergenic
1193250137 X:79281347-79281369 CTGAATTTCAGACTTGCATGGGG - Intergenic
1193275273 X:79579353-79579375 CTGAGTTTCAGACTTGTGTGGGG + Intergenic
1193329723 X:80222749-80222771 CTGGGTTTCATACTTGCGTGGGG + Intergenic
1193330142 X:80226754-80226776 CTGGGTTTCATACTTGCGTGGGG - Intergenic
1193406515 X:81107862-81107884 CTGGGTTTCAGATATGTGTGGGG + Intergenic
1193412743 X:81183791-81183813 CTGGGTTTCAGACTTGTGTGGGG + Intronic
1193439058 X:81516041-81516063 CTGGATTTCAGACTTGCATGGGG + Intergenic
1193519998 X:82518410-82518432 CTGTGTTTCAGACTTGCATGGGG - Intergenic
1193564081 X:83056043-83056065 CTGGGATTCAGACATGTGTGGGG - Intergenic
1193643416 X:84039466-84039488 CTGGTTTTCAGACTTGCATAGGG - Intergenic
1193770322 X:85580498-85580520 CTGGGGTTCAGACTTGTGTGGGG - Intergenic
1193772568 X:85605345-85605367 CTAGGTTTCAGACTTGTGTGAGG - Intergenic
1193804568 X:85979112-85979134 CTGATTTACAGATTTCTGTCAGG + Intronic
1193823264 X:86192034-86192056 CTGATTCTCTGACTTGTGCTTGG + Intronic
1193861517 X:86673406-86673428 CTGGGTTTCAGACTTGCATGGGG + Intronic
1193911197 X:87309101-87309123 CTGGGTTTCAGACTTGCTTGGGG - Intergenic
1193930625 X:87546854-87546876 CTGGATTTCAGACTTGCCTGGGG + Intronic
1194019439 X:88668766-88668788 CCGCATTTCAGACTTGTGTGTGG - Intergenic
1194024825 X:88738809-88738831 CTGGGTTTCAGACTTGCTTGTGG - Intergenic
1194124708 X:90001624-90001646 CTGTTTTTCAATTTTGTGTGTGG - Intergenic
1194169555 X:90564688-90564710 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1194178801 X:90688106-90688128 CTGGTTTTCAGACTTGCATGGGG - Intergenic
1194182820 X:90734810-90734832 CTGGATTTCAGACTTGCATGGGG + Intergenic
1194352621 X:92839727-92839749 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1194358936 X:92922941-92922963 CTTATTTTCAGACTTGGCTCTGG + Intergenic
1194373922 X:93109751-93109773 CTGGGTTTCAGACTTCTGGGGGG - Intergenic
1194397285 X:93401940-93401962 CTGTGTTTCAGAATTGTGTGGGG + Intergenic
1194442981 X:93955409-93955431 CTGGATTTCAGACTTGCGTGGGG + Intergenic
1194496265 X:94620914-94620936 CTGGATTTTAGACTTGCGTGGGG - Intergenic
1194535082 X:95096138-95096160 CTGAATTTCAGATTTGCATGGGG + Intergenic
1194541533 X:95178173-95178195 CTGTGTTTCAGACTTGCATGAGG + Intergenic
1194624495 X:96212895-96212917 TTGGATTTCAGACTTGTATGGGG - Intergenic
1194932930 X:99910738-99910760 CTGACTTTCAGGCTTTTCTGTGG + Intergenic
1195154612 X:102110469-102110491 CTGGATTTCAGACTTGCCTGGGG + Intergenic
1195608276 X:106834736-106834758 CTGGATTTCAGACTTGTATGGGG - Intronic
1196138173 X:112232208-112232230 CAGATCTTCTGACTTCTGTGAGG - Intergenic
1196246537 X:113406293-113406315 TTGGATTTCAGACTTGTATGGGG - Intergenic
1196313425 X:114196159-114196181 CTGGATTTCAGACTTGCATGGGG - Intergenic
1196366685 X:114932086-114932108 CTGGGTTTCAGACATGCGTGGGG - Intergenic
1196480534 X:116142021-116142043 CTGGATTTCAGACTTGCATGGGG + Intergenic
1196576299 X:117322938-117322960 CTGGATTTCAGACTTGCATGGGG + Intergenic
1197054359 X:122098410-122098432 CTGGATTTCAGACTTGCATGGGG + Intergenic
1197058994 X:122154318-122154340 CTGGATTTCAGACTTGCATGGGG + Intergenic
1197074979 X:122343135-122343157 CTGGTTTTCAGAATTGTGTGGGG - Intergenic
1197349028 X:125359622-125359644 CTGAATTTCGGACTTGCATGGGG + Intergenic
1197460503 X:126735541-126735563 CTGGGTTTCAGACTTGTATGGGG - Intergenic
1197559438 X:127999621-127999643 CTGAATTTAAAACTTGTGTAAGG + Intergenic
1197639692 X:128954349-128954371 CTGAATTTTGGACTTGTATGGGG - Intergenic
1197911057 X:131482872-131482894 CTGGATTTTGGACTTGTGTGGGG + Intergenic
1198304582 X:135368104-135368126 CTGGGTTTCAGACTTGCATGGGG - Intergenic
1198569848 X:137942833-137942855 CTGGATTTCAGACTTGCATGGGG + Intergenic
1198888112 X:141361761-141361783 CTGGATTTCAGACTTGCATGTGG - Intergenic
1198996440 X:142578816-142578838 CTGAATTTTAGACTTGCATGGGG + Intergenic
1199237826 X:145510866-145510888 CTGGGTTTCAGACTTGCATGGGG + Intergenic
1199243546 X:145575705-145575727 CTGGGTTTCAGACTTATGTCTGG + Intergenic
1199284330 X:146039164-146039186 CTGGATTTCAGACTTGCATGGGG + Intergenic
1199338107 X:146643084-146643106 CTGAGTTTCAGACTTACATGGGG + Intergenic
1199373845 X:147083903-147083925 CTGAGTTTCAGACTTGCATGGGG + Intergenic
1199492639 X:148418000-148418022 CTCCGTCTCAGACTTGTGTGTGG - Intergenic
1199638946 X:149841470-149841492 CTAGATTTCAGACTTGTATGGGG - Intergenic
1199715121 X:150502624-150502646 AAGATTTTAGGACTTGTGTGTGG - Intronic
1199929447 X:152503781-152503803 CTGGGTTTCAGACTTGCTTGGGG - Intergenic
1199929700 X:152506081-152506103 CTGAATTTCAGACTTTCATGGGG - Intergenic
1200381654 X:155843353-155843375 CTGGATTTCAGACTTGCATGGGG + Intergenic
1200477600 Y:3659235-3659257 CTGTTTTTCAATTTTGTGTGTGG - Intergenic
1200525466 Y:4270276-4270298 CTGGTTTTCAGACTTGCATGGGG - Intergenic
1200660928 Y:5956469-5956491 CTGGGTTTCAGACTTGAATGGGG - Intergenic
1200667150 Y:6038954-6038976 CTAATTTTCAGACTTGGCTCTGG + Intergenic
1200681951 Y:6223822-6223844 CTGGGTTTCAGACTTCTGGGGGG - Intergenic
1201265562 Y:12203317-12203339 CTAAGTTTCAGACTTGCATGGGG + Intergenic
1201592421 Y:15629457-15629479 CTAGATTTCAGACTTGTGTGGGG + Intergenic
1201958057 Y:19647791-19647813 CTCATTTTTTGACTTGGGTGGGG + Intergenic
1201982173 Y:19919648-19919670 CTGGGTTTCAGACTTACGTGGGG + Intergenic
1202019885 Y:20453161-20453183 CTGGATTTCAGACTTCTGTAGGG + Intergenic