ID: 936695341

View in Genome Browser
Species Human (GRCh38)
Location 2:114940357-114940379
Sequence CTTATAATAAAACATGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936695341_936695343 4 Left 936695341 2:114940357-114940379 CCAGACACATGTTTTATTATAAG 0: 1
1: 0
2: 1
3: 8
4: 235
Right 936695343 2:114940384-114940406 AACAGAGTGTATCTGCTCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 96
936695341_936695342 3 Left 936695341 2:114940357-114940379 CCAGACACATGTTTTATTATAAG 0: 1
1: 0
2: 1
3: 8
4: 235
Right 936695342 2:114940383-114940405 AAACAGAGTGTATCTGCTCTAGG 0: 1
1: 0
2: 2
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936695341 Original CRISPR CTTATAATAAAACATGTGTC TGG (reversed) Intronic
901730646 1:11276850-11276872 CTTATAATAAAAAATGTTGGGGG - Intronic
904625983 1:31802735-31802757 TTAATAAAAAAACATGTTTCCGG - Intronic
907841368 1:58160781-58160803 TTTACAATAAAGCATGTGTTTGG + Intronic
910791180 1:91052706-91052728 CTTATAATAAAACAAGTAAAAGG - Intergenic
910872418 1:91847195-91847217 CTTATAATAAATGTGGTGTCAGG + Intronic
911487005 1:98515099-98515121 CTTACAGTAACTCATGTGTCAGG + Intergenic
914330042 1:146659563-146659585 CTTAAAATGAAACATTTGGCCGG - Intergenic
915126202 1:153666819-153666841 CTCATTAAAAAACATTTGTCAGG + Intronic
916648337 1:166811471-166811493 CTTAAAAGAAGACATGTGGCTGG + Intergenic
917050148 1:170913913-170913935 TGTATAATAAAAAATATGTCTGG + Intergenic
918635840 1:186773057-186773079 CTTATATAAAAACATGTTCCTGG + Intergenic
919649684 1:200135068-200135090 TTTATAATACAAAATGTGACTGG + Intronic
922494624 1:226046946-226046968 CTTAAAATGAAAGATTTGTCTGG - Intergenic
923108882 1:230875354-230875376 CTTAAAACAAAACTTGTGTCAGG + Intergenic
924086650 1:240458716-240458738 CTGATAATAAAAGATGAATCTGG + Intronic
1062842977 10:685663-685685 ATAATAATAAGACATGAGTCTGG + Intronic
1062849113 10:729329-729351 CTTGTCATAAAACATGTCTCAGG + Intergenic
1065172586 10:23046563-23046585 CTTTTAATAAAACAATTTTCTGG - Intergenic
1065236920 10:23661368-23661390 CTTTTTATAAAACATATTTCTGG - Intergenic
1065403152 10:25329768-25329790 CATGTAATAAAACAAGTGTTTGG - Intronic
1067681105 10:48441750-48441772 CTCATAAAAACACATGTGCCTGG - Intergenic
1068387264 10:56347663-56347685 ATAATAATTAAACATGTGTTGGG - Intergenic
1072696519 10:97607914-97607936 ATTATAATAAATCATGTTTTTGG - Intronic
1074005777 10:109421695-109421717 CTTATAAGAAAATATGCGGCCGG + Intergenic
1075639250 10:124052870-124052892 CTAAAAATAAAAAATTTGTCAGG + Intronic
1076425738 10:130366498-130366520 CTTAAAAGAAGACATGTGTGTGG - Intergenic
1080546160 11:33320952-33320974 CTTATTTAAAAACATGTGACAGG + Intronic
1082678614 11:56141284-56141306 CTTATAATTAAACATGTGGTAGG + Intergenic
1086814903 11:91357842-91357864 ATTATAATAAAAATTGTGTGTGG + Intergenic
1087869866 11:103279194-103279216 AATATAATAAAACATCTTTCTGG - Intronic
1088370794 11:109086280-109086302 CTGAAAATAAAACATGGTTCAGG - Intergenic
1090417388 11:126549919-126549941 CTTAGAATAAAACATCTCACAGG + Intronic
1092935931 12:13364452-13364474 CTTCCAATAAAACATGACTCAGG - Intergenic
1093737170 12:22634477-22634499 CTTTTAATAATACATGTTTAAGG + Intronic
1095325047 12:40879609-40879631 CTAAAAATAAGATATGTGTCAGG + Intronic
1095447971 12:42301287-42301309 CTTAGAACAGAACATGTTTCAGG - Intronic
1095875247 12:47073363-47073385 ATTATAATAAATCATGAATCAGG + Intergenic
1099351016 12:81568365-81568387 CTTGTATTCAAACATTTGTCTGG + Intronic
1099597619 12:84687859-84687881 ATTATAAGAAAACATGACTCTGG + Intergenic
1099899224 12:88686185-88686207 CATGTTATAAAACATGTGTTGGG - Intergenic
1100527913 12:95437343-95437365 ATGAAAATAAAACATTTGTCTGG - Intergenic
1105502152 13:20982005-20982027 CTCATCTTAAAACATGTGTCAGG - Intronic
1105625727 13:22110796-22110818 CTTATAAAAGTACATGTCTCTGG - Intergenic
1107038771 13:35927588-35927610 TGTATAATAAAACATGTGTCTGG + Intronic
1108852847 13:54756005-54756027 ATTATAATAAAACTTGATTCTGG + Intergenic
1109006806 13:56887579-56887601 AGTACAAAAAAACATGTGTCTGG - Intergenic
1112539124 13:100289850-100289872 CAAATAATGAAAGATGTGTCTGG - Intronic
1114255154 14:20995410-20995432 CTTATATAAAAACAGGTGGCAGG - Intronic
1114867527 14:26615411-26615433 CTGATAATAACAGATTTGTCAGG + Intergenic
1115902295 14:38165574-38165596 GTTAAAGTAAAAAATGTGTCCGG + Intergenic
1116508278 14:45712872-45712894 CTTATAATAAAACCTATATAGGG + Intergenic
1116913635 14:50498770-50498792 CTTAGAAAAAAACTTATGTCTGG - Intronic
1120045322 14:79799135-79799157 CTTTCAATAAAATATCTGTCTGG - Intronic
1120725328 14:87932601-87932623 TTTTTAAAAAAACATGTATCTGG + Intronic
1120792476 14:88597930-88597952 CTTAGAATAAAAAATGTGATAGG - Intronic
1122897254 14:104765526-104765548 TTGAAAATAAAACAAGTGTCGGG + Intronic
1124885549 15:33682656-33682678 CTCATCAGAAAACATGTGCCTGG + Intronic
1126250931 15:46566754-46566776 CTTTTAAAAAAAGATGTGTGAGG + Intergenic
1133429469 16:5724236-5724258 CCCAAAATAAAACCTGTGTCTGG + Intergenic
1133529177 16:6638482-6638504 ATTATAATAAAATATGCTTCTGG + Intronic
1134019224 16:10910029-10910051 CTTAAAAAAAAAGATCTGTCTGG - Intronic
1135241941 16:20815101-20815123 CTGAGACTAATACATGTGTCAGG + Intronic
1136229853 16:28879763-28879785 CTTAAAATAAAACCTGCCTCTGG - Intronic
1140003511 16:71051348-71051370 CTTAAAATGAAACATTTGGCCGG + Intronic
1140174389 16:72641854-72641876 CTTGTAATAAAACCTGTTACAGG - Intergenic
1140613629 16:76633156-76633178 CTTTTAATAAAACATCTGAAAGG - Intronic
1141153677 16:81582205-81582227 ATTATAATTGAACATGAGTCTGG + Intronic
1141354661 16:83333961-83333983 CTGAGAATCCAACATGTGTCAGG + Intronic
1141843074 16:86586899-86586921 CTTATAAAAATACACCTGTCTGG - Intergenic
1143245859 17:5485652-5485674 CTTATAATAAAAAGGGTCTCTGG - Intronic
1143246953 17:5494894-5494916 CTTAGAAGAAAACATGTATTAGG + Intergenic
1151440402 17:74125081-74125103 CTTAGAATCAAAGATGTTTCAGG + Intergenic
1153724710 18:7942935-7942957 CTTAAAGCAAAAAATGTGTCAGG - Intronic
1153839678 18:8995313-8995335 CTTATAATAAAACAATTTTAGGG - Intergenic
1154078431 18:11229127-11229149 ATTTTAAAAAAATATGTGTCAGG - Intergenic
1155443052 18:25882245-25882267 CATTTGACAAAACATGTGTCTGG - Intergenic
1163159289 19:15455217-15455239 CTTATAATTAGACATGAGACTGG + Intronic
1165371198 19:35407351-35407373 TTTAAAATAAAACTTGTGGCTGG - Intergenic
926512604 2:13801416-13801438 CTTATATTTAAAATTGTGTCTGG + Intergenic
929515275 2:42601197-42601219 ATAATAATAAAAAATGGGTCAGG - Intronic
930460324 2:51665403-51665425 CTTAGTATAAGACATGAGTCTGG - Intergenic
931171765 2:59810882-59810904 CTGATAATAGTAAATGTGTCAGG - Intergenic
931825064 2:65991812-65991834 TTTATAATCAAACAGCTGTCTGG + Intergenic
931999052 2:67866965-67866987 CTTATAAAAGAACATGTTTCTGG + Intergenic
932948825 2:76269353-76269375 CTTATAATAGAACACTTCTCTGG + Intergenic
934868710 2:97839481-97839503 CTAAAAATAAAGAATGTGTCAGG - Intronic
935029239 2:99306181-99306203 CTTATAAGAAATCATGAGGCAGG - Intronic
935370728 2:102343930-102343952 TTTATAATAAGACATTTGTTAGG + Intronic
936525870 2:113241389-113241411 GGTAAAATAAAGCATGTGTCAGG + Intronic
936695341 2:114940357-114940379 CTTATAATAAAACATGTGTCTGG - Intronic
936779373 2:116013727-116013749 TTTAAAATATAACATGTGGCTGG - Intergenic
936912672 2:117608974-117608996 CTCAAAATAAAACATCAGTCTGG + Intergenic
938185775 2:129230563-129230585 TTTATAATAAAGCATTTGGCTGG - Intergenic
940648545 2:156417394-156417416 ATTACAATTAAACATATGTCAGG + Intergenic
940967333 2:159854084-159854106 CTTTTAGTAAAAAATGTGACAGG + Intronic
942472900 2:176281071-176281093 CTGATAGTAAAAAGTGTGTCTGG + Intronic
942599243 2:177623362-177623384 CTTACAATGAAACATCAGTCTGG + Exonic
944023631 2:195137262-195137284 CTTATATTAAATAATGTGTTAGG - Intergenic
945101604 2:206267401-206267423 GGTATAATAAAAAATGTGCCGGG - Intergenic
945848503 2:214977465-214977487 CTTTTAATTAAACATTTGCCTGG - Intronic
946557736 2:220877727-220877749 CTTATAATAAATCATTTCCCTGG + Intergenic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1173304718 20:41837276-41837298 CTTGTTATAAAACAGATGTCTGG - Intergenic
1176705096 21:10110614-10110636 CTCTTAAAAAAACATTTGTCAGG - Intergenic
1177931340 21:27287911-27287933 CTAATAAGAAATTATGTGTCTGG + Intergenic
1181331181 22:22092702-22092724 CTTATAAGAAAACATAGGTTGGG + Intergenic
1181838698 22:25634576-25634598 CTTATAATTAAACATAATTCTGG - Intronic
1182852852 22:33491055-33491077 CTTGTAAACAAAGATGTGTCTGG - Intronic
1184394095 22:44222433-44222455 CTTATAAAAAACCAAGTTTCAGG - Intergenic
1184856042 22:47147356-47147378 CTTTTAATAACAGATGTGTAAGG + Intronic
1184932754 22:47693301-47693323 TTTGATATAAAACATGTGTCTGG + Intergenic
949850385 3:8414499-8414521 CATATAATAAGGCATGTTTCTGG - Intergenic
950273791 3:11641141-11641163 TCTAAAATAAACCATGTGTCTGG - Intronic
950838995 3:15948751-15948773 CTGGTTATGAAACATGTGTCTGG - Intergenic
953263066 3:41358900-41358922 GTTACAATAAACCATGTGTGGGG + Intronic
954333909 3:49905167-49905189 TTTAAAATAAAATATGTGACCGG + Intronic
955967437 3:64403138-64403160 CTTGTAATCAAACCTGTCTCTGG + Intronic
957111314 3:75962807-75962829 CTTGAAATAACACATCTGTCTGG - Intronic
958027581 3:88066823-88066845 CCTGTAGTAAAATATGTGTCTGG + Intronic
958499361 3:94886261-94886283 CTTTTAAAAAAACATGAGCCAGG + Intergenic
958829435 3:99069247-99069269 ATTATAATAAAACATTCATCTGG - Intergenic
960285901 3:115828264-115828286 GTTATCATAAGACATTTGTCAGG + Intronic
960472315 3:118081996-118082018 CTAATTATAAAACTGGTGTCTGG + Intergenic
960573139 3:119205091-119205113 CTTATAACTCAACATTTGTCTGG + Exonic
962124507 3:132601559-132601581 CTTATAATAAAGAATGGGTTGGG + Exonic
962440693 3:135413191-135413213 TTGATAATAAAACATTTTTCAGG - Intergenic
964265142 3:154887748-154887770 CTTAAAATTAAACACCTGTCGGG - Intergenic
965120086 3:164543040-164543062 CTCATAATTGACCATGTGTCCGG + Intergenic
966004892 3:174998035-174998057 ATTACAATAAAAGAAGTGTCAGG - Intronic
966783066 3:183601645-183601667 CCTATTATAAAACATGCCTCTGG - Intergenic
968040721 3:195587011-195587033 CTCCTAAAAAAACATGTTTCTGG + Intergenic
969998160 4:11336340-11336362 ATTATAATAAAACCTGTAGCGGG + Intergenic
970880826 4:20927730-20927752 TTTAAATTAAAATATGTGTCGGG + Intronic
971713071 4:30142146-30142168 CTTATAATAACACATGTGGAGGG - Intergenic
972796263 4:42423285-42423307 TTTATAATAAAAAATGTTTTTGG + Intronic
973024730 4:45252926-45252948 TCTATAATAAAAAATGTTTCAGG + Intergenic
975555878 4:75664176-75664198 TTTAAAATAAAACAGGTGGCTGG - Intronic
976163287 4:82227064-82227086 CTTACAATAAATAATGTGACTGG + Intergenic
976520074 4:86016564-86016586 CTTATAAGAAAACATGTAAAGGG - Exonic
976539767 4:86260674-86260696 CTTAAAAGAAAACACGTGACTGG + Intronic
978195188 4:105963307-105963329 CTTATAAAAGAATATGTGTTTGG + Intronic
979225558 4:118280231-118280253 CTTATAATTAAACTAGTGTTGGG - Exonic
979475251 4:121149468-121149490 CTTAAAATAAACCACGTGGCTGG + Intronic
980658988 4:135831565-135831587 CTCCTTATAAAACATGTATCAGG - Intergenic
980719899 4:136682003-136682025 CTTAGAATAAAATATGTTTTTGG + Intergenic
981055287 4:140353916-140353938 CTGACAATGAAACATGTGTATGG - Intronic
981229105 4:142332195-142332217 CTTATATTATACCATGTTTCAGG + Intronic
981903673 4:149894851-149894873 CTTACAGGAAAATATGTGTCAGG - Intergenic
983482535 4:168292464-168292486 TTTAAAATAAAACATTTTTCAGG + Intronic
987449494 5:18064154-18064176 CTTAAAATTAAATATGTGTCTGG + Intergenic
987529958 5:19105016-19105038 TTAAAAATAAAAAATGTGTCAGG + Intergenic
987935999 5:24465617-24465639 CTTTTACTAAAATATGTTTCAGG - Intergenic
987962886 5:24832863-24832885 TCTATAATAAAATATGTTTCTGG + Intergenic
988381753 5:30505601-30505623 CTTATGAAAAAGCGTGTGTCAGG - Intergenic
989734217 5:44683678-44683700 CTTATCGTAAAACAAGTCTCAGG + Intergenic
990902602 5:60769601-60769623 CATACAATAAACCATGTGTTCGG + Intronic
992255936 5:74921210-74921232 CTTATTATAAAACATTAGTTTGG + Intergenic
994110423 5:95996909-95996931 CTAATAGTAAACCATGTGCCAGG - Intergenic
994222968 5:97217918-97217940 CTTATAATTATACATATATCAGG + Intergenic
994698026 5:103097517-103097539 TTTGTAATAAAACATTTATCTGG + Intronic
994874270 5:105394918-105394940 CTTAAAATTAAACATTTATCAGG - Intergenic
994910986 5:105907278-105907300 CTTAAAAGAAAACATATGTTAGG - Intergenic
995030224 5:107472250-107472272 CATGTAATAAAACAAGTGTTTGG - Intronic
995626858 5:114088915-114088937 TTTAAAATAAAAAATGTGGCTGG - Intergenic
995954436 5:117758674-117758696 CTTGTAACAAAACAAGTGTGTGG + Intergenic
996969990 5:129354494-129354516 GTTATAATAAATTATGAGTCTGG + Intergenic
998346681 5:141470513-141470535 CTAATATTAAAATATGTATCAGG + Intronic
998517104 5:142766513-142766535 TTTCTTATTAAACATGTGTCCGG + Intergenic
1000672435 5:164078917-164078939 CTTATCATTAATCATGTGTTTGG - Intergenic
1002027234 5:176403919-176403941 CTAAAAATAAAACATTAGTCGGG - Intronic
1003814560 6:9823800-9823822 CTTACAATAAACCAAGTTTCTGG - Intronic
1004173215 6:13315414-13315436 CATATAACAAAATATGTGGCTGG + Intronic
1005093043 6:22079309-22079331 TTTTTTATAAAACAGGTGTCAGG + Intergenic
1006757459 6:36428961-36428983 CTTATTTTAAAATATATGTCAGG + Intronic
1008991540 6:57608428-57608450 CTTTTCAAAAAAAATGTGTCAGG + Intronic
1009766318 6:68080087-68080109 ATTATGATAAAACAACTGTCAGG - Intergenic
1010729268 6:79371173-79371195 CTTATAATCAAACATTGGTAGGG + Intergenic
1011827047 6:91319985-91320007 CAAATAATTGAACATGTGTCAGG - Intergenic
1012365071 6:98429151-98429173 CTAACCATAAAACATATGTCCGG + Intergenic
1012522237 6:100135671-100135693 TTAATATTATAACATGTGTCAGG - Intergenic
1012916163 6:105173386-105173408 ATTATAATGTAACATGTGTTTGG + Intronic
1012970364 6:105722826-105722848 CTTATAATAATATTTATGTCTGG - Intergenic
1013582722 6:111552023-111552045 TTTATAATAAAACCTGTGTTTGG - Intergenic
1013779294 6:113712426-113712448 CTTATTATAAAAAATGTGCTGGG - Intergenic
1014772261 6:125470303-125470325 TTTTTAAAAAATCATGTGTCAGG - Intergenic
1014987188 6:128025834-128025856 CTTATAAGAATACATGTAACTGG + Intronic
1015932228 6:138373297-138373319 CATATTATAAGAAATGTGTCAGG - Intergenic
1015979416 6:138823908-138823930 CTTATAATAAAGAATGGGTTGGG + Intronic
1016910542 6:149194388-149194410 CTTAAAATAATACAGGTGGCCGG + Intergenic
1018549136 6:164974610-164974632 CTTGTTATACAACATGTCTCTGG + Intergenic
1018616775 6:165694258-165694280 CTTATAATTAAACAATTCTCAGG + Intronic
1019407458 7:891212-891234 CTTATGAAAAATCATGGGTCAGG - Intronic
1019457644 7:1138709-1138731 GTTATAATAATGCTTGTGTCCGG + Intergenic
1019962396 7:4471833-4471855 TGTATAATAAAACATAAGTCAGG + Intergenic
1021054356 7:16028574-16028596 ATTATAATAATATATGTGTTAGG + Intergenic
1021372225 7:19862929-19862951 CTTATAAAAAATCAAGTATCTGG - Intergenic
1021988628 7:26121171-26121193 ATTAAAATACATCATGTGTCAGG - Intergenic
1022435817 7:30383866-30383888 CCTATAATAAAACAGCTATCAGG + Intronic
1023164082 7:37325634-37325656 GTTAGAATAAAGCATCTGTCAGG - Intronic
1024513657 7:50223876-50223898 CTTAGAAGAAAACATGTGAGTGG + Intergenic
1024762164 7:52611708-52611730 CTTATAATAAAATATGAGAGAGG - Intergenic
1024831299 7:53461662-53461684 CCTATAATCAAACATTTTTCTGG - Intergenic
1026291995 7:69015629-69015651 TTCATAATAAAATATGTTTCTGG - Intergenic
1026640607 7:72121684-72121706 GTAATAATCAAACATGTTTCTGG - Intronic
1028000931 7:85497546-85497568 ATTTTAATATAAAATGTGTCTGG + Intergenic
1028635575 7:92985395-92985417 TTTAAAATAAAACATGTTCCTGG - Intergenic
1031122937 7:117741980-117742002 CTCATCATATAACATGTGTGTGG + Intronic
1035788931 8:2286105-2286127 CCTATAAGAAAACATGTGGTGGG - Intergenic
1035803874 8:2435600-2435622 CCTATAAGAAAACATGTGGTGGG + Intergenic
1036927384 8:12920338-12920360 CTTAAAATAAAGCCTGTGGCTGG + Intergenic
1036940863 8:13050376-13050398 CATATAATAAATTATGTGACTGG - Intergenic
1038915600 8:32018112-32018134 GATATTATAAAACATGTATCTGG - Intronic
1042749630 8:72144185-72144207 CTGATAATATTACATGTGGCAGG + Intergenic
1044766019 8:95575408-95575430 CTTATAATTATAAATGTGTTTGG + Intergenic
1044864224 8:96554191-96554213 TTTCTTATAAAACATGTATCTGG - Intronic
1047167872 8:122460953-122460975 ATAATAATAAAACATGTTGCCGG + Intergenic
1047290475 8:123525148-123525170 CTTAAACTAAAACATGTTTTTGG + Intronic
1047351136 8:124075460-124075482 CTTATAATAACACCTTTTTCTGG + Intronic
1047594736 8:126366697-126366719 CTTAAAATGACACATGTGGCTGG - Intergenic
1047919737 8:129622393-129622415 CTTATAAGTAAACAAGTGTGGGG + Intergenic
1051798326 9:20901629-20901651 CTTGTAGTAAAACATGTATGAGG + Intronic
1055475125 9:76655604-76655626 CTTAAAATAAACCATGTATGGGG + Intronic
1055786416 9:79873866-79873888 CTCATTATAAACCATGTGTAAGG + Intergenic
1055828015 9:80349846-80349868 CTCATTATAAACCATGTGTAGGG - Intergenic
1055941734 9:81656677-81656699 TTGTTAATCAAACATGTGTCAGG + Intronic
1202790128 9_KI270719v1_random:80713-80735 CTCTTAAAAAAACATTTGTCAGG - Intergenic
1185946821 X:4386034-4386056 CTTATAATTAAGCATGAATCAGG - Intergenic
1185987542 X:4852561-4852583 CATATAAAAAAGCATGGGTCTGG - Intergenic
1186306257 X:8262563-8262585 ATTATAAAAAAACAGGTGGCCGG + Intergenic
1188872625 X:35392289-35392311 CTTATAGTAAATGAAGTGTCAGG - Intergenic
1189065474 X:37803853-37803875 TATAGAATAAAACATATGTCTGG - Intronic
1190080094 X:47349901-47349923 ATTATAATAAAACTTTTGCCGGG - Intergenic
1192161189 X:68789160-68789182 TTTATAATAAAGCATGAATCAGG - Intergenic
1193672544 X:84406591-84406613 CTTTTAAAAATACCTGTGTCTGG - Intronic
1193832378 X:86304956-86304978 CTGAGAATAAAACATTTGTTTGG + Intronic
1195123748 X:101783683-101783705 ATTATATTAAATCATGTGCCAGG + Intergenic
1195726363 X:107921507-107921529 CTGATAATAAAACAAGGGTGGGG - Intronic
1198939322 X:141935435-141935457 ATTATAAAAAAAGATTTGTCAGG + Intergenic
1199062791 X:143378456-143378478 TTTTTAATAAAAAATGTATCTGG + Intergenic
1199417132 X:147598263-147598285 TTTTTCATAAAACATGTGCCAGG - Intergenic
1199499129 X:148490041-148490063 TTCATAATAAAACATTTTTCAGG + Intergenic
1201539811 Y:15093851-15093873 TTTATAATTAAGCATGAGTCAGG - Intergenic
1201577422 Y:15476242-15476264 CTTCTATGAAAACAGGTGTCAGG + Intergenic
1201757627 Y:17503634-17503656 CATTTACTAAAAAATGTGTCTGG + Intergenic
1201843927 Y:18402348-18402370 CATTTACTAAAAAATGTGTCTGG - Intergenic