ID: 936703805

View in Genome Browser
Species Human (GRCh38)
Location 2:115045580-115045602
Sequence AGGGTGAGTGCAGTGATTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 20, 3: 75, 4: 365}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936703805_936703812 27 Left 936703805 2:115045580-115045602 CCCGCAATCACTGCACTCACCCT 0: 1
1: 0
2: 20
3: 75
4: 365
Right 936703812 2:115045630-115045652 TGCCATGTGGTCCAGACCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 184
936703805_936703810 25 Left 936703805 2:115045580-115045602 CCCGCAATCACTGCACTCACCCT 0: 1
1: 0
2: 20
3: 75
4: 365
Right 936703810 2:115045628-115045650 TGTGCCATGTGGTCCAGACCAGG 0: 1
1: 0
2: 0
3: 23
4: 200
936703805_936703811 26 Left 936703805 2:115045580-115045602 CCCGCAATCACTGCACTCACCCT 0: 1
1: 0
2: 20
3: 75
4: 365
Right 936703811 2:115045629-115045651 GTGCCATGTGGTCCAGACCAGGG 0: 1
1: 0
2: 0
3: 12
4: 125
936703805_936703809 14 Left 936703805 2:115045580-115045602 CCCGCAATCACTGCACTCACCCT 0: 1
1: 0
2: 20
3: 75
4: 365
Right 936703809 2:115045617-115045639 GATTTTCTTTCTGTGCCATGTGG 0: 2
1: 1
2: 14
3: 68
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936703805 Original CRISPR AGGGTGAGTGCAGTGATTGC GGG (reversed) Intronic
900427177 1:2586196-2586218 AGGGTGAGCGCAGGGGTCGCGGG - Intergenic
901468360 1:9438230-9438252 AGGCTGAGTGCGGTTACTGCTGG + Intergenic
901859962 1:12068023-12068045 AGCTTGAGAGCAGTGAGTGCCGG + Intronic
903050460 1:20596666-20596688 AGAGTGGGTGCAGTGCTTTCTGG + Intronic
904384495 1:30132519-30132541 AGGGTGAATGATGTGAGTGCTGG - Intergenic
904936832 1:34136908-34136930 AGGGTGAATGCATGGATGGCAGG - Intronic
904955968 1:34284153-34284175 ATGGTGAGTGGAGTGAGAGCTGG + Intergenic
905261325 1:36721382-36721404 GGGGTGAGTGGAGTGAGGGCTGG - Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910685738 1:89914297-89914319 AGGCTGCGTGCTGTGCTTGCGGG - Intronic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912179687 1:107204800-107204822 AGGGTATGTACAGAGATTGCAGG - Intronic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912721950 1:112027919-112027941 AGCATGAGTACAGTAATTGCAGG - Intergenic
912855581 1:113166184-113166206 AAGGTGACTGAAGTGATTGAAGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913336740 1:117715863-117715885 TGGGTGAGTGCTGTAACTGCTGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916115017 1:161479063-161479085 GGGCTGTGTGCAGTGCTTGCAGG + Intergenic
916676262 1:167066499-167066521 AGGGTGAGAGCAGGGGTTCCTGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
920218845 1:204380627-204380649 ACTGGGAGTGCACTGATTGCTGG - Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921883227 1:220277105-220277127 GGGGTGAGAGCAGTGAGAGCAGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
923215645 1:231845685-231845707 AAGGTGAGTGAAGTGATGGATGG + Intronic
924250901 1:242132173-242132195 AAAGAGAATGCAGTGATTGCGGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
924560887 1:245155879-245155901 AGGGGGAGGGCTGTGATTTCAGG - Intronic
924883304 1:248187017-248187039 TGGGTGAGGCCCGTGATTGCTGG - Intergenic
1064483858 10:15765618-15765640 AGGGTGAGGGAAGTGCTTGGGGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065894605 10:30152243-30152265 AGGGTGAGGCCTGTGACTGCTGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066544273 10:36482335-36482357 GGGCTGTGTGCAGTGCTTGCGGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069555898 10:69398489-69398511 TGGATGAGTACAGTGATTGGGGG + Intronic
1071103074 10:82061645-82061667 AGAGTGAGCTCAGTGAATGCTGG + Intronic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075982778 10:126755688-126755710 TGGGTGAGGACAGTGACTGCTGG - Intergenic
1076137053 10:128052380-128052402 GGGGTCAGTACAGTGAATGCTGG + Intronic
1076913239 10:133402771-133402793 TGGGTGAGTGCAGTGAATGCAGG + Exonic
1078214217 11:9297871-9297893 AGGGTGGGTGCTGGGATTACAGG - Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1082125735 11:48429392-48429414 AAGCTGAGAGCAGTGCTTGCAGG - Intergenic
1082231069 11:49767232-49767254 AGAGTGAGTGCTGGGATTACAGG - Intergenic
1082250692 11:49976819-49976841 AAGGTGAGAGCAGTGCTTGTAGG + Intergenic
1083273264 11:61582704-61582726 AGGGTGAGGGCTGAGATTTCTGG - Intergenic
1083864008 11:65443826-65443848 TGGCTGAGTGCAGTGGTTCCTGG + Intergenic
1084423505 11:69072056-69072078 AGGGTGGGTGCTGTGGCTGCTGG + Intronic
1084440416 11:69169589-69169611 AGGGAGAGTCCATGGATTGCAGG + Intergenic
1085004872 11:73077955-73077977 AGAGTGAGGGCAGTAATGGCAGG + Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085747797 11:79129588-79129610 TGGGTGAGGCCTGTGATTGCTGG + Intronic
1086618980 11:88861739-88861761 AGAGTGAGTGCTGGGATTACAGG + Intronic
1087327263 11:96738936-96738958 GGGGTGAGTGAAGTGACAGCAGG - Intergenic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1088237581 11:107742026-107742048 GGGGTGAGTGAAGTGATGGCGGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1093422881 12:18995286-18995308 AAGTTGACTGAAGTGATTGCTGG - Intergenic
1094270385 12:28608164-28608186 AGGTTGAGTGCTGTGATTTTGGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096548948 12:52359732-52359754 AGGGTGAGAGCAGTGAGTTTGGG + Intergenic
1096558246 12:52417495-52417517 AGGGTGAGTGGAGTGCCTCCAGG - Intergenic
1098287013 12:68917590-68917612 AGGGTCATTGCTGTGACTGCAGG - Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099860386 12:88218505-88218527 AGGCTGACTGCACTGATTGATGG + Intergenic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1101635292 12:106535556-106535578 TGGGTGAGGGCTGTGACTGCTGG - Intronic
1106340889 13:28825311-28825333 AGGGTGACTGCAGGGAATCCAGG - Intronic
1107606808 13:42065580-42065602 AGGGTGTGTGGAGTAATTGAGGG + Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108298744 13:49053006-49053028 AGGGTGAGGCCTGTGAGTGCCGG - Intronic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113460613 13:110479565-110479587 AGGTTGGGAGCAGTGAATGCTGG + Intronic
1114836451 14:26208377-26208399 ACGGTGAGTGCTGAGATGGCCGG - Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116490920 14:45502193-45502215 AGGGTGACTGCAGTAACTGCAGG + Intergenic
1117052187 14:51872021-51872043 CAGGTGAGTGCAGTGGTTGAAGG + Intronic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119162881 14:72467820-72467842 AGGAGGGGTGCTGTGATTGCTGG - Intronic
1119648559 14:76366911-76366933 ACAGTGAGTACAGTGATTGATGG - Intronic
1120613046 14:86666186-86666208 GGGGTTAGTGCATTGATGGCTGG - Intergenic
1121162343 14:91755443-91755465 AGGTTGTCTTCAGTGATTGCAGG - Intronic
1121409198 14:93737703-93737725 AGGGTGGGGGCAGGGATGGCCGG - Intronic
1122115880 14:99526997-99527019 AGGGAGAGTGCAGAGAAAGCAGG + Intronic
1122593625 14:102873163-102873185 CAGGTGAGTGCAGTGATTTGAGG + Intronic
1123055477 14:105567316-105567338 AGCGTGTGTGCAGTGAGTGGTGG + Intergenic
1123079928 14:105687156-105687178 AGCGTGTGTGCAGTGAGTGGTGG + Intergenic
1124888927 15:33713477-33713499 AGGGTGAGTGTGGTGAATGATGG + Intronic
1125263410 15:37852580-37852602 ATGGTGAGTTCAGGGATTTCAGG + Intergenic
1126660829 15:51031470-51031492 AGAGGGACTGCAGTGATTGTGGG - Intergenic
1126979948 15:54229156-54229178 AGAGAGAATGCAGTAATTGCAGG - Intronic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1129556456 15:76515286-76515308 AGGGTGAGTGCAGTAACTGAAGG + Intronic
1129999827 15:80036814-80036836 AGGGTCATTGCAGGGGTTGCTGG - Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132097678 15:99000071-99000093 GGGCTGCGTGCAGTGCTTGCGGG + Intronic
1132407997 15:101556256-101556278 AGGGTAGGTGCAGTGAGTCCTGG + Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1135101908 16:19613426-19613448 AGGGTTAGTGCAGGCATGGCTGG + Intronic
1135943763 16:26845675-26845697 AGGGTCTGTGCAGGGTTTGCTGG - Intergenic
1136109076 16:28053421-28053443 TGGGTGGGTGCAGTGTTTGGAGG - Intronic
1138797991 16:59993310-59993332 TGGGTGAGTCCTGTGACTGCTGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140722555 16:77784716-77784738 GGGCTGCGTGCAGTGCTTGCGGG - Intergenic
1142417660 16:89951670-89951692 GGGGAGAGTGACGTGATTGCAGG - Intronic
1143119295 17:4597142-4597164 AGGGTGAGTGGGGTCAGTGCGGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143782992 17:9239276-9239298 CGGGTGAGAGCAGTGCTGGCGGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146177827 17:30677873-30677895 AAGGTGATTGCAGGGAGTGCTGG - Intergenic
1146466756 17:33092314-33092336 AGAGTGAGGGCAGGGACTGCAGG - Intronic
1146803236 17:35844315-35844337 AGGCTCATTGCACTGATTGCAGG - Exonic
1146852560 17:36235766-36235788 ATGCTGGGTGCAGTGAATGCTGG - Intronic
1146868473 17:36359638-36359660 ATGCTGGGTGCAGTGAATGCTGG - Intronic
1147071345 17:37960262-37960284 ATGCTGGGTGCAGTGAATGCTGG - Intergenic
1147082872 17:38039788-38039810 ATGCTGGGTGCAGTGAATGCTGG - Intronic
1147098815 17:38163759-38163781 ATGCTGGGTGCAGTGAATGCTGG - Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150080348 17:62232801-62232823 ATGCTGGGTGCAGTGAATGCTGG - Intergenic
1152643229 17:81457782-81457804 AGGGGGAGGGCAGGGGTTGCTGG + Intronic
1152643324 17:81458023-81458045 AGGGGGAGGGCAGAGGTTGCTGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1156943141 18:42795270-42795292 GGGCTGCGTGCAGTGCTTGCGGG + Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1162980665 19:14237375-14237397 AAGGTGATTGCAGGGAGTGCTGG + Intergenic
1163870433 19:19816751-19816773 AGGCTGAGTGCTGGGATTACAGG + Intronic
1165486804 19:36101315-36101337 AGGGTGAGTGCAGGGCAGGCAGG + Exonic
1166899603 19:46049476-46049498 TGGGTGAGGTCTGTGATTGCTGG + Intronic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925870812 2:8268693-8268715 AGGGAAAGTGCAGGCATTGCTGG - Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927070169 2:19520246-19520268 TGGGTGGGGGCAGTCATTGCAGG + Intergenic
927176839 2:20415795-20415817 GGGGTGAGGTCTGTGATTGCTGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930593094 2:53353548-53353570 AGGGTGAGTCCTGTGACTGCTGG + Intergenic
930615898 2:53593100-53593122 TGGTTGAGTGCAGAGATTGTTGG - Intronic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930897572 2:56463838-56463860 GGGGTGTGTGAAGTGATGGCAGG + Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931525242 2:63145543-63145565 TGGGTGAGGCCAGTGACTGCCGG - Intronic
931549180 2:63424075-63424097 GGGGTGAGTGAAGTGATGGCAGG + Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
934039809 2:88118414-88118436 AGAGTAAGTACAGTGATTGGTGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935924257 2:108050418-108050440 AGGGTGAATGGAGTCACTGCTGG - Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936701035 2:115011989-115012011 AGGGTGAGGCCTGTGACTGCTGG + Intronic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936730120 2:115372797-115372819 AGAATGAGTGCAGTTATTCCTGG + Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937156402 2:119722761-119722783 GGGGTGAGTGCAGTGCTTGCCGG + Intergenic
937336172 2:121063635-121063657 AGGGTGACTGCTGCGGTTGCAGG - Intergenic
938809865 2:134843213-134843235 AGGGTGAGAGCAGGGGTTGAGGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943698222 2:190959678-190959700 TTGGTGAGGACAGTGATTGCTGG + Intronic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169189624 20:3649953-3649975 AGGCTGTGTGCAGGGATGGCAGG - Exonic
1169500785 20:6158400-6158422 GGAGTGAGTGAAGTGATGGCAGG - Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170485032 20:16807275-16807297 AGAAAGAGTTCAGTGATTGCAGG - Intergenic
1170997714 20:21380131-21380153 AGGGTAACCGCAGTGATTCCAGG + Intronic
1171489066 20:25503902-25503924 AGAGTGACAGCAGTGGTTGCTGG + Intronic
1171785347 20:29458747-29458769 AGCATCAGGGCAGTGATTGCTGG - Intergenic
1175552519 20:59826546-59826568 AGGGTGTGTGCAGAGACAGCAGG - Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177127709 21:17216969-17216991 AGGGTGAGGCCTGTGACTGCCGG + Intergenic
1177222330 21:18210291-18210313 AGGGGAAGTGCCGTGATTGTGGG - Intronic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178732843 21:35120613-35120635 AGGGTGAGGCCTGTGATTGCTGG + Intronic
1179276829 21:39899579-39899601 AGGGTGAGTGCAGTGTTCCCTGG + Intronic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1181010503 22:20037600-20037622 AGGCTGAGTGAAGTCATTTCAGG + Intronic
1181669319 22:24418813-24418835 AGGGAGAGTGGAGAGATTCCAGG + Intronic
1184676584 22:46046240-46046262 AGGGTGTTTGCAGTGACGGCAGG + Intergenic
1185204688 22:49531099-49531121 GGGGTGGGTGCAGGGCTTGCAGG - Intronic
949661361 3:6283176-6283198 AGGCTGAGTGAAGCGATGGCAGG + Intergenic
950950345 3:16992282-16992304 AGGGTGAAGGCACTGATGGCTGG - Intronic
951024890 3:17818023-17818045 GGGCTGCGTGCAGTGCTTGCGGG - Intronic
951024969 3:17818333-17818355 GGGCTGCGTGCAGTGCTTGCGGG - Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952859843 3:37803940-37803962 AAGGTGAGTCTGGTGATTGCAGG + Exonic
953948616 3:47170335-47170357 AGGATGAGTGGAGTGATGGTTGG + Intergenic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956383645 3:68693029-68693051 GGAGTGAGTGCAGTGAGTGCAGG - Intergenic
957141941 3:76370975-76370997 AGGGTGAGTGCAATGAGAGAAGG - Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957971697 3:87390622-87390644 AGGGTGAGGCCTGTGACTGCCGG + Intergenic
958108465 3:89107667-89107689 AGGGGGAGCGCTCTGATTGCTGG - Exonic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959714600 3:109418511-109418533 AGGCTGGGTGCAGTGATTACAGG - Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
961932348 3:130547399-130547421 GGGCTGTGTGCAGTGCTTGCAGG - Intergenic
962129615 3:132659474-132659496 AGGGTGCGTCCACTGACTGCAGG + Exonic
962147444 3:132855380-132855402 AGGGTGAGGCCTGTGACTGCTGG - Intergenic
962923213 3:139969561-139969583 CAGGTGGGTGCAGTGATGGCAGG - Intronic
963192874 3:142492886-142492908 AGGGTGAGAATAGTGATTACTGG + Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964393134 3:156218198-156218220 GGGGTGAGGCCAGTGACTGCTGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965216904 3:165874995-165875017 TGGGTGAGGCCTGTGATTGCCGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968543298 4:1179234-1179256 AGAGTGAGTGCTGTGTTTGCTGG - Intronic
969611344 4:8229254-8229276 AGGGTGAGTGGTGTGATGGCGGG + Intronic
970658649 4:18260325-18260347 TGGGTGAGGCCTGTGATTGCCGG - Intergenic
970854690 4:20638193-20638215 AGGCTGAGAGCAGAGACTGCAGG - Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975203078 4:71614694-71614716 AGGGTGAGGCCTGTGACTGCTGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977535521 4:98252542-98252564 AGGTTGAGTGATGTGACTGCTGG + Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980682802 4:136186554-136186576 AGGGAGAGTGTAATAATTGCAGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981394597 4:144233255-144233277 AGGGACAGTGCATTGATTGAGGG + Intergenic
981559703 4:146033436-146033458 TGGGTGAGGCCAGTGACTGCTGG + Intergenic
981760812 4:148192767-148192789 AGGGTGAGGCCTGTGACTGCCGG - Intronic
982036970 4:151355299-151355321 AGGCTGAGTGCACTAATTTCAGG + Intergenic
982126487 4:152188335-152188357 AGCGAGAGTCAAGTGATTGCAGG - Intergenic
982948523 4:161658928-161658950 AGGGTTAGTGAAGAGATTCCAGG - Intronic
983380568 4:166986946-166986968 AGGGTGAGGGCAGTAACTCCTGG - Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
985908980 5:2864230-2864252 AGGGTGGGTGCAGGGGCTGCCGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987640109 5:20601673-20601695 AGGGTGAGCCCTGTGACTGCCGG + Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
989278311 5:39613372-39613394 AAGTTGAGTGCAGTGCTTGCTGG + Intergenic
990131501 5:52591368-52591390 AGGGTGTGGGAAGTGATTTCTGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
994051323 5:95365763-95365785 TGGGTGAGGGCTGTGACTGCTGG - Intergenic
994292842 5:98050517-98050539 AGAACAAGTGCAGTGATTGCAGG + Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995278760 5:110308617-110308639 AGGGTGAGAGCAGTGAGTTGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
997725143 5:136114042-136114064 AGGGTGAGGGCAGGGATGGAGGG - Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999917003 5:156273713-156273735 AGTGGGAGGGCAGTCATTGCTGG + Intronic
1001086693 5:168705168-168705190 TTGGCAAGTGCAGTGATTGCAGG - Intronic
1002212478 5:177607176-177607198 AGGCTGAGTGAAGTCAGTGCTGG + Intronic
1004051645 6:12086569-12086591 ACGGTGAGAGATGTGATTGCTGG + Intronic
1005978272 6:30816635-30816657 GGGCTGCGTGCAGTGCTTGCGGG - Intergenic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1007270798 6:40635491-40635513 ATGGTGAGTGCAGGGACTTCAGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010666080 6:78630979-78631001 AGGTTGAGTGCAGTTATGGCAGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011029163 6:82902581-82902603 AAGGACAGAGCAGTGATTGCAGG + Intronic
1011133165 6:84072862-84072884 TGGGTGAGTCCTGTGACTGCTGG - Intronic
1011195706 6:84777204-84777226 TGGGAGAGAGCAGTGAGTGCTGG + Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1013901024 6:115156313-115156335 TGGGTGAGGCCTGTGATTGCTGG - Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1014336806 6:120147361-120147383 TGGGTGAGGCCAGTGACTGCTGG + Intergenic
1014482061 6:121951107-121951129 AGGGTGAGGCCTGTGACTGCCGG - Intergenic
1015309881 6:131754993-131755015 AGCGTGAGTCCACTGATTGAAGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016012259 6:139149576-139149598 AGGGAGTTTGCAGTGAATGCCGG + Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016794967 6:148108164-148108186 AGGGTGAGTGTGGTTATTTCTGG - Intergenic
1016997932 6:149974162-149974184 ATGGTGAGTCCAGTGTTTTCTGG - Intergenic
1017000335 6:149992052-149992074 ATGGTGAGTCCAGTGTTTTCTGG + Intergenic
1017326433 6:153146114-153146136 GGGGTGAGGCCAGTGACTGCTGG - Intergenic
1017823728 6:158066633-158066655 AGGGTGAGGGCAGTGACTTTGGG + Exonic
1018243222 6:161798913-161798935 AGGGTGAGGGCAGTGTGTGGGGG - Intronic
1018335986 6:162790333-162790355 GGGGTGAGTGGGGTGAGTGCGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024545460 7:50513678-50513700 TGGGTGAGGGCTGTGACTGCTGG + Intronic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025256974 7:57390682-57390704 GGGCTGAGTGCTGGGATTGCAGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028197727 7:87926769-87926791 AGGGTGAGGTCTGTGATTGCTGG + Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029671076 7:102031319-102031341 AGAGTGAGTGCTGGGATTACAGG + Intronic
1030067494 7:105671549-105671571 CGGGTGAGAGCAGAGGTTGCTGG - Intronic
1030393625 7:108957982-108958004 AAGGTGATGGCAGTGAATGCAGG + Intergenic
1030533450 7:110737384-110737406 AGGGTGAGGCCTGTGACTGCTGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031682778 7:124695162-124695184 CCAGTGAGTGCAGTGATTTCAGG + Intergenic
1031740091 7:125418671-125418693 TGGGTGAGGCCTGTGATTGCCGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1033315014 7:140289924-140289946 GGGCTGAGTGCCGTCATTGCTGG - Intergenic
1033449405 7:141449346-141449368 AGGATGGGGGCATTGATTGCAGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035062788 7:156081524-156081546 GGGGGTAGTGCAGTGACTGCCGG + Intergenic
1035300739 7:157895915-157895937 AGGGTGAGCACAGAGACTGCAGG + Intronic
1035574432 8:695901-695923 AGGGTGAGAGGAGCGAGTGCAGG - Intronic
1035574443 8:695950-695972 AGGGTGAGAGGAGCGAGTGCAGG - Intronic
1035574495 8:696164-696186 AGGGTGAGAGGAGCGAGTGCAGG - Intronic
1035574553 8:696429-696451 AGGGTGAGAGGAGCGAGTGCAGG - Intronic
1037911368 8:22745605-22745627 AGGGTGAGGGGAGGGAATGCTGG - Intronic
1038367229 8:26948534-26948556 TGGGTGAGAGCTGTGATTACTGG - Intergenic
1038638245 8:29304276-29304298 GGGCTGCGTGCAGTGCTTGCGGG + Intergenic
1038908734 8:31937722-31937744 GGGGTGAGGCCTGTGATTGCTGG + Intronic
1038993924 8:32900640-32900662 AAGATGAGTGCAGAGATTGGGGG - Intergenic
1040292147 8:46131004-46131026 GGTGAGACTGCAGTGATTGCTGG - Intergenic
1040293512 8:46137491-46137513 AGAGAGACTGCAGGGATTGCTGG - Intergenic
1040300072 8:46183398-46183420 AGTGAGACTGCAGTGAATGCTGG - Intergenic
1040315164 8:46257131-46257153 AGGGAGACTGCAGGGAATGCTGG + Intergenic
1041878006 8:62712524-62712546 TGGGTGAGGCCTGTGATTGCTGG - Intronic
1043040772 8:75259534-75259556 AGGGTGAGGCCTGTGACTGCCGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043819704 8:84847288-84847310 AGGCTGAGTGAAGTGACTGTGGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044949830 8:97424964-97424986 AGGGTCAGTGCAGTGATTAAGGG + Intergenic
1045779805 8:105849681-105849703 AGGGTGAGGCCTGTGACTGCTGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048456479 8:134583156-134583178 AAGGTAAGTGCAGTGATGGAGGG - Intronic
1049500162 8:142958715-142958737 AGGGTGTCTGCAGTGATGGAAGG - Intergenic
1050751114 9:8938495-8938517 AGGGTGTGTGCCTTGATTTCTGG + Intronic
1050878636 9:10673455-10673477 AAGCTGAGTGCAGGGAGTGCAGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052250798 9:26394616-26394638 GGGGTGAGTGAAGTCACTGCAGG - Intergenic
1052985383 9:34483102-34483124 GGGCTGAGTGCGGTGCTTGCGGG - Intronic
1054931480 9:70639912-70639934 CCGGTGAGTGCTGTGATTCCAGG + Intronic
1056790080 9:89619662-89619684 AGGGAAGGTGCAGTGAATGCTGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057976803 9:99613218-99613240 AGCCTGAGTGCCGTGATTGAGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058522918 9:105829442-105829464 AGGGAGACAGCACTGATTGCAGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1061256528 9:129456793-129456815 AGGGTGAGTGCATAGATAGGTGG + Intergenic
1061403592 9:130381850-130381872 GGGGTGACAGCAGTGGTTGCTGG - Intronic
1062120534 9:134831670-134831692 AGGCTGAGAGCTGTCATTGCGGG - Intronic
1062201379 9:135304568-135304590 AGGGTGAGTGGAGGGATGGAGGG + Intergenic
1062573539 9:137196240-137196262 GGGTGGAGTGCAGGGATTGCAGG - Intronic
1203446126 Un_GL000219v1:57978-58000 AGCATCAGGGCAGTGATTGCTGG - Intergenic
1187219216 X:17307859-17307881 TGGGTGAGACCTGTGATTGCCGG - Intergenic
1187588826 X:20693382-20693404 AGGGTGAGGCCTGTGACTGCAGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188451569 X:30312393-30312415 AGGGTCAGCGCAGCGATAGCTGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1190224236 X:48533335-48533357 AGAGTGAGTGAAGTGATTAGGGG - Intergenic
1190405362 X:50081413-50081435 AGGGGGAGGGGAGTGATAGCTGG - Intronic
1190440129 X:50468992-50469014 AGGGAGAGTGCAGAGAAAGCAGG + Intronic
1190877135 X:54467988-54468010 AGGGTGAGGGCAGTATTTGTGGG + Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193680992 X:84518758-84518780 TGGGTGAGGGCCGTGACTGCAGG - Intergenic
1193747364 X:85298430-85298452 TGGGTGAGTGAAGTGACAGCAGG - Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195765266 X:108289715-108289737 AGGGAGAGAGAAGTGAGTGCAGG - Intronic
1196025063 X:111033434-111033456 AAGGTGAGTGCAGTCAATGTGGG - Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic