ID: 936704975

View in Genome Browser
Species Human (GRCh38)
Location 2:115061343-115061365
Sequence AAAAGCCATTTGGCCAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936704975_936704977 11 Left 936704975 2:115061343-115061365 CCAAAATTGGCCAAATGGCTTTT 0: 1
1: 0
2: 0
3: 20
4: 226
Right 936704977 2:115061377-115061399 TTTCCAGTTATTCTTTGTGATGG 0: 1
1: 0
2: 3
3: 46
4: 566
936704975_936704980 18 Left 936704975 2:115061343-115061365 CCAAAATTGGCCAAATGGCTTTT 0: 1
1: 0
2: 0
3: 20
4: 226
Right 936704980 2:115061384-115061406 TTATTCTTTGTGATGGAAAAGGG 0: 1
1: 0
2: 9
3: 40
4: 485
936704975_936704979 17 Left 936704975 2:115061343-115061365 CCAAAATTGGCCAAATGGCTTTT 0: 1
1: 0
2: 0
3: 20
4: 226
Right 936704979 2:115061383-115061405 GTTATTCTTTGTGATGGAAAAGG 0: 1
1: 0
2: 3
3: 24
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936704975 Original CRISPR AAAAGCCATTTGGCCAATTT TGG (reversed) Intronic
900281226 1:1870673-1870695 AAAAGCCATTTTAGCACTTTGGG + Intronic
900728297 1:4233435-4233457 AAAATCCCTTTGGTCAACTTGGG - Intergenic
902060905 1:13641725-13641747 AAAAGTCATCTGACAAATTTAGG - Intergenic
902971862 1:20059444-20059466 AAAGACCATATGGCCATTTTAGG + Intronic
907129513 1:52083254-52083276 AAAAGCAATTCAGCCAATTATGG - Intronic
907339851 1:53727150-53727172 AAAAGCCATGTGGCCGCCTTTGG + Intronic
908966402 1:69769902-69769924 AAAAACCAACTGGCCATTTTAGG + Intronic
910191128 1:84596919-84596941 AAAAGTCATTTTGCCTGTTTAGG - Intergenic
911568352 1:99491919-99491941 AAATGCCAGTAGGCCAGTTTGGG - Intergenic
912580660 1:110718188-110718210 GAAAGCCATTTGGAGAAGTTTGG - Intergenic
914385736 1:147168107-147168129 ATAGGCCATTTGACCATTTTTGG - Intronic
917377821 1:174368685-174368707 AATAGCCATTTGTCAAATGTTGG + Intronic
918056993 1:181030421-181030443 AAAATCCATTTGCCAATTTTTGG - Intergenic
918136843 1:181681358-181681380 AAAACCCACTTGGCCATCTTGGG + Intronic
922321060 1:224487492-224487514 AAAAACCATTTCTCCACTTTGGG - Intronic
922418191 1:225441145-225441167 GAAAGACATTTTTCCAATTTAGG - Intergenic
1062808149 10:440448-440470 ACAAGCAAATTGGACAATTTAGG - Intronic
1063217292 10:3936454-3936476 AGATCCCATTAGGCCAATTTAGG + Intergenic
1063947978 10:11195884-11195906 AAAAGCCATGTTTCCAACTTAGG - Intronic
1064132530 10:12722629-12722651 AATAGCCATTTGGCAAATGTTGG + Intronic
1064594963 10:16934680-16934702 AGAGGCCATTTGACCAGTTTTGG + Intronic
1064856445 10:19773581-19773603 AAAAGTTTTTTGGCCCATTTAGG + Intronic
1065045286 10:21742545-21742567 TAATGGGATTTGGCCAATTTTGG + Exonic
1068458036 10:57285563-57285585 ATAAGCCACATGGCCAATTTTGG - Intergenic
1068775178 10:60861306-60861328 AAATTCCATTTGACCAATATCGG - Intergenic
1069474102 10:68718044-68718066 AAAAGCCCTTTGGCCAAGCGCGG + Intergenic
1070298041 10:75181562-75181584 AAAAGTCCTTTGGTTAATTTAGG - Exonic
1071478426 10:86044334-86044356 AAAAGCCATTAAGCCAATGCTGG - Intronic
1071906045 10:90174705-90174727 TAAAACTTTTTGGCCAATTTCGG - Intergenic
1072814262 10:98489226-98489248 AAAATCCATCTGGCCAAATATGG - Intronic
1073399631 10:103246033-103246055 AACAGCGACCTGGCCAATTTAGG + Exonic
1073520672 10:104126164-104126186 AAAAGTCATTTGGGCAGTTCTGG + Exonic
1074461504 10:113642260-113642282 AATAGCAAAGTGGCCAATTTTGG - Intronic
1074957622 10:118407799-118407821 ATAAGCCAATTGGCCCATTTAGG + Intergenic
1075009913 10:118858909-118858931 AACAGCCAATGGGCCAATTTTGG - Intergenic
1075800156 10:125148709-125148731 TGGAGCCATGTGGCCAATTTAGG + Intronic
1080320536 11:31004212-31004234 AAAATACTTTTGGCAAATTTTGG - Intronic
1080323794 11:31046623-31046645 AAAAGCCATATGTGCAATTAAGG + Intronic
1081066977 11:38555085-38555107 AACAGGCTTGTGGCCAATTTTGG + Intergenic
1081860386 11:46330179-46330201 AGGAGCCATTTGGCCAAACTGGG + Intergenic
1082818786 11:57529578-57529600 CATAACCATTTGGCAAATTTGGG - Intronic
1085586281 11:77710308-77710330 AAAATCTATTTGGCAATTTTAGG + Intronic
1085829603 11:79885309-79885331 ATAGGCAATTTGGGCAATTTGGG + Intergenic
1086251437 11:84819743-84819765 CAAAGCCATTTGGCTAAATCTGG - Intronic
1086279215 11:85166431-85166453 AAAAGCCAGGTAGCCAAATTGGG - Intronic
1091056431 11:132423673-132423695 GAAAAGCATTTGGCCAAGTTAGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1094537024 12:31330464-31330486 AAAATTCACTTGGGCAATTTAGG - Intergenic
1095545859 12:43369105-43369127 AAAAGCATCTTTGCCAATTTTGG - Intronic
1098423198 12:70326945-70326967 TAAGGCTATTTGGCCAATTAGGG - Intronic
1099078177 12:78138815-78138837 AAAAGCCATCTTGCCCACTTAGG - Intronic
1099262277 12:80398273-80398295 AAAAGCCATTTAGGCAATGGAGG - Intergenic
1100042090 12:90332283-90332305 AAAATCTATATAGCCAATTTTGG + Intergenic
1101277114 12:103214906-103214928 GAAAACTATTTGGACAATTTTGG - Intergenic
1102702977 12:114855838-114855860 AACAGTCAATTGGCCAAATTGGG - Intergenic
1104603384 12:130169054-130169076 AAAAGCCACTTGGCCAGTGTGGG + Intergenic
1105702200 13:22942038-22942060 AAAAGCCAGCTGGCCACTTCTGG - Intergenic
1105854818 13:24363823-24363845 AAAAGCCAGCTGGCCACTTCTGG - Intergenic
1109727340 13:66360039-66360061 AAAAGACATTTGGTCTATGTGGG + Intronic
1110953053 13:81519526-81519548 CAAAGCCAGTTGGCTTATTTTGG + Intergenic
1112051809 13:95650098-95650120 AACAGTCATTTGGCCACTCTCGG + Intergenic
1112235230 13:97630013-97630035 AAAAGCATTTGAGCCAATTTGGG - Intergenic
1114290660 14:21285794-21285816 AAAAGCCATTTGGAGACTTTTGG + Intergenic
1115225722 14:31099618-31099640 AAAAGCTATTTGGCTAAATCAGG + Intergenic
1115939449 14:38591909-38591931 AAAAGCCATTGGGCCATTGCGGG - Intergenic
1117125994 14:52626419-52626441 AAAAGGCATTTGACTAAATTTGG + Intronic
1118138721 14:63056338-63056360 AAGAGCCATTTGTTCACTTTTGG - Intronic
1119598934 14:75961525-75961547 AAAGGCCATTTAGCCAAATAAGG + Intronic
1119995220 14:79246234-79246256 AAAAGCCATTTGGCCTAGCCAGG + Intronic
1122325554 14:100879172-100879194 AACAGCCATTTTGCCACTTTGGG + Intergenic
1127748967 15:62013206-62013228 AAATGGCATTTGGGTAATTTTGG - Intronic
1129114845 15:73359566-73359588 CAAAGCCTTTGAGCCAATTTCGG - Intronic
1130603866 15:85297506-85297528 AAAAGCAATTTGGGCAAATCTGG - Intergenic
1130775640 15:86979238-86979260 AAAATCCATTATGACAATTTGGG + Intronic
1131355317 15:91740555-91740577 ATAAGCCATTCTGCCATTTTTGG - Intergenic
1135882795 16:26275500-26275522 AAAAGCTAATTGGCCCATATGGG - Intergenic
1136351867 16:29715317-29715339 CAAAGCCAATTGGCTTATTTTGG - Intergenic
1137541750 16:49367726-49367748 AAAAGACATTTAGGAAATTTGGG + Intergenic
1138849962 16:60615883-60615905 AAGATCCATTTGGTCAGTTTTGG + Intergenic
1140613211 16:76626218-76626240 AAAAGCCATTTCGTGATTTTTGG - Intronic
1142332673 16:89464945-89464967 AAAAGACATTGGGCCAGATTCGG - Intronic
1144309929 17:14004186-14004208 TAAAGCCAGTTGGCCAAATCTGG - Intergenic
1149312014 17:55403994-55404016 AGCAGGCATTTGGGCAATTTAGG + Intronic
1151135216 17:71940111-71940133 AAAAGGCATTGGTCCAAGTTAGG + Intergenic
1153309279 18:3662332-3662354 AAAAGCCTTTTTGTCTATTTTGG - Intronic
1157051114 18:44166358-44166380 AAAAGCCTTTTGATCATTTTGGG + Intergenic
1157866290 18:51188309-51188331 AAAAGCTGTTTGGCCAGTTGTGG + Intronic
1157958297 18:52123908-52123930 CAAAGACATTTTGCCAATCTTGG + Intergenic
1158275925 18:55767424-55767446 AAAAGACATTTGGCAATGTTCGG - Intergenic
1158422369 18:57306590-57306612 AAAAGCCTTTTGGTCTCTTTTGG + Intergenic
1158816750 18:61107978-61108000 AAAAGACATTTGACAAAATTTGG + Intergenic
1163120140 19:15212483-15212505 AAAAGCCACTTAGCCACTTCAGG + Intergenic
1164316654 19:24094547-24094569 AAAAGGCATTTGGCCAGGTAAGG - Intronic
1166651965 19:44581551-44581573 AAAAGCCATGTGGCTATCTTGGG - Intergenic
1167401882 19:49278259-49278281 AAAAGCCATTTGGCAAAATGCGG + Intergenic
1168055224 19:53860118-53860140 AAAAGCCATTTTGGCATTTCTGG + Intergenic
926003530 2:9353563-9353585 AAAAGACATTTGGGCAGTTGGGG + Intronic
926910860 2:17851481-17851503 AAAAAGCATCTGGCAAATTTGGG + Intergenic
927568267 2:24134563-24134585 AAAAGACATTTGAACATTTTGGG + Intronic
927816620 2:26223165-26223187 AACTGCCATCTGGCCACTTTGGG + Intronic
928482996 2:31702594-31702616 AAAAAGCATTTGACAAATTTTGG + Intergenic
929871929 2:45766394-45766416 AAAAGCCCTGTGGCCACTTGAGG + Intronic
929913981 2:46118331-46118353 ACAAGCTCTTTGGCCAACTTTGG - Intronic
930254678 2:49076789-49076811 AAAACAAATTTGGCCAATTTTGG + Intronic
933441205 2:82316641-82316663 AAAATCCATATGACAAATTTAGG - Intergenic
936704975 2:115061343-115061365 AAAAGCCATTTGGCCAATTTTGG - Intronic
937297195 2:120816838-120816860 AAAAGCCTTTTCGCCTAATTTGG + Intronic
937496364 2:122424407-122424429 TATAGCCAATTAGCCAATTTGGG - Intergenic
938716165 2:134023786-134023808 AAAACTCATTTCTCCAATTTTGG + Intergenic
939297287 2:140284064-140284086 ACAAGCCATTTGCCATATTTAGG + Intronic
939453490 2:142401806-142401828 AAAAGCCATTTTACAAAGTTTGG + Intergenic
940290250 2:152071394-152071416 AACAGCCATTTGCAAAATTTGGG + Intronic
941152434 2:161931406-161931428 AACAGCAACCTGGCCAATTTAGG - Intronic
941204688 2:162557362-162557384 ATAAGCTATTGGGCCAATTAAGG + Intronic
944803303 2:203257332-203257354 AAATTCCATTTGGTCAGTTTGGG + Intronic
945451787 2:210002698-210002720 AACAGCGACCTGGCCAATTTAGG + Exonic
945675772 2:212853864-212853886 ATAATTCATTTGGCCAAGTTAGG - Intergenic
945776130 2:214108556-214108578 AAGAGCCTTTTGTCCAATTTGGG + Intronic
945835310 2:214832831-214832853 AAATGCCACCTGGCCAAATTTGG - Intergenic
946009024 2:216549967-216549989 AAGAGCCATTTGGTCCATTTTGG - Intronic
946683352 2:222240743-222240765 AGAAGCCACTGGGCTAATTTGGG - Intronic
947330296 2:229022087-229022109 AAAAGCCATTTGCTCACCTTTGG + Intronic
1169506299 20:6214759-6214781 AAAAGGCATTTAGTCAGTTTGGG + Intergenic
1170828172 20:19814911-19814933 AAAATCCACTTGGCCATTTCTGG + Intergenic
1171088144 20:22257752-22257774 AAAACCCATTGGGGGAATTTTGG - Intergenic
1173129071 20:40370674-40370696 AAAAACCATTTGGCCAAACTAGG + Intergenic
1173336409 20:42115687-42115709 CAAGGCCATGTGGCCAGTTTGGG + Intronic
1173565111 20:44032825-44032847 AAAAGCAATTTGTCCCCTTTGGG - Intronic
1174131712 20:48349130-48349152 AAAAATGATTTGGACAATTTTGG + Intergenic
1177729705 21:25012396-25012418 AAAAGCCAATTGGCAATTTCCGG - Intergenic
1179009721 21:37546875-37546897 ACAAGCCACTTGACCAATCTGGG - Intergenic
1179057337 21:37948278-37948300 GAATCCCATTAGGCCAATTTAGG - Intergenic
1181153615 22:20902943-20902965 GGAAGCCAATTGGCCAGTTTAGG + Intergenic
1181235233 22:21444529-21444551 TAAAGCCATCTGGTCATTTTTGG + Intronic
1182144563 22:27989473-27989495 CAAAGCCATTTGTACCATTTGGG + Intronic
1183284821 22:36955085-36955107 TGGAGCCATTTGGCCCATTTGGG - Intergenic
1184631567 22:45784677-45784699 AATAGCCATGAGGTCAATTTGGG - Intronic
951128376 3:19011497-19011519 AAAAGACATTTGTTAAATTTTGG - Intergenic
951192932 3:19791267-19791289 AAAGACAATTTGGGCAATTTAGG + Intergenic
951512479 3:23518886-23518908 AAAAGCCATTTTGTGAATTTAGG + Intronic
951956902 3:28266941-28266963 GAAAGCGATTTGGCCATTCTAGG - Intronic
952015066 3:28946596-28946618 CAAAGCCATTTGGACCTTTTTGG + Intergenic
952377159 3:32777522-32777544 AAAAGGCTTTTGGCCATGTTTGG + Intergenic
953287159 3:41622228-41622250 AAATACCATTTGACCCATTTGGG + Intronic
956792584 3:72691690-72691712 GAAAGCCATTTGGTCAAGGTAGG + Intergenic
956894632 3:73647478-73647500 AAAAGTAATTTGGCATATTTGGG + Intergenic
963633936 3:147769467-147769489 AAAAAATATTTGGCCACTTTTGG + Intergenic
965188188 3:165492370-165492392 AAAAGCCATTTGTCTATATTAGG + Intergenic
965425680 3:168519623-168519645 AAAAGCCCTTTGGACAAGGTAGG + Intergenic
965473379 3:169123014-169123036 ACAAGCTATTTGTCCAGTTTTGG + Intronic
966016421 3:175144277-175144299 AAAAGCCATTGGGCACGTTTCGG + Intronic
966542360 3:181106294-181106316 AAAAGCCATTTCGTGAATTAGGG + Intergenic
969106744 4:4812105-4812127 AAAAACCTTTTGGCCAATCTGGG - Intergenic
969473971 4:7410605-7410627 AAAAGCCAATGGGACATTTTAGG - Intronic
970291849 4:14581647-14581669 AACAGCCATTTGGACAAATTTGG - Intergenic
970477593 4:16439417-16439439 ATAAGCCATTTTCCCAACTTGGG - Intergenic
970559386 4:17268005-17268027 AAAAGTCACTTGGCTAATTGGGG - Intergenic
971212388 4:24631568-24631590 AAAAGAAATTTGGTTAATTTAGG + Intergenic
971388053 4:26159790-26159812 AAGAGCCACTTGGCCAGCTTTGG - Intergenic
971787026 4:31117711-31117733 AAAAACCATTTGCCATATTTAGG + Intronic
972037293 4:34541668-34541690 AAAAACCATTTTCCCTATTTGGG - Intergenic
972641169 4:40926433-40926455 AAAAATCATTTTGGCAATTTGGG - Intronic
974824417 4:67108519-67108541 AAAAGCCATTTTACCAAAATGGG + Intergenic
979201149 4:117980001-117980023 AAAACTCATTTGGCCTGTTTAGG - Intergenic
980021044 4:127710599-127710621 AAGAGACAGTTAGCCAATTTGGG + Intronic
981564733 4:146087812-146087834 GAAAGCCAGTTAGCCAAGTTGGG - Intergenic
981957656 4:150499063-150499085 GAAAGCCATTTATCTAATTTAGG + Intronic
984450424 4:179893931-179893953 AAAGGCCAATTGGCCCATCTTGG + Intergenic
986704877 5:10446679-10446701 AAAAGGCATTTGGCAATTTCTGG - Intronic
986766699 5:10934799-10934821 AAATGCCATTTGTGCATTTTAGG + Intergenic
987875249 5:23673845-23673867 AAATGCCATTTTGACTATTTGGG - Intergenic
987933953 5:24439537-24439559 TCAAGCCATTTTGCTAATTTCGG - Intergenic
988990049 5:36661847-36661869 AGAAGCCTTTTGGTTAATTTTGG + Intronic
990219220 5:53568575-53568597 AAAAGGCATTTTGATAATTTTGG + Intronic
990631610 5:57676390-57676412 AAAAGCCATTTAGCCATGTGAGG + Intergenic
991162762 5:63524283-63524305 AAAATCCAATTGGCTGATTTTGG - Intergenic
991426083 5:66493363-66493385 AAAAGGCATTTGACCAAATCTGG - Intergenic
992036657 5:72785513-72785535 AAAAGCAATTAGGCCTTTTTTGG - Intergenic
994472226 5:100221936-100221958 AAAAGCAATTTGGTCATTTACGG + Intergenic
995858582 5:116618729-116618751 CCAAGGGATTTGGCCAATTTTGG + Intergenic
996934059 5:128927802-128927824 AAAAGCCATGTGGACAATAGAGG - Intronic
998083022 5:139292678-139292700 AAAAACCAGCTGGCCACTTTGGG + Intronic
999172140 5:149604524-149604546 AAAAGCCATGTGGGTTATTTGGG - Intronic
999619300 5:153456257-153456279 AAAAGCCATGAGGCCACTATGGG - Intergenic
1000023197 5:157336768-157336790 AAAAGCCATGTGGGCAGTTTAGG - Intronic
1000498566 5:162019059-162019081 AAAAGTCATATGGACATTTTTGG - Intergenic
1005095230 6:22107322-22107344 CACAGCCATTTGACCTATTTGGG - Intergenic
1005993417 6:30917565-30917587 AAAAGCCATTTGGAGGATTCGGG - Intronic
1007068693 6:39018833-39018855 AAAATCCATCTGGCCATTTTTGG - Intronic
1008374406 6:50775372-50775394 AAAGGTCCTTTGGCCCATTTTGG - Intergenic
1009778552 6:68238156-68238178 ATAAGGCATTTGACTAATTTGGG - Intergenic
1010082550 6:71881202-71881224 AACAGTCATTTGGCTAAATTTGG + Intergenic
1010138513 6:72584332-72584354 ACAAGCCATTTCTTCAATTTTGG + Intergenic
1010298348 6:74227909-74227931 AACAACCATGTGGTCAATTTTGG - Intergenic
1011167121 6:84461373-84461395 ATAAGCCATCTGGCCTCTTTAGG - Intergenic
1011274723 6:85619340-85619362 AAAAGGCATTTAGTCAGTTTGGG - Exonic
1011852575 6:91648574-91648596 AAAAGATATCTGGTCAATTTTGG - Intergenic
1013458418 6:110353504-110353526 AAAAACCATATGGCAAAATTTGG - Intronic
1013537268 6:111074843-111074865 AAGAGCCATTTGGGCCAATTGGG - Intergenic
1013801748 6:113953802-113953824 AAGAGGCAATTGGCCAAATTTGG - Intronic
1014033015 6:116729622-116729644 TAAAGCCACTTGGACTATTTTGG - Exonic
1014076245 6:117238535-117238557 AAAATCCATTTTGTCATTTTTGG + Intergenic
1015784890 6:136912519-136912541 GAAAGCCATTTGTCCAAGTGTGG + Intronic
1020501366 7:8925621-8925643 AAAAGGCAATTGGCTAATTACGG - Intergenic
1021279309 7:18697642-18697664 AAGAGCCATTTGAACACTTTAGG - Intronic
1021407076 7:20284074-20284096 AAAAGACAGTTAGCTAATTTGGG + Intergenic
1023083370 7:36546323-36546345 AAAATCCATTTGCTCATTTTGGG + Intronic
1023153432 7:37223918-37223940 GAAACCCAATTGGCCCATTTGGG - Intronic
1025594687 7:62909880-62909902 AGAACCCATTTTGTCAATTTTGG + Intergenic
1026012419 7:66646980-66647002 AAAAGCTAGTTGGCCACTTCTGG + Intronic
1028043017 7:86081251-86081273 AAAAGCCATTTCTACAATCTAGG - Intergenic
1028592999 7:92518174-92518196 AAAAGCCATTTTTCCTGTTTGGG - Exonic
1030916176 7:115316525-115316547 AAAAGTCATTTTACTAATTTTGG - Intergenic
1030998356 7:116385764-116385786 AAAAGCCATGTGGCCAAGCACGG + Intronic
1033570042 7:142618762-142618784 AAAAACCAATGGGCCAATTGGGG + Intergenic
1036031714 8:4981228-4981250 ACAATCTATTTGGCCATTTTAGG + Intronic
1039229433 8:35427066-35427088 AAAAGCTGTTTGGTCAATTCAGG - Intronic
1041785975 8:61635093-61635115 AAAAGCCATTTGAGTAAATTAGG - Intronic
1042588184 8:70366121-70366143 AAAAGCCACAAGACCAATTTCGG + Intronic
1043515968 8:80995057-80995079 AAAAGCCATTTTGGCAAATGTGG + Intronic
1044737965 8:95298319-95298341 AAAGTCCATTTTGCTAATTTGGG - Intergenic
1046392396 8:113592488-113592510 GAAAGATATTTGGACAATTTTGG - Intergenic
1046788075 8:118289500-118289522 AAAAGCCCTTTGGAGAATGTGGG - Intronic
1047355550 8:124118408-124118430 AAAAGCCATTCAGCAAATGTGGG + Intronic
1048684083 8:136882302-136882324 AAAAGACATATGGCCAATTGAGG + Intergenic
1052572241 9:30241669-30241691 AAAAGCCATTTGGGCAGCCTAGG - Intergenic
1055237308 9:74139240-74139262 AACAGCCATTTGAGTAATTTTGG + Intergenic
1055357611 9:75453717-75453739 AAGAGCCTTTTGGTCACTTTTGG - Intergenic
1055727281 9:79244568-79244590 AAATTCCATTTGGAAAATTTTGG + Intergenic
1056796944 9:89665118-89665140 AAAACCTGTTTGGCCACTTTAGG + Intergenic
1057609518 9:96528052-96528074 TAAAGATATTAGGCCAATTTAGG - Intronic
1058092096 9:100816016-100816038 ATATCCCATTTGCCCAATTTGGG + Intergenic
1060603403 9:124893519-124893541 AAAAGCCCATTAGCTAATTTTGG - Intronic
1060910404 9:127345190-127345212 AAAATGCATTTGGATAATTTGGG + Intronic
1188543430 X:31275348-31275370 AAAATGTATTTGGCCAATATTGG + Intronic
1190788308 X:53675312-53675334 AAAAACCTTTGGGCCAATATTGG - Intronic
1190942304 X:55053867-55053889 AGAACCCATTTAGTCAATTTGGG - Intergenic
1191044566 X:56121638-56121660 AAAAGCCACATGGCCCATGTTGG + Intergenic
1193393566 X:80957732-80957754 ATAAACCATTTTGGCAATTTTGG + Intergenic
1194406986 X:93508895-93508917 AAAATCCTATTGGTCAATTTTGG - Intergenic
1196329211 X:114449704-114449726 GAAATTCATTTAGCCAATTTTGG + Intergenic
1196881469 X:120201810-120201832 AAAAGTCATTTGGGCAGTTCTGG - Intergenic
1198248078 X:134850938-134850960 AAAATTCATTTGGCCATTTTTGG + Intronic
1198621209 X:138512069-138512091 AAATTCCATTCTGCCAATTTCGG - Intergenic
1198845976 X:140911151-140911173 AAAAGTCTATTGGCCCATTTGGG + Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1200312588 X:155093802-155093824 AAGAGTCATTAGGTCAATTTAGG - Intronic