ID: 936706057

View in Genome Browser
Species Human (GRCh38)
Location 2:115075018-115075040
Sequence CTCTCTTGTCTGTGGGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936706057_936706063 21 Left 936706057 2:115075018-115075040 CCTTGGTCCCACAGACAAGAGAG 0: 1
1: 0
2: 1
3: 19
4: 260
Right 936706063 2:115075062-115075084 TCATGGTATAAATCATATGATGG 0: 1
1: 0
2: 0
3: 15
4: 167
936706057_936706061 -2 Left 936706057 2:115075018-115075040 CCTTGGTCCCACAGACAAGAGAG 0: 1
1: 0
2: 1
3: 19
4: 260
Right 936706061 2:115075039-115075061 AGTGAGAAGCAGTTATACGTGGG 0: 1
1: 0
2: 1
3: 5
4: 110
936706057_936706060 -3 Left 936706057 2:115075018-115075040 CCTTGGTCCCACAGACAAGAGAG 0: 1
1: 0
2: 1
3: 19
4: 260
Right 936706060 2:115075038-115075060 GAGTGAGAAGCAGTTATACGTGG 0: 1
1: 0
2: 1
3: 10
4: 79
936706057_936706062 4 Left 936706057 2:115075018-115075040 CCTTGGTCCCACAGACAAGAGAG 0: 1
1: 0
2: 1
3: 19
4: 260
Right 936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG 0: 1
1: 0
2: 0
3: 2
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936706057 Original CRISPR CTCTCTTGTCTGTGGGACCA AGG (reversed) Intronic
900486229 1:2924094-2924116 CGCTCATGACTGTGGGTCCAGGG + Intergenic
902177691 1:14663358-14663380 CTCTCTTGCCTGTGTGGCCCCGG - Intronic
902395269 1:16129021-16129043 CCCTCATGGCTGTGGGACCCTGG + Intronic
902601231 1:17540957-17540979 CTTTCTAGTCTGTGTGTCCAGGG - Intronic
903705694 1:25284106-25284128 CTCTCTTTTCTGTGTGTCCTGGG + Intronic
903721547 1:25409314-25409336 CTCTCTTTTCTGTGTGTCCTGGG - Intronic
904604832 1:31692580-31692602 CTCTGGTGAGTGTGGGACCAGGG - Exonic
905627466 1:39498286-39498308 CTCTCTTGCCTGTGGGAAAGAGG - Intronic
905860852 1:41350111-41350133 CTCTGATTTCTGTGGGACCCTGG + Intergenic
905943492 1:41883078-41883100 CTGTATTTTCTGTGTGACCAGGG - Intronic
905972898 1:42154665-42154687 CTCCCCTGTCTGTAGTACCAAGG + Exonic
907262428 1:53229794-53229816 CTCTCTAGTAGCTGGGACCACGG - Intronic
907794547 1:57702196-57702218 TTCACTTGTCTGTGGCACCAGGG + Intronic
908038442 1:60081464-60081486 CTCTCTTGCCTGTTCCACCATGG + Intergenic
911459974 1:98177237-98177259 CTCTCTTGTCTGAGTTACAAGGG - Intergenic
911995921 1:104766301-104766323 CTATTTTGTCTGTGGTACCCTGG - Intergenic
912948737 1:114106040-114106062 CTCTCTTGACTAGGGGACTAGGG - Intronic
915082392 1:153360971-153360993 CTGTCTTGGCTGTGGGGCTAGGG + Exonic
915859436 1:159428678-159428700 ATCTCTTGCCTGTGGGACTTTGG + Intergenic
919893848 1:201996132-201996154 CTCTCTTGTCTTTAGGAGCCGGG + Exonic
920054891 1:203184593-203184615 CTCTCTTGTCTGTCGGAGGATGG - Exonic
920650359 1:207832941-207832963 CTGTCTTGTTTGGGGGGCCAGGG - Intergenic
920919987 1:210290943-210290965 CTTTCTTATCTATGGGTCCAGGG + Intergenic
921539771 1:216399247-216399269 CTCTGGTGTCAGTGGGACCAAGG + Intronic
921766464 1:218978439-218978461 CTCTCTGGGCTGTGGGATTATGG - Intergenic
923495574 1:234521648-234521670 CTCTCTTTTCCGTGGGAGCCAGG - Intergenic
1064148222 10:12842108-12842130 TCCTCTTGACTGTGGGATCAAGG + Intergenic
1065091628 10:22240641-22240663 ATCTCTTGACTGTAGGACCATGG - Intergenic
1065729865 10:28700819-28700841 CTCCCTCTTCTGTGGTACCATGG - Intergenic
1067689770 10:48494307-48494329 CTCCCTTGCCTCTGGGACAAAGG + Intronic
1068990005 10:63140449-63140471 CACTCTAGTCTGTGGGACAGAGG - Intronic
1070749149 10:78953654-78953676 CTCTCTCTTCTGTGGGTCTAGGG - Intergenic
1070756721 10:78997924-78997946 CTCACTTGGCTGTGTGACCTTGG - Intergenic
1071193357 10:83127998-83128020 CTCTCATTTCTGTGGCATCAGGG - Intergenic
1071197347 10:83176316-83176338 ATCTCTGGACAGTGGGACCAGGG - Intergenic
1071372446 10:84966241-84966263 CTGTCTTTTCTGGGGTACCACGG - Intergenic
1071372710 10:84968870-84968892 CTGTCTTTTCTGGGGTACCACGG - Intergenic
1072543018 10:96412829-96412851 CTCTCCTTTCTCTGGGACTAGGG - Intronic
1072747221 10:97949303-97949325 CTGTCTTCTCTGTGGGACCAGGG - Intronic
1072804224 10:98414621-98414643 TTCACTTGTCTGTTGGCCCAGGG + Intronic
1074702158 10:116102066-116102088 CTGTCTTGTATGTGAGACAAGGG - Intronic
1076152960 10:128178155-128178177 CTGTTGTGTCTGTGGCACCAAGG + Intergenic
1076845655 10:133068360-133068382 GCCTCTCGTCTGTGTGACCATGG - Intergenic
1078444126 11:11391453-11391475 ATTTCCTGTCTATGGGACCAAGG + Intronic
1078921053 11:15831045-15831067 CTATCATCTCTGTGGTACCAGGG + Intergenic
1079560150 11:21811601-21811623 CTCTATTTTCTGGTGGACCAAGG - Intergenic
1081639563 11:44743433-44743455 CTCTCTGGTTTGTGTGACCTTGG + Intronic
1081668414 11:44929939-44929961 CTCTCTTGTCTGGGGGAACCGGG - Exonic
1081815066 11:45934432-45934454 CTCTGTTGCCTCTGGGACCTGGG - Intronic
1084189041 11:67490681-67490703 CTCTCTCCCCTGTGGGCCCATGG + Intronic
1088016994 11:105072768-105072790 CCCTCTTGTATGTGAGAGCAAGG - Intronic
1088019544 11:105102670-105102692 CCCTCTTGTATGTGAGAGCAAGG - Intergenic
1088727710 11:112654166-112654188 CTCTCTTGGATCAGGGACCATGG - Intergenic
1089812747 11:121144965-121144987 CTCCCTTGTCTGGGTAACCAGGG - Intronic
1090096781 11:123750119-123750141 CTGTCTTGTCTCTGTGGCCACGG + Intergenic
1090177509 11:124664150-124664172 CTCTCTTGTCAGTGTAACCCAGG - Intronic
1090340030 11:126009537-126009559 CTCTTTAACCTGTGGGACCATGG + Intronic
1090400416 11:126445152-126445174 CACTCTTGTCTCTGGGAACAAGG + Intronic
1093316129 12:17652507-17652529 CTCTCTTATCTGAGGAACGAAGG + Intergenic
1096046396 12:48566332-48566354 CTGTCTTCTCTGTGGGATGAAGG + Intergenic
1096481966 12:51948277-51948299 CACTCTAGTCAGTGGGACTAAGG + Intergenic
1096789198 12:54034609-54034631 CGCTTTTGTCTGTGGGGCCCGGG - Exonic
1096804730 12:54133713-54133735 CACTCTTCTCTGTGAGCCCAGGG - Intergenic
1097137901 12:56874795-56874817 TTATCTTGTCTGTGGGCCAATGG + Intergenic
1097280286 12:57841168-57841190 CTCGCTTGTCTTTGGGACGTGGG - Intronic
1097290381 12:57909396-57909418 CTTCCTTGTCTGTGGTGCCAAGG + Intergenic
1097552444 12:61091168-61091190 ATCTCTTGGCAGTGGGAGCATGG - Intergenic
1100798912 12:98211136-98211158 CAGTCATGTCTGTGGGCCCAGGG - Intergenic
1103662716 12:122534260-122534282 CTTTCATGTCTGTGGGGGCATGG + Intronic
1105024796 12:132840710-132840732 CTCCCTTGTGTGAGTGACCACGG - Intronic
1108415501 13:50194493-50194515 CTCTCAGGTCTGTGGAACCCTGG - Intronic
1108611537 13:52088702-52088724 CTATCTCTTCTGTGGGACCTTGG - Intronic
1117544965 14:56785844-56785866 CTCCCTTGTCTTGGTGACCAGGG + Intergenic
1122729856 14:103787988-103788010 CTCTCTAGTCGCTGGGACTATGG - Intronic
1124993211 15:34696264-34696286 TTCTCTTGTCTCTAGCACCAAGG - Intergenic
1127263237 15:57341134-57341156 CTCTCTTGTCTGGAGGTGCAGGG + Intergenic
1128179336 15:65587857-65587879 CTCTCATGTGGCTGGGACCACGG - Intronic
1128551018 15:68597995-68598017 CACTCTTGACTGTGTGGCCATGG - Intronic
1128627280 15:69222459-69222481 CTTTCTTTCCTGTGGGACCAGGG - Intronic
1128727011 15:69995746-69995768 CAGTGTTGTCTGTGGGGCCACGG - Intergenic
1129395582 15:75243682-75243704 CTCTCTAGTAGCTGGGACCACGG - Intergenic
1130322138 15:82850315-82850337 CACGCCTCTCTGTGGGACCAGGG - Intronic
1130655989 15:85792532-85792554 CTCTCTTCTCTGGGGGTCCTGGG - Intronic
1130670498 15:85908322-85908344 CTGTCTTCTATGTGGCACCATGG + Intergenic
1130776678 15:86991594-86991616 GACTCTTGACTGAGGGACCATGG + Intronic
1132326650 15:100975479-100975501 GTCTCTTCTCTGTGGCATCATGG + Intronic
1134024737 16:10944978-10945000 CGCTCTTGGCTGTGTGACCTTGG + Intronic
1135274654 16:21101850-21101872 TTCTCTTGTCTGTTGGATCCGGG - Intronic
1135813947 16:25614951-25614973 CTCAATTGTCTGTGTGACCCTGG + Intergenic
1136356072 16:29745498-29745520 CTTTCTTGTCTGAGGCACCCTGG - Intronic
1137806209 16:51308242-51308264 CTCTCCTGGCTGTGTGACCTTGG + Intergenic
1137955239 16:52823009-52823031 ATCTCTTGTGAGTGGCACCAGGG + Intergenic
1138419458 16:56889883-56889905 CTCCCTTAGCTGTGTGACCATGG + Intronic
1138445771 16:57062337-57062359 CTGTCTTATCTGGGGGACAATGG - Intronic
1138458924 16:57136599-57136621 CTTTCTTAGCTGTGGGACCTGGG - Intronic
1139293171 16:65876114-65876136 CTCTCTTGCCTGTCTGACCAGGG + Intergenic
1140922357 16:79550982-79551004 CTCTGCTGTCTGTGAGGCCACGG - Intergenic
1141459666 16:84170418-84170440 CTCACGTCTCTGTGGGACCTGGG + Intronic
1141647936 16:85377447-85377469 CTCTCCTGGCTGTGTGACCTTGG + Intergenic
1141989331 16:87601683-87601705 CTCTCTTGTGCGTGGGAAGAGGG + Intergenic
1142109517 16:88323745-88323767 GCCCCTGGTCTGTGGGACCACGG - Intergenic
1143346740 17:6255056-6255078 CTCTCCTCTCTGTGGCTCCAAGG + Intergenic
1143476797 17:7207871-7207893 GTTTCTCCTCTGTGGGACCAAGG + Intronic
1144277609 17:13689059-13689081 CTCTCTTGGCTGTGGGAGGAAGG + Intergenic
1144297149 17:13886913-13886935 CTCTCTGGTATGTGTGCCCAGGG - Intergenic
1146219745 17:31008338-31008360 CCCTTTTGTCTGAGGGACCCGGG - Intergenic
1147736658 17:42643016-42643038 CTCTCTTTTCTCTTGGAGCAAGG + Intergenic
1148463200 17:47849942-47849964 ATCTCCTGCCTCTGGGACCAGGG + Intronic
1148866221 17:50630115-50630137 ATCTCCTGGCTGTGTGACCACGG - Intergenic
1149519636 17:57308907-57308929 TTCTTTTGTCCGTGGTACCATGG + Intronic
1150373630 17:64662297-64662319 CCCTCTTGTCTGAGGGACCCGGG + Intergenic
1151079526 17:71312599-71312621 CTCAGTTTTCTGTGAGACCATGG + Intergenic
1151418495 17:73982335-73982357 CTCTCCTGTCTCTGGGCCCCAGG - Intergenic
1152278344 17:79371156-79371178 CTTTCTTCACTGAGGGACCATGG + Intronic
1152415646 17:80160000-80160022 CTCTCTTCTTTCTGGGACCCAGG - Intergenic
1153666439 18:7370970-7370992 GTCTCTGCTCTGTGGGACCTAGG - Intergenic
1154064676 18:11096003-11096025 CTTTCTTGTGTGTGTGCCCAAGG + Intronic
1157765623 18:50294860-50294882 CTCTGTCTTCTGTAGGACCAAGG - Intergenic
1160622594 18:80181281-80181303 CTGACTTGGCTGAGGGACCAGGG - Intronic
1160722337 19:603139-603161 CCCTCTTCCCTGTGGGACGAGGG - Intronic
1160722425 19:603375-603397 CCCTCTTCCCTGTGGGACGAGGG - Intronic
1162889849 19:13724656-13724678 ATTTCTTGGCTGTGGGACCTTGG - Intergenic
1163173997 19:15551716-15551738 CTGTCCTGTTTGAGGGACCAGGG + Exonic
1166218058 19:41349173-41349195 GCCTCTTGGCTGTGTGACCATGG + Intronic
1166517698 19:43459864-43459886 CCCACTTGTCTGTAGGACCCGGG - Intergenic
1166880506 19:45927077-45927099 CTGGCTTGTCTGTGGAACTACGG + Intergenic
1167142311 19:47660583-47660605 CTCATTTGTCTGTCTGACCAAGG + Intronic
1168215884 19:54925273-54925295 TTCTCTTGTTGGTGGGACCGAGG - Intronic
925510463 2:4620009-4620031 CTCTCTTGGCTCTGGGGTCATGG - Intergenic
925712270 2:6752921-6752943 CTCTCTTGTCAATGGGATGAGGG + Intergenic
925963015 2:9036070-9036092 CTCTCTTGTCTGTTGGTTCCTGG - Intergenic
926425779 2:12737242-12737264 CTCTCCCATCTGTGGGACAAGGG - Intronic
926861743 2:17317362-17317384 CTCCCTTGTCTGTGGAAGCAGGG - Intergenic
928443726 2:31314833-31314855 CACACTTCACTGTGGGACCATGG - Intergenic
930057034 2:47260064-47260086 CTTTCTTGTCTCTCTGACCATGG - Intergenic
931018571 2:58015385-58015407 ATTTCCTGGCTGTGGGACCATGG + Intronic
932859471 2:75274764-75274786 CTCTCAGTTCTGTGGGCCCAGGG + Intergenic
933852620 2:86382731-86382753 TTCTCATTTCTGTGGGCCCAGGG + Intergenic
934077622 2:88441344-88441366 CTCTGTTGGCTGGAGGACCATGG - Intergenic
935127851 2:100239854-100239876 CTCTCTTACCTGTGGGAGAAAGG - Intergenic
935352673 2:102167256-102167278 CACTGATGCCTGTGGGACCATGG - Intronic
935948042 2:108303701-108303723 CTTTCTTGTGGGTGGGAGCAAGG + Intronic
936706057 2:115075018-115075040 CTCTCTTGTCTGTGGGACCAAGG - Intronic
939056552 2:137372286-137372308 CTCTCTGGCCTGTGGGCCAAAGG - Intronic
940698604 2:157012936-157012958 CTCTGTTGACTGTGGAACCTTGG + Intergenic
941679412 2:168380371-168380393 CTCCCTTGTATGTAGGGCCATGG - Intergenic
943653602 2:190483375-190483397 CTCTCTTCTCTGTGTGACTCTGG + Intronic
944351784 2:198736355-198736377 ATATCTTAGCTGTGGGACCACGG + Intergenic
945722275 2:213432765-213432787 CTCTCTGGTCTTTGGTATCAGGG - Intronic
946002271 2:216492465-216492487 CACTCTTGTCTGTGGCCCCCAGG + Intergenic
947633582 2:231668688-231668710 GTCCCTTGACTGAGGGACCAAGG - Intergenic
1168784812 20:529145-529167 CTCCCTTGTAGCTGGGACCACGG + Intronic
1168939566 20:1697141-1697163 CTCCCTTATCTGTGGAAACATGG + Intergenic
1171385889 20:24769358-24769380 CCCTCTTGCCTCTGGGACCCAGG + Intergenic
1173502628 20:43565280-43565302 CTCGCAGGTATGTGGGACCAGGG + Intronic
1174476547 20:50799922-50799944 CTCTCTAGTAGCTGGGACCAGGG - Intronic
1177834886 21:26177163-26177185 CTCTCTTGAGTGTGGGAGTAAGG + Intergenic
1178610773 21:34077121-34077143 CTCTCTTGTGAGTGGGAAAATGG + Intronic
1178755001 21:35340495-35340517 CTCTCTAGTCCATGGGGCCAAGG - Intronic
1180176549 21:46093254-46093276 CTCTCTTGTCTGTCCCACTAGGG - Intergenic
1180206792 21:46265786-46265808 CTGTCTTGTCTTGGGGCCCAGGG - Intronic
1180726996 22:17953594-17953616 GTTTCTTGTCTGTTGGACCTTGG - Intronic
1181041620 22:20195108-20195130 CTCTGCTGTCTGTGGGCCTAGGG + Intergenic
1181550100 22:23633128-23633150 CTCTATTGAGAGTGGGACCAGGG - Intergenic
1181798284 22:25326413-25326435 CTCTATTGAGAGTGGGACCAGGG + Intergenic
1182092736 22:27607010-27607032 GTCTCCTGTCTGTGAGGCCACGG - Intergenic
1182420965 22:30248371-30248393 GTCTCTTCTTTGAGGGACCATGG + Intergenic
1182898118 22:33875411-33875433 CCCTCTTGACTGGGGAACCATGG + Intronic
1183540150 22:38425110-38425132 CTCTGCTCTCTGTGGGACCTCGG - Intergenic
1185419250 22:50726301-50726323 CTCACTTGTCTCTGAGACCCTGG + Intergenic
950613404 3:14140267-14140289 CTTTCTTGCCTGTGTGACCCTGG + Intronic
951011830 3:17690552-17690574 CTTGCTTGTCTGTGGCCCCAGGG - Intronic
951577051 3:24124681-24124703 CTCTTTGCACTGTGGGACCAAGG + Intronic
952080615 3:29753285-29753307 TTCTCTTTTCTGGGGGACCCGGG - Intronic
952145869 3:30531396-30531418 CTCACTTTCCTATGGGACCAGGG - Intergenic
952543549 3:34395089-34395111 CTCTCCTGTTTTTGAGACCATGG + Intergenic
953409815 3:42684410-42684432 GTCTATGGTCTGAGGGACCAGGG - Intergenic
953429227 3:42823397-42823419 CTCTCCTGTCTGGGAGATCAGGG + Intronic
955854927 3:63262668-63262690 CTCTGTCTTCTGTGGGACTAGGG - Intronic
956858154 3:73296082-73296104 CTCTACTTTCTGTGGGACTATGG + Intergenic
957485609 3:80858587-80858609 CACTTTTGTCTGTGGTAGCAGGG - Intergenic
960618673 3:119618995-119619017 CTGTTATGTCTGTGGGTCCATGG - Intronic
960971905 3:123145819-123145841 CCCTCTTTTCTCTGGGACCCTGG + Intronic
962079089 3:132117863-132117885 CTGTCTTTTCTGTATGACCAGGG - Intronic
962805390 3:138923431-138923453 TTCTCTTGTCTGTGGGTGCTAGG + Intergenic
964095152 3:152922663-152922685 CTCTCTTGGCCGAGGGATCAAGG + Intergenic
966318854 3:178678373-178678395 CCCTCTTGCCTGTGGGCCTAAGG + Intronic
968651832 4:1763249-1763271 CTCTCTGTTCAGTGGGACCCAGG - Intergenic
969221018 4:5758530-5758552 CTTTCCTGTCTGTGGGCCCCAGG - Intronic
969599073 4:8165260-8165282 ATCTGTGGTCTGTGGGACCTGGG + Intergenic
969646313 4:8431518-8431540 CTCTGTTGTATTTGGGACCTGGG + Intronic
970572306 4:17394826-17394848 CTCTCCTGTCTCTGGCTCCAGGG - Intergenic
972968453 4:44542369-44542391 CTCTCTTGTGAATGGGATCAAGG - Intergenic
977738266 4:100444391-100444413 CTGTCTTATCTGTGGTGCCAGGG + Intronic
979110589 4:116750160-116750182 TTCTCTTGACTTTGGGATCAGGG - Intergenic
979183234 4:117756380-117756402 CTCTCTTCTCTCTGAGACCTTGG - Intergenic
982920891 4:161273719-161273741 CTGTCATCTCTGTGGGTCCATGG + Intergenic
983130950 4:164019464-164019486 CTCTCTTGTCTGTGAGCAGATGG + Intronic
985940853 5:3134436-3134458 CTCACTTCTCTGAGGGACCCAGG + Intergenic
986244834 5:5997877-5997899 CTAACTTGTCTGTGGGACAGAGG - Intergenic
988896058 5:35676238-35676260 CTCCCTCCTCTGTGAGACCAGGG + Intronic
991507488 5:67340454-67340476 GCCTCTTGTGTGTAGGACCAGGG - Intergenic
991942999 5:71872878-71872900 CTCTCCTGTGTGAGGTACCATGG + Intergenic
992751574 5:79867414-79867436 CTCTCTTCTATTTGGGACCCAGG - Intergenic
1001873006 5:175173846-175173868 CTCTACAGTCTGCGGGACCAAGG - Intergenic
1003664320 6:8095681-8095703 CTCTCTTGTTGGTGGGACTATGG + Intronic
1006845424 6:37058044-37058066 CTTGCTTCTCTGTGAGACCATGG + Intergenic
1007060173 6:38932784-38932806 CTCTCCTGTGTTTGGGACCCTGG - Intronic
1007065845 6:38989653-38989675 TTCTCTTGTGTGTGGGAGTATGG + Intronic
1007520873 6:42451413-42451435 CACTCTTGTCGGGGGGACGAGGG - Intronic
1007861355 6:44912558-44912580 CTCTCTACACTGTGGGACCTGGG + Intronic
1008515850 6:52318618-52318640 CTCTCTTGCCTGTCAGTCCATGG + Intergenic
1010884543 6:81219567-81219589 GTCTCTTGACTTTGGGATCAGGG + Intergenic
1014514090 6:122360917-122360939 CTCTATTTTCTGGTGGACCAGGG - Intergenic
1014762157 6:125368174-125368196 CTCTCTTCACTCTGGGACTAGGG - Intergenic
1015670984 6:135689240-135689262 CTCTGTTGACTGTGGGCCCCAGG + Intergenic
1016357209 6:143231509-143231531 CTCTCTTGGCTGAGGGAGCATGG + Intronic
1019001820 6:168760098-168760120 CTTTCTTGTCTTTGGTATCAGGG - Intergenic
1019062934 6:169269751-169269773 ATCTCTTGTCTCAGGGCCCATGG - Intergenic
1019521046 7:1460593-1460615 CCCTCCTGGCTGTGGGGCCAGGG + Intergenic
1020000312 7:4751851-4751873 CTCTCTCGCCTGTGGGAGCCAGG + Intronic
1020357391 7:7292470-7292492 CTCATTTGTCTGTGCAACCAAGG + Intergenic
1020575434 7:9921168-9921190 CTCTCTTGTCTCTGTGACTGAGG - Intergenic
1023339737 7:39207345-39207367 CTCACTTTCCTGTGGAACCAAGG - Intronic
1023806569 7:43876954-43876976 GTCTCTTGTCTCTGGGCCTAGGG + Exonic
1031987362 7:128171765-128171787 CTCTCCTGGCTGTGTGACCTTGG + Intergenic
1033432499 7:141301826-141301848 CTCTCTTCTCTGTGGGATGAGGG - Intronic
1036607987 8:10324652-10324674 CTCTGCTTTCTGTGGGACCCAGG - Intronic
1038257402 8:25962869-25962891 CTCTTTTGTCTCTTGGCCCAGGG + Intronic
1040507506 8:48063205-48063227 CCCTCTTGTTTGTGGGATTATGG + Exonic
1041128130 8:54666398-54666420 CTTTGTTCTCTGTGGTACCAGGG + Intergenic
1041537585 8:58944100-58944122 CTCTCTTGTGTCTTGAACCAGGG - Intronic
1042843437 8:73147470-73147492 TTCTCTTGTCTGTTGGTCCCTGG + Intergenic
1043380249 8:79694942-79694964 CTGTTTTGTCTCTGGGGCCATGG - Intergenic
1043584486 8:81752321-81752343 CCCTCTTGACTGTGGCACCTTGG - Intronic
1043673448 8:82918378-82918400 TTTTCTGGTCTGTGGGAACACGG - Intergenic
1044912113 8:97071317-97071339 CTGTGTTGTCTGTGAGAGCATGG - Intronic
1045383358 8:101648245-101648267 CTGTCACGTCTGTGGGACCCTGG + Intronic
1045769748 8:105722284-105722306 CTCCTTTGTTTGTTGGACCATGG + Intronic
1047188196 8:122654610-122654632 CTCTCAATTCTGTGGGCCCAAGG + Intergenic
1047465501 8:125109197-125109219 CTCTCTTATCTTTGTGACCTTGG + Intronic
1050253661 9:3771941-3771963 TTCTCTAGCCTGTGGGACCTTGG + Intergenic
1051074337 9:13212601-13212623 CACTCTTCTCTGTGGTACCATGG - Intronic
1052743619 9:32417620-32417642 ATCTCCTGTGTGTAGGACCAAGG - Intronic
1053233208 9:36429326-36429348 CTCTCGTATCTGTGGGAGCTTGG + Intronic
1053361758 9:37492879-37492901 GACTGTTCTCTGTGGGACCAAGG - Intronic
1055939384 9:81635125-81635147 CTCCCCTGTCTGTGGCAGCATGG - Intronic
1056589207 9:87951950-87951972 CTGTCTTTCCTGTGGGACCAGGG - Intergenic
1061291305 9:129651657-129651679 CTCTCTTGGCTGTGGCCCCAAGG + Intergenic
1061407600 9:130401061-130401083 CTCTCCTGGCTGTGTGACCTGGG + Intronic
1062599237 9:137312538-137312560 CCCACTTGGCTGTGGGTCCATGG - Intronic
1186177737 X:6942914-6942936 CACTCTTGTCAGCAGGACCACGG - Intergenic
1186460849 X:9747436-9747458 CTCCCTCGCCTGTGGGACCCCGG - Intronic
1186544560 X:10435438-10435460 CTCTCTAGTGTGTGCTACCAAGG + Intergenic
1186755703 X:12669264-12669286 CTCTTTAGGCTGTTGGACCAAGG - Intronic
1187493695 X:19776424-19776446 TTCTGTTGTCTGTTGGCCCAGGG - Intronic
1188021639 X:25165090-25165112 CTTTTTAGGCTGTGGGACCAAGG + Intergenic
1189765969 X:44372529-44372551 CTCTCTTCCCTGTGGGACTATGG + Intergenic
1192449393 X:71234230-71234252 CTTTCTTTCCTGTGTGACCAAGG - Intergenic
1192537274 X:71938950-71938972 CTCTAATTTCTGTGAGACCAGGG - Intergenic
1194458267 X:94131808-94131830 CTCACTTGGCTGTGTGACCTTGG - Intergenic
1195690998 X:107625414-107625436 CTCTCTTCTTTCTGGGAACAGGG + Intergenic
1195748104 X:108138482-108138504 CTCTCCTGCCTGTGGGGCCCAGG + Intronic
1196982281 X:121228081-121228103 GTCTCTTGTCTGTGTAACTATGG - Intergenic
1200708715 Y:6464972-6464994 CTGTCTTTTCTGTGGATCCATGG - Intergenic
1200920383 Y:8607811-8607833 CTCTCTCCTCTGTGGGATCCAGG + Intergenic
1200924019 Y:8638312-8638334 CTGTCTTCTCTGTGGGATCACGG + Intergenic
1200963791 Y:9018432-9018454 CTGTCTTCTCTGTGGGATCCAGG - Intergenic
1200984616 Y:9292090-9292112 CTGTTTTCTCTGTGGGATCACGG - Intergenic
1201025397 Y:9699737-9699759 CTGTCTTTTCTGTGGATCCATGG + Intergenic
1202119267 Y:21507771-21507793 CTCTCTTGTCTGGTGGGGCAGGG + Intergenic
1202121719 Y:21531311-21531333 CTCTCTTGTCTGGTGGGGCAGGG + Intronic
1202125829 Y:21568141-21568163 CTGTTTTCTCTGTGGGATCACGG + Intergenic
1202149313 Y:21830356-21830378 CTGTCTTCTCTGTGGGATCCAGG + Intergenic
1202153172 Y:21861239-21861261 CTGTTTTCTCTGTGGGATCACGG - Intergenic
1202157286 Y:21898071-21898093 CTCTCTTGTCTGGTGGGGCAGGG - Intronic
1202159733 Y:21921612-21921634 CTCTCTTGTCTGGTGGGGCAGGG - Intergenic
1202182690 Y:22153096-22153118 CTGTCTTTTCTGTGGATCCACGG - Intergenic
1202186178 Y:22186527-22186549 CTCTCTTGTCTGGTGGGGCAGGG - Intergenic
1202205181 Y:22399869-22399891 CTCTCTTGTCTGGTGGGGCAGGG + Intronic
1202208670 Y:22433306-22433328 CTGTCTTTTCTGTGGATCCACGG + Intergenic