ID: 936706058

View in Genome Browser
Species Human (GRCh38)
Location 2:115075025-115075047
Sequence CTTCTCACTCTCTTGTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936706058_936706063 14 Left 936706058 2:115075025-115075047 CCCACAGACAAGAGAGTGAGAAG 0: 1
1: 0
2: 1
3: 25
4: 267
Right 936706063 2:115075062-115075084 TCATGGTATAAATCATATGATGG 0: 1
1: 0
2: 0
3: 15
4: 167
936706058_936706060 -10 Left 936706058 2:115075025-115075047 CCCACAGACAAGAGAGTGAGAAG 0: 1
1: 0
2: 1
3: 25
4: 267
Right 936706060 2:115075038-115075060 GAGTGAGAAGCAGTTATACGTGG 0: 1
1: 0
2: 1
3: 10
4: 79
936706058_936706061 -9 Left 936706058 2:115075025-115075047 CCCACAGACAAGAGAGTGAGAAG 0: 1
1: 0
2: 1
3: 25
4: 267
Right 936706061 2:115075039-115075061 AGTGAGAAGCAGTTATACGTGGG 0: 1
1: 0
2: 1
3: 5
4: 110
936706058_936706062 -3 Left 936706058 2:115075025-115075047 CCCACAGACAAGAGAGTGAGAAG 0: 1
1: 0
2: 1
3: 25
4: 267
Right 936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG 0: 1
1: 0
2: 0
3: 2
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936706058 Original CRISPR CTTCTCACTCTCTTGTCTGT GGG (reversed) Intronic
902783308 1:18717839-18717861 TTTGTCACTTGCTTGTCTGTGGG - Intronic
903376301 1:22868471-22868493 TTTCTCACTCACTAGTGTGTGGG + Intronic
903601812 1:24547404-24547426 CTGCTCACTCACATGGCTGTTGG + Intergenic
905209086 1:36361124-36361146 CACCTCACTCTGATGTCTGTAGG + Intronic
908553391 1:65232667-65232689 CCTCACACTCTCCTGTCTCTGGG + Intergenic
910312707 1:85843479-85843501 TTTCTCTCTCTCTTTTTTGTTGG - Intronic
910598891 1:89009502-89009524 CTTCTCACTCTGTGTTCTCTGGG - Intronic
910603330 1:89055223-89055245 CTTCTCACTCTGTGTTCTCTGGG - Intronic
912225209 1:107725408-107725430 CCTCTCACTCTCTTTACTTTCGG - Intronic
912300280 1:108509010-108509032 CTCCTCACTGTGTTGTCTGTTGG - Intergenic
912412842 1:109490034-109490056 CTCCTCACTCTCTTCGCTGGAGG - Exonic
912427851 1:109610424-109610446 CTTCACCCTATCTTGTCTTTTGG + Exonic
913086855 1:115446884-115446906 TTTCTCACTTTCTTGCTTGTTGG + Intergenic
913296071 1:117321702-117321724 CTTCTATCTCTCCTCTCTGTGGG + Intergenic
914730869 1:150369268-150369290 CTTCTTTCTCTCTTTTCTGTGGG + Intronic
916859837 1:168791296-168791318 CTATGCACTCTCTTGTTTGTGGG + Intergenic
917430278 1:174960148-174960170 CTTCTAACTCTCTTGTCATATGG - Intronic
918399881 1:184152863-184152885 CTTCCCACTCTCATGTCGGCTGG + Intergenic
918605106 1:186415447-186415469 GTTCTCTCTCTCTTTTTTGTGGG + Intronic
918712961 1:187754339-187754361 TATCTCACTCTCTTGGCTGTAGG + Intergenic
919357900 1:196549361-196549383 CTTCTCACTCTCTAGTGTGGGGG - Intronic
920054893 1:203184600-203184622 CTGAAGACTCTCTTGTCTGTCGG - Exonic
920566137 1:206974988-206975010 TTTCTAACTCTCTTCTCTGAAGG + Intergenic
921939126 1:220821970-220821992 CCTCACACTCTCTTGTTTGGGGG + Intergenic
922166874 1:223123206-223123228 ATTCTCACTCCCATGTCTGCAGG - Intronic
922468769 1:225862563-225862585 CTTCTCAGTCTTCTTTCTGTAGG + Exonic
923227410 1:231951116-231951138 TTTCTCACTCTCTGTTCTTTGGG + Intronic
924568439 1:245217322-245217344 ACTCTCACTCTCTTTTCTGGTGG + Intronic
1064032723 10:11893543-11893565 TTCCACACTCTCTTGCCTGTTGG + Intergenic
1064723154 10:18250364-18250386 CTTCTTACTGTCCTTTCTGTGGG + Intronic
1065312940 10:24433814-24433836 CTTCTCAGTCTCTTTTCTTATGG - Intronic
1065906843 10:30262601-30262623 CTTCTCACTCTGAGGTCTCTTGG - Intergenic
1068539549 10:58275810-58275832 ATTCTCAGTCTCTTGTATCTTGG - Intronic
1069327080 10:67244331-67244353 CTTCTCAGTCTTGTTTCTGTTGG - Intronic
1069871224 10:71534331-71534353 CTTGCCACTCTCATGTCTGGGGG + Intronic
1070670628 10:78375019-78375041 GGTCTCCCTCCCTTGTCTGTTGG - Intergenic
1071893907 10:90043226-90043248 TTTCTCACTCTCTAGTATTTAGG + Intergenic
1073153979 10:101331904-101331926 CATCTCACTTTCTTGTCTTTAGG + Intergenic
1073676815 10:105656891-105656913 GTTATCACTTTTTTGTCTGTTGG + Intergenic
1074378904 10:112962331-112962353 CTTGTCCCTCTCTTTTCAGTTGG - Intronic
1076055392 10:127368259-127368281 CTTCTGCCTCTTTTGTCTCTGGG + Intronic
1077591272 11:3492688-3492710 CTTCTCCCTCCCTTATCTGAAGG - Intergenic
1077707848 11:4505307-4505329 CTACACACTCCCTTTTCTGTGGG - Intergenic
1078809823 11:14747489-14747511 CTTCTGACTGTCTTCTCTATGGG - Intronic
1078952994 11:16156395-16156417 CTTCTCACTCTCATATTTCTAGG + Intronic
1079350041 11:19684686-19684708 TTCCTCACTCTGGTGTCTGTGGG - Intronic
1079590054 11:22171963-22171985 CTTCTTAATTTCTAGTCTGTAGG + Intergenic
1081246493 11:40772442-40772464 CTTCTTACTCTGTTGTCAGGTGG - Intronic
1083911587 11:65713095-65713117 CTCCTATTTCTCTTGTCTGTTGG + Intronic
1084246973 11:67864439-67864461 CTTCTCCCTCCCTTATCTGAAGG - Intergenic
1084440746 11:69171530-69171552 CTCCTCACTCTCCAGCCTGTTGG - Intergenic
1084825716 11:71730092-71730114 CTTCTCCCTCCCTTATCTGAAGG + Intergenic
1086292094 11:85323153-85323175 TTTCTCTCTCTCTTGCCTGTAGG + Intronic
1087068344 11:94048767-94048789 CTTCTCTCTATCCTGTCTGCAGG + Intronic
1088230475 11:107669114-107669136 CTTCTCTCTCAGATGTCTGTAGG + Intergenic
1088339919 11:108752380-108752402 CTTTTCACTTTCTTTCCTGTGGG + Intronic
1089018614 11:115187917-115187939 CAGATCACTTTCTTGTCTGTAGG + Intronic
1090441988 11:126731960-126731982 CTTCTCTCTCTCTTTGCTGCTGG - Intronic
1091254322 11:134170685-134170707 CTCCGCAGTATCTTGTCTGTTGG - Intronic
1092244639 12:6856680-6856702 CTGCTGATTCTCTTCTCTGTGGG + Intronic
1095378385 12:41558943-41558965 TTTCTCACTCTCATCTCTCTGGG - Intronic
1095422243 12:42037143-42037165 CTTATCACTCCCTTGTCAGATGG - Intergenic
1096272016 12:50172897-50172919 ATTCCCAGTCTCTTGGCTGTTGG + Intergenic
1096756308 12:53802715-53802737 CTTCTCCCTCTCTTCTCTCAAGG + Intergenic
1097159982 12:57039185-57039207 GTTGTCATTCTCTTATCTGTGGG - Intronic
1098567697 12:71954281-71954303 CTTCCCACACTCATGTCTGCAGG - Intronic
1099570113 12:84306448-84306470 TTCCTCTCTCTCTTGTCTCTTGG - Intergenic
1100978984 12:100149959-100149981 CGTCTCATTCTCATGTCTCTTGG - Intergenic
1101018377 12:100526002-100526024 CTTCTCTCTCTCTTTTTTCTTGG + Intronic
1101318388 12:103650549-103650571 CCTTTCAGTCCCTTGTCTGTAGG - Exonic
1101478585 12:105075180-105075202 CATCTCAGTCTCTTGGCTCTTGG - Intronic
1101720644 12:107347735-107347757 CTTCCCACTCTCTTGAAAGTAGG - Intronic
1101764858 12:107688100-107688122 CCTCTCCCTCTCTTCCCTGTGGG - Intronic
1102575254 12:113852182-113852204 CTTCTCACTCTGATCTCTGTAGG + Intronic
1105582386 13:21711190-21711212 CTTCTCCCTCTCATCTCTTTTGG - Intergenic
1105968828 13:25408448-25408470 CTGCTCACCATCCTGTCTGTGGG - Intronic
1106587812 13:31072453-31072475 CTGCTCACTTTATTATCTGTTGG + Intergenic
1107576214 13:41725494-41725516 CTTCCCACTCTCTGGCCTCTTGG - Intronic
1108138434 13:47391554-47391576 CTTGTCAATCTCTTGTCAGATGG - Intergenic
1108423362 13:50272973-50272995 CCCCTCACTTCCTTGTCTGTTGG - Intronic
1108514189 13:51182459-51182481 CTTCTCACATACTTGTATGTAGG + Intergenic
1112461792 13:99609035-99609057 CTTATCTCTCTCTTCTCTTTCGG + Intronic
1113138543 13:107120797-107120819 ATACTCAGTCTCTAGTCTGTTGG + Intergenic
1116000337 14:39236594-39236616 ATTATCATTCTCTAGTCTGTAGG - Intronic
1116143408 14:41031408-41031430 CTCCTCACACTCTTTTCTTTTGG + Intergenic
1116473068 14:45307522-45307544 CTTCTCATTCTGTTGTGTGAAGG - Intergenic
1117573207 14:57069807-57069829 TTTCTCCCTCTCTTGTATTTAGG - Intergenic
1118179299 14:63475240-63475262 CATTTCACTCTCTTCTCTGTTGG + Intronic
1120596663 14:86447967-86447989 CTTCCCGCTCTCCTGTCTTTGGG + Intergenic
1122679081 14:103442953-103442975 CTTCTCACTTCCTTGTCGGTGGG - Intronic
1123842718 15:24265333-24265355 CCTCTTACTTTCTTGGCTGTTGG + Intergenic
1124784030 15:32662322-32662344 TTTCTCTCTCACTTGTTTGTGGG + Intronic
1125166268 15:36708733-36708755 CTTGTCTCTTTCTTGTGTGTGGG + Intronic
1127161469 15:56191349-56191371 CTTCTAACTCCTTTGTCTATAGG - Intronic
1127263235 15:57341127-57341149 CATTGCACTCTCTTGTCTGGAGG + Intergenic
1128569928 15:68726538-68726560 CTTCCCACCCTCTTGTCTTCAGG + Exonic
1129363392 15:75039034-75039056 CTTCTCCCTCTATTGTCTCTGGG + Intronic
1131260854 15:90886962-90886984 CTTCTCAATGTCCTGGCTGTGGG - Exonic
1131462090 15:92624671-92624693 CTTCCCACCCTCTTGTGGGTAGG - Intronic
1132137319 15:99354367-99354389 CTTCTGCCTCTTTTATCTGTTGG + Intronic
1133723227 16:8514422-8514444 CTTCTCATGCTCTTGTCTCCTGG + Intergenic
1135038461 16:19098175-19098197 GGTCTCACTCTCATGTCTGGTGG - Intergenic
1137524666 16:49224322-49224344 CTTCTGAGTCTCCTGTCTCTAGG - Intergenic
1139573547 16:67827726-67827748 CCTGTCACTCTCTTTCCTGTGGG + Intronic
1140978561 16:80084412-80084434 ATTCACACTCCCTTCTCTGTTGG + Intergenic
1144277606 17:13689052-13689074 CTCACCACTCTCTTGGCTGTGGG + Intergenic
1146744461 17:35314996-35315018 CCTCTCTCTCTGTTCTCTGTGGG + Intergenic
1147210600 17:38870584-38870606 CTTCTCACTCTCCAGGCCGTAGG - Intronic
1147319711 17:39638524-39638546 CTCCTCCTTCTCTTGTCTGCTGG + Intronic
1148095048 17:45046674-45046696 GTTCTCATTCTCCTGTGTGTAGG - Intronic
1148689091 17:49516436-49516458 CTACTCACTCTCTGGGCTCTGGG - Intergenic
1154191173 18:12232012-12232034 CTTCCCACTCTGTTCACTGTGGG - Intergenic
1154943703 18:21139030-21139052 ATTCTCTCTCTCATGTCTGTGGG + Intergenic
1155382394 18:25238590-25238612 CCTCTCACACCCTTGCCTGTAGG + Intronic
1155857463 18:30850815-30850837 CTTCTAACTAACTTGTCTCTGGG - Intergenic
1157413254 18:47481540-47481562 CTTCCCAGTCTCTTTTATGTTGG + Intergenic
1158112074 18:53951523-53951545 CTTTTCCTGCTCTTGTCTGTGGG + Intergenic
1158960857 18:62586736-62586758 CTTCTCTATGTGTTGTCTGTGGG + Intronic
1160251251 18:77205084-77205106 TTTCTTTCTCTCCTGTCTGTTGG + Intergenic
1160424271 18:78769505-78769527 CTTGTGACTTTCTTGTCTCTGGG + Intergenic
1160879217 19:1311888-1311910 CTGCTCACCCTCCTGCCTGTGGG + Intergenic
1162494932 19:11018303-11018325 CTCCTCAGTCTCTAGGCTGTCGG + Intronic
1164994335 19:32708590-32708612 GTTATTACTCTCTTGACTGTAGG + Intronic
1167437255 19:49486638-49486660 CTTCTCACTTTCTGGACTGTCGG - Intergenic
925572316 2:5325401-5325423 CTTTTCATTTTGTTGTCTGTAGG + Intergenic
925963017 2:9036077-9036099 ATTGCCTCTCTCTTGTCTGTTGG - Intergenic
926631458 2:15140199-15140221 CTTGTCACTCACTTGTCTCACGG - Intergenic
927221024 2:20709648-20709670 TTTCTAATTCTCTTGTCTATAGG - Intronic
929321844 2:40553495-40553517 CTTCTCACTCAGTGGTCTGAAGG - Intronic
930432497 2:51297468-51297490 CTTCCCACTCTTCTGCCTGTTGG - Intergenic
931018829 2:58018748-58018770 CTTGTAATTCTCTTCTCTGTGGG + Intronic
931282699 2:60808054-60808076 CCTCTCCCTCTCTTGTCCATGGG - Intergenic
931720072 2:65061272-65061294 CTTCTCACTCACTTATCTGTTGG - Intronic
932708135 2:74042743-74042765 CTTCTCCTTCTCTTGCCTGTTGG + Intronic
934725280 2:96612954-96612976 CTTCTCACTCACTGGTTTTTGGG - Intronic
934776437 2:96940646-96940668 CTCCTCCACCTCTTGTCTGTAGG - Intronic
934784859 2:96997673-96997695 CGTCTCTCTCTCATGTCTGTCGG - Intronic
936706058 2:115075025-115075047 CTTCTCACTCTCTTGTCTGTGGG - Intronic
937403143 2:121602991-121603013 CTTTTTACTCTCTTGTTTCTTGG - Intronic
937441906 2:121922654-121922676 GAGCTCACTCTCATGTCTGTAGG + Intergenic
938256391 2:129862902-129862924 CTTCTCTCTCTCTGCACTGTGGG + Intergenic
938337267 2:130511084-130511106 CTTCTTCCTCTCTAGTCAGTTGG + Intergenic
942401835 2:175610967-175610989 CTTCTCTCTCTCCTCTCTGGAGG + Intergenic
943135585 2:183907192-183907214 CTTCTCCCTCTCCTGCCTGATGG - Intergenic
943325509 2:186492922-186492944 TTTCTCATTCTCTTGTTTATGGG - Intronic
948566673 2:238891652-238891674 CTTCTCGCTTTCTTGTCTCAAGG - Intronic
948669046 2:239554946-239554968 CTCCTCCCTCTCCTCTCTGTCGG - Intergenic
948939704 2:241189674-241189696 CCTCTCCCTCTCTTATCCGTAGG - Intronic
1168863198 20:1061019-1061041 CTTCTCACTCATGGGTCTGTAGG + Intergenic
1169551903 20:6709632-6709654 CTTATCAATCTCTTGTCTTCTGG - Intergenic
1170402488 20:16003408-16003430 GTTTTCACTGTCTTGTCTCTAGG - Intronic
1170530785 20:17288733-17288755 CTTCTCACACTGCTGTCTGTGGG - Intronic
1172726224 20:37044250-37044272 CTTCTCACTTTCTCCTCTGCAGG - Exonic
1173464335 20:43269100-43269122 CTTCTCATTCTCTTTGCGGTTGG - Intergenic
1173628907 20:44495130-44495152 CTTCTCTCTCTCTTCTATCTGGG - Intergenic
1175542735 20:59757992-59758014 CTTCTCTCTCTCCATTCTGTGGG - Intronic
1177498015 21:21914241-21914263 CTTCTCTCTCTCTTATCCTTTGG - Intergenic
1178720499 21:35004904-35004926 CATCTCACTCTCTTATCAGCAGG + Intronic
1182189450 22:28443239-28443261 GTTCTCAGTCTCTTCTCTGAGGG - Intronic
1182874393 22:33678280-33678302 CTTCTCACTCTGTCCTTTGTAGG - Intronic
1184149453 22:42629772-42629794 CTTCTCACCCTCTGTTCTGCAGG + Intronic
1184303067 22:43574448-43574470 CATCTCACTGTCATGCCTGTTGG - Intronic
1184797247 22:46739337-46739359 CTTGTGACTGTCTTGTCTATAGG + Intergenic
949141198 3:635520-635542 CTCATCACTCTCTTATCTCTGGG - Intergenic
949775940 3:7632324-7632346 ATTCTCAGTCTCTTGTGTGATGG + Intronic
950626622 3:14252257-14252279 CTTCTAATTCTCTTGCCTTTAGG + Intergenic
951170324 3:19534207-19534229 CTCCTCACACTCTTTTCTGCAGG - Exonic
951406508 3:22306273-22306295 CTTCTCAGACTCTTGTCTAATGG + Intronic
952007287 3:28856550-28856572 CTTATCTCTCTCTTGTATGTTGG - Intergenic
952636870 3:35543455-35543477 GTATTAACTCTCTTGTCTGTTGG - Intergenic
953637482 3:44675549-44675571 CTCCTCACTTGCTTGTCTGCAGG - Intergenic
956562197 3:70591942-70591964 CTTCTTACTCCTTTGCCTGTTGG + Intergenic
956723500 3:72138464-72138486 CCTCTCACTCACGTGTCTGGTGG - Intergenic
956776071 3:72566616-72566638 CTGCTCACTCACATGGCTGTGGG + Intergenic
956903198 3:73738011-73738033 CTTCTTGCACTCTTGTCAGTAGG - Intergenic
957355679 3:79082735-79082757 CTTCTCACTCCCATGCCTCTTGG + Intronic
958455110 3:94321026-94321048 CTACTCACTCTTGTGTGTGTGGG - Intergenic
959385673 3:105702335-105702357 CTACTCAGTCTATTGTCTGGTGG + Exonic
959730205 3:109592411-109592433 CTTCTCACCCTCTCATCTTTTGG - Intergenic
960124194 3:113980245-113980267 TTTCTCACTCATATGTCTGTGGG - Intronic
961312343 3:126011074-126011096 CGTCTCACTCTGCTGTCTGTTGG - Intronic
961648867 3:128407605-128407627 CTTCCCACACTCTGGCCTGTTGG + Intronic
961895090 3:130160173-130160195 CTTCTCCCTCCCTTATCTGAAGG - Intergenic
964937550 3:162110277-162110299 CTTTTTACCCTCTTGTGTGTTGG + Intergenic
965673664 3:171173020-171173042 CTGTTCACTCACTTTTCTGTGGG + Intronic
965873780 3:173292054-173292076 ATTCTCAATCTGTTGTATGTTGG - Intergenic
967714550 3:192747398-192747420 CTTCTCTCACTGTTGTCAGTTGG + Intronic
967979918 3:195059602-195059624 ATTCCCACTTTCTTGTCTTTTGG + Intergenic
969005188 4:4013230-4013252 CTTCTCCCTCCCTTATCTGAAGG - Intergenic
969747676 4:9086921-9086943 CTTCCCACTCCCTTATCTGAAGG + Intergenic
969808723 4:9631444-9631466 CTTCTCCCTCCCTTTTCTGAAGG + Intergenic
972007148 4:34123832-34123854 CTTCTCACTCTTGAGTCTGAAGG + Intergenic
972050680 4:34729198-34729220 TTGCTCACTCTGTTGTGTGTGGG + Intergenic
972374957 4:38461214-38461236 CTTGTTTTTCTCTTGTCTGTTGG + Intergenic
972512351 4:39780730-39780752 TTTGTTATTCTCTTGTCTGTGGG + Exonic
975657907 4:76660032-76660054 CTTCACACTCTCGAGTCTGGTGG - Intronic
978021729 4:103823177-103823199 GTTCTGATTCTCTTTTCTGTGGG + Intergenic
978747966 4:112215819-112215841 CTTCCAACTCTAGTGTCTGTAGG + Intergenic
979140340 4:117164466-117164488 CTTCTGGCTCTCTTGGCTGCTGG - Intergenic
979179108 4:117703024-117703046 CTTCTCTGCCTCTTGTCTTTGGG - Intergenic
979530981 4:121769048-121769070 CTTCTCAGTCTCCTCCCTGTGGG + Intergenic
980314571 4:131180903-131180925 CTTCTCACCATTTTTTCTGTGGG + Intergenic
980517679 4:133885899-133885921 GTTCTTACTCACTTGTATGTGGG + Intergenic
981918742 4:150063676-150063698 CTTTTTACTCTCTTGTTTTTAGG + Intergenic
982028962 4:151279781-151279803 CTTCTCTTTCTCTAGTGTGTGGG + Exonic
982200007 4:152950838-152950860 CTTTTCACTCTAGTTTCTGTGGG - Intronic
982979605 4:162116084-162116106 CCTCTCACTCTGTTGTGAGTGGG + Intronic
983011109 4:162548910-162548932 CTTCTCTCTCACTTGTCAGCTGG + Intergenic
983877630 4:172895624-172895646 CTTTTCACTTTCTTCTGTGTGGG + Intronic
985976027 5:3419780-3419802 CTTCTCACTCTCTGGAATGCGGG + Intergenic
986130112 5:4922338-4922360 CTTCTTATTCTCTTGTATGCCGG + Intergenic
986276175 5:6277039-6277061 CTCCTCTCTTTCTTCTCTGTTGG - Intergenic
989809201 5:45652254-45652276 CTTCACATACTCTTGTTTGTGGG + Intronic
991500310 5:67269796-67269818 CGTCTCACCCTCTTATCTGCAGG + Intergenic
991651903 5:68864120-68864142 GTTCTCACTCTCATTTCTGCAGG + Intergenic
993344660 5:86768030-86768052 CTTATCACTGTTTTGTCTTTAGG - Intergenic
995320494 5:110828185-110828207 CTTCTCTCTCTTTTTTTTGTGGG - Intergenic
997083772 5:130772083-130772105 TTTCTCTCTCTCTTGTTTTTAGG + Intergenic
997400452 5:133597951-133597973 CTCCTCCCTGGCTTGTCTGTAGG - Intronic
997440083 5:133902926-133902948 CTTCTCACCCTTTTGTGTGTTGG - Intergenic
997879643 5:137578157-137578179 TTTCTCACTCTCTTTTCTTTTGG - Intronic
999922393 5:156335847-156335869 CTTCTCACCCACCTGTCTATAGG + Intronic
1001044304 5:168360070-168360092 TTCCTCAATGTCTTGTCTGTGGG + Intronic
1001096753 5:168781241-168781263 GTTCTCCCTCTCTGGTCTCTAGG - Intronic
1001156414 5:169276172-169276194 CATCTCACTGTGTTGTCTGATGG - Intronic
1003575388 6:7289058-7289080 CTACTCACTCAGTTGTGTGTAGG - Exonic
1004087235 6:12462256-12462278 ATTCTCAAGCTCCTGTCTGTGGG - Intergenic
1004127681 6:12889312-12889334 CCTCTCTCACCCTTGTCTGTGGG - Intronic
1005797426 6:29380329-29380351 TTTCTCACTCTGGTGTCTGTGGG - Intronic
1005867870 6:29949798-29949820 CTTCTCACCTGCTTGTCTCTGGG - Intergenic
1006183761 6:32169021-32169043 CCTCCTACTGTCTTGTCTGTGGG - Exonic
1008250554 6:49234256-49234278 CTTTTCTGTCTCTTGTCTTTTGG - Intergenic
1008692908 6:54000978-54001000 CATCTTACTCTTTTGGCTGTTGG + Intronic
1010532796 6:76989252-76989274 CCTCTCTCTCTCTTTCCTGTGGG + Intergenic
1012411847 6:98967641-98967663 ATTCTCACTCTATTCTCTTTTGG + Intergenic
1012759873 6:103285741-103285763 CCTCTCTCACTCTTGTATGTTGG - Intergenic
1013607532 6:111764357-111764379 CATCTCACTCTCACGGCTGTGGG + Intronic
1013739967 6:113271342-113271364 CTTCTCAGTCTCTAATCTGGAGG + Intergenic
1014016047 6:116531304-116531326 CTGCTTACTCTCTTTTCTCTGGG - Intronic
1015841289 6:137479926-137479948 CTTCTCCCTCTCCTTTCTCTAGG - Intergenic
1016021962 6:139245442-139245464 CTACTCACATTCTTGTTTGTAGG + Intronic
1018234416 6:161710129-161710151 TTTTTCCCTCTCTTTTCTGTAGG - Intronic
1018336650 6:162798180-162798202 CTTTTCCCTCTCTATTCTGTCGG + Intronic
1018804300 6:167246997-167247019 TTGCTAACTCTCTTGTGTGTGGG + Intergenic
1020325323 7:6969714-6969736 CTTCTCCCTCCCTTATCTGAAGG - Intergenic
1020941460 7:14543479-14543501 CTTCTAACTCTATTGTATTTAGG - Intronic
1021079475 7:16346986-16347008 ATTCTTAATCACTTGTCTGTGGG - Intronic
1021141045 7:17025945-17025967 TTTTTCATTCTCTTGTCTATTGG + Intergenic
1021240819 7:18198946-18198968 CTTCTCACTTTCTGGTATGCAGG + Intronic
1022804097 7:33804542-33804564 GTTATCTCTCTGTTGTCTGTAGG + Intergenic
1023498739 7:40826002-40826024 CTTCTTAATATATTGTCTGTAGG - Intronic
1024965895 7:55021525-55021547 CTACTCTCTCTCTTGTCTTCAGG - Intronic
1024969666 7:55056975-55056997 ATTCTGACTCTCTGCTCTGTTGG - Intronic
1026177276 7:68008972-68008994 CTTCTCTCTTTCTTGTTTGAAGG - Intergenic
1028254700 7:88579481-88579503 CATCTCAATATCTTGTCTGGTGG + Intergenic
1028460485 7:91086404-91086426 TGTCTCTCTCTCTTTTCTGTTGG + Intronic
1029696661 7:102218037-102218059 CTTCTCACTCGCTTGGCAGCAGG + Intronic
1031004522 7:116456735-116456757 CTCTACACTCTCTTTTCTGTGGG + Intronic
1031089191 7:117333210-117333232 CTTCTCCCTCTCTTGAATCTGGG - Intergenic
1032295324 7:130632639-130632661 TTTCTCTCTCTCTTTTCAGTTGG + Intronic
1032452942 7:132050077-132050099 CTTCTTTTTCTCTTGGCTGTGGG - Intergenic
1034364277 7:150533280-150533302 TTTCTCTCTCTCTTGACTGCTGG + Intergenic
1035120452 7:156562314-156562336 CTGCTCACCCTCATGGCTGTGGG - Intergenic
1035611654 8:969647-969669 CTTATTTCTCTCTTGTCTGCAGG + Intergenic
1036370746 8:8161095-8161117 CTTCTCCCTCCCTTATCTGAAGG + Intergenic
1036567005 8:9946291-9946313 CTGCTCACTCTCCTGGCTGTTGG + Intergenic
1036880147 8:12504535-12504557 CTTCTCCCTCCCTTATCTGAAGG - Intergenic
1037401407 8:18498580-18498602 CTTCTCACTCCCTGCTCTGTTGG - Intergenic
1038145002 8:24887345-24887367 GTTCTCACTCTCTGGTGTCTGGG + Intergenic
1044639292 8:94361560-94361582 CTTCTCCTTCTCTTTCCTGTTGG + Intergenic
1045507640 8:102789765-102789787 CTTCTCAGCTTCTTATCTGTGGG + Intergenic
1046482890 8:114846524-114846546 TGTCTCACTTTCTTCTCTGTTGG - Intergenic
1046508584 8:115169738-115169760 ATTTTCACTCTGTTGTCTTTTGG - Intergenic
1047382372 8:124375082-124375104 CTTCTCACTCTGTTTTATGTTGG + Intergenic
1050204768 9:3184644-3184666 TTTCTCCCTCTCCTGTCTCTGGG - Intergenic
1050628158 9:7529253-7529275 CTTTTCACTATCTTGTATGTTGG + Intergenic
1051773843 9:20612595-20612617 CTTGTCATTTTCTTGTTTGTAGG - Intronic
1052067929 9:24045643-24045665 TTTCTCAATCTCTTGACTCTGGG - Intergenic
1053035467 9:34823742-34823764 CTGCCCACACTCTGGTCTGTGGG + Intergenic
1053509075 9:38671963-38671985 CTTCTTACTCTCCTACCTGTGGG + Intergenic
1057627536 9:96691218-96691240 CTTCTCACAGTTTTGTCAGTTGG - Intergenic
1058186460 9:101861086-101861108 CTTCCCAGTCTATTTTCTGTTGG + Intergenic
1059254484 9:112916951-112916973 TTTCTCACTCACAGGTCTGTGGG + Intergenic
1059361673 9:113747374-113747396 CATCTCTCTCTCTTTTCTTTGGG + Intergenic
1059822143 9:117985066-117985088 TTTTTCACTCCCTTTTCTGTGGG - Intergenic
1187828007 X:23352303-23352325 CTTCTCATTCCCTTGTCAGTTGG - Intronic
1192802703 X:74482391-74482413 TTTCTCGCTCTCTTCTCTTTGGG + Intronic
1194640890 X:96402616-96402638 CTTTTTACTGTCTTGGCTGTTGG - Intergenic
1194858980 X:98971261-98971283 CTTCTCATTCTGATGTCTGATGG - Intergenic
1195164557 X:102206257-102206279 CTGCTCCCTCCCTTGGCTGTTGG + Intergenic
1195194302 X:102480837-102480859 CTGCTCCCTCCCTTGGCTGTTGG - Intergenic
1195788643 X:108557034-108557056 CTTATTCCTCTCTTATCTGTAGG + Intronic
1199045472 X:143165385-143165407 TTTTTCAATCTCTTGTCTTTAGG - Intergenic
1199349314 X:146781742-146781764 CTTGTCACTCACTTCTTTGTGGG + Intergenic