ID: 936706059

View in Genome Browser
Species Human (GRCh38)
Location 2:115075026-115075048
Sequence GCTTCTCACTCTCTTGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936706059_936706063 13 Left 936706059 2:115075026-115075048 CCACAGACAAGAGAGTGAGAAGC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 936706063 2:115075062-115075084 TCATGGTATAAATCATATGATGG 0: 1
1: 0
2: 0
3: 15
4: 167
936706059_936706061 -10 Left 936706059 2:115075026-115075048 CCACAGACAAGAGAGTGAGAAGC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 936706061 2:115075039-115075061 AGTGAGAAGCAGTTATACGTGGG 0: 1
1: 0
2: 1
3: 5
4: 110
936706059_936706062 -4 Left 936706059 2:115075026-115075048 CCACAGACAAGAGAGTGAGAAGC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG 0: 1
1: 0
2: 0
3: 2
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936706059 Original CRISPR GCTTCTCACTCTCTTGTCTG TGG (reversed) Intronic
901169765 1:7248158-7248180 GCTTCATATTCTATTGTCTGGGG - Intronic
902508571 1:16953454-16953476 GCTTCTCACTCTCTGCTAGGAGG - Exonic
902783309 1:18717840-18717862 GTTTGTCACTTGCTTGTCTGTGG - Intronic
903411036 1:23143033-23143055 GAGTCTTACTCTCTTGTCCGGGG + Intronic
905034381 1:34907770-34907792 ACTTCTCACTCTCTTGCTTATGG - Intronic
907018219 1:51038410-51038432 GCCTTATACTCTCTTGTCTGGGG - Intergenic
907090946 1:51724806-51724828 GCTTTACAATCTCTTCTCTGGGG + Intronic
907728501 1:57043446-57043468 GCCTCTCTCCCTCTTCTCTGTGG + Intronic
908136098 1:61134310-61134332 GCTTCTCAATTTCTTTTCTTAGG + Intronic
908553389 1:65232666-65232688 GCCTCACACTCTCCTGTCTCTGG + Intergenic
910472430 1:87569331-87569353 GTTTTTCACACTCTTGTCTCAGG - Intergenic
910980561 1:92956486-92956508 TCTTCTCCCTCTATTGTCTTTGG + Intronic
911073984 1:93855315-93855337 ACTTCTCACTCCTTTGTTTGTGG - Intergenic
911361072 1:96877080-96877102 GCTTCTCAGTGTCTGGTCTTCGG - Intergenic
911868373 1:103057945-103057967 GCTTCAAACTCTCTTGTTAGGGG - Intronic
913296070 1:117321701-117321723 GCTTCTATCTCTCCTCTCTGTGG + Intergenic
913554112 1:119947972-119947994 CCTTCTCTCTTTCTTGCCTGTGG - Intronic
914730868 1:150369267-150369289 TCTTCTTTCTCTCTTTTCTGTGG + Intronic
916454752 1:164959368-164959390 GCATCTCCCTCTCTTTTCTCAGG + Intergenic
916709733 1:167393522-167393544 GGGTCTCACTCTCTTGGCTCTGG + Intronic
917046505 1:170866383-170866405 GCATCTTACTCTGCTGTCTGAGG + Intergenic
917675368 1:177313738-177313760 GCTGCTTAGTCTCTTGCCTGAGG - Intergenic
918083319 1:181223982-181224004 GCTTCTGATTCTACTGTCTGAGG - Intergenic
919357901 1:196549362-196549384 TCTTCTCACTCTCTAGTGTGGGG - Intronic
920091728 1:203458286-203458308 TCTTCTCACTCTGTCCTCTGTGG + Intergenic
921939124 1:220821969-220821991 TCCTCACACTCTCTTGTTTGGGG + Intergenic
924407794 1:243769773-243769795 CCTTCTCACTTTCTTGACAGCGG + Intronic
924951196 1:248885159-248885181 GGATCTCACTCTTTTGCCTGGGG + Intergenic
1063020389 10:2121034-2121056 GCTTCTCAATGTCTTTTCAGAGG - Intergenic
1063110272 10:3029604-3029626 CCTTCTCCCTCTATTATCTGCGG - Intergenic
1063179489 10:3584861-3584883 TCTTCTCAAGGTCTTGTCTGTGG + Intergenic
1063553004 10:7051141-7051163 ACTTCACAGTCTCTTGCCTGTGG - Intergenic
1063609526 10:7551511-7551533 GTTTCTCACCAGCTTGTCTGGGG + Intergenic
1064349031 10:14559549-14559571 GCTTCTCACTCAGTTTTCAGAGG + Intronic
1065440783 10:25751483-25751505 TCTGATCACTCTCTTCTCTGAGG - Intergenic
1067566178 10:47339578-47339600 CCTTCTCTCTCTCTTGCCTAAGG - Intergenic
1068392411 10:56415013-56415035 ACTTCTCACTCATTTATCTGAGG - Intergenic
1069871223 10:71534330-71534352 TCTTGCCACTCTCATGTCTGGGG + Intronic
1072202566 10:93174184-93174206 GCTTTTCAGCCTATTGTCTGGGG - Intergenic
1073543816 10:104333034-104333056 ATTTCTCACTCTCTTTTGTGGGG + Intronic
1075037325 10:119080444-119080466 CCTTCTCACTCTATCGACTGGGG - Intronic
1075922410 10:126224451-126224473 GTTTCTCCCTCTCCTGCCTGGGG - Intronic
1076442992 10:130493016-130493038 ACTCCTCCTTCTCTTGTCTGCGG + Intergenic
1077216265 11:1396405-1396427 GGTTCTCACTCCCGAGTCTGCGG + Intronic
1078446669 11:11409838-11409860 ACTTCTGTCTGTCTTGTCTGAGG + Intronic
1079597939 11:22275143-22275165 CTGTCTCACTCTCTTTTCTGAGG - Intronic
1079836085 11:25334483-25334505 GCTTGTCACATTCTTTTCTGTGG - Intergenic
1080609742 11:33893626-33893648 CCTTCTCTCTCTCTTTTCTGGGG - Intergenic
1080689330 11:34543192-34543214 GCTTCTCACGCTCTCCTCTTTGG + Intergenic
1081598377 11:44475058-44475080 GCTCCTCCCTCTCTTCTCTCTGG - Intergenic
1081703684 11:45168049-45168071 GCTTCTCAAGCTATGGTCTGTGG - Intronic
1081800546 11:45856105-45856127 GAATCTCACTGTCTTCTCTGGGG - Intronic
1082063670 11:47881603-47881625 GGTTCTCAATCTCTAGCCTGGGG + Intergenic
1083694235 11:64431985-64432007 GCTTCTCACTGTCTTATCGGGGG + Intergenic
1084913645 11:72411327-72411349 GCTTCTCAGTCTCAGGGCTGAGG + Intronic
1085339151 11:75720041-75720063 GCTCCTCACTGTCCTGTATGCGG + Exonic
1085397524 11:76214337-76214359 GCCTCTCCCTCCCATGTCTGCGG + Intergenic
1085409771 11:76284181-76284203 GCTGCTCCCTGTCTGGTCTGTGG + Intergenic
1086849576 11:91793462-91793484 GATACTAACTCTCATGTCTGTGG - Intergenic
1089714052 11:120338819-120338841 GCTTTTCACTCACTTGTGTGTGG - Intronic
1090273889 11:125406221-125406243 GGGTCTGACTCTCTTTTCTGAGG - Intronic
1091278876 11:134370698-134370720 GCCCCTCACTCTCCTCTCTGAGG - Intronic
1091543899 12:1487689-1487711 GGGTCTCCCTCTATTGTCTGGGG - Intronic
1092953637 12:13530130-13530152 CCTTCTGGCTTTCTTGTCTGGGG - Intergenic
1094247496 12:28316845-28316867 TCTTCTCTCTCTATTGTCTCTGG + Intronic
1094761001 12:33532864-33532886 GTTTCTCATTCTTTTGTCAGAGG + Intergenic
1095762400 12:45854331-45854353 TCTCCTCACTCCCTGGTCTGTGG + Intronic
1095812809 12:46388616-46388638 GCCCCTCACACTCTTGTATGAGG + Intergenic
1096556555 12:52407524-52407546 GCTTCCCATTTTCCTGTCTGTGG - Intergenic
1097636917 12:62134026-62134048 ACACCTCACTCTCTTTTCTGAGG + Intronic
1098009635 12:66036742-66036764 GGTTCTGACTCAGTTGTCTGGGG + Intergenic
1099222351 12:79930139-79930161 GATTCACATTCTCTTTTCTGGGG - Intronic
1100706107 12:97202282-97202304 TCTTCCCACTATCTTGTCTGTGG + Intergenic
1100887989 12:99093607-99093629 GCAACTCACTCTCTTTTCTCTGG - Intronic
1101477252 12:105062638-105062660 GCTTCCCACTCGCTGGTCTTGGG - Intronic
1101885605 12:108658768-108658790 GACTCTCACTTTCTTGTCTTTGG + Exonic
1103880479 12:124162377-124162399 TCTTCTCATTCTCTTGGCTAAGG - Intronic
1104327365 12:127812193-127812215 GCTTCTTTCCCTCTTGACTGGGG - Intergenic
1104492099 12:129203205-129203227 GCACCTCACTCTGTTTTCTGTGG + Intronic
1106569266 13:30912202-30912224 ACTTCTCACTCTAATGTGTGTGG - Intronic
1107441388 13:40430388-40430410 CCCTCTCCCTCTCCTGTCTGTGG - Intergenic
1108448707 13:50537129-50537151 GTTCTTCACTCTCTTGTCTATGG + Intronic
1108806227 13:54159735-54159757 GCTTGTCTCTCTCCTGCCTGTGG - Intergenic
1110252591 13:73397270-73397292 GCTTCCCTTTCTCTTGTTTGGGG - Intergenic
1110561287 13:76912979-76913001 GCTGATTACTCTCTTCTCTGTGG + Intergenic
1110751896 13:79124296-79124318 GCTTCTCAATGTCTGGGCTGGGG + Intergenic
1111217298 13:85160636-85160658 ACTTCAGACTCTCTTGTTTGTGG + Intergenic
1111502794 13:89145026-89145048 TTTTCCCACTCTCTAGTCTGAGG + Intergenic
1113286746 13:108858090-108858112 GCTTCCCAATGTGTTGTCTGTGG + Intronic
1114229780 14:20770102-20770124 GCTTTTCTTTCTCTTCTCTGTGG + Intronic
1114519495 14:23324342-23324364 GCTTCCTCCTCTCTGGTCTGAGG + Intronic
1115021801 14:28690092-28690114 ACTTCTCACTTTGTTGTCTTTGG + Intergenic
1115471837 14:33776005-33776027 GCTTTTGAATCTCTTGGCTGAGG - Intronic
1116334170 14:43635999-43636021 ACTTCTCTATCACTTGTCTGAGG + Intergenic
1118650357 14:67885247-67885269 ACTTGTCACTCTCTTGTGTTTGG + Intronic
1121118303 14:91358971-91358993 GATTCTTACTCTCTTGTCTAAGG + Intronic
1122375642 14:101255287-101255309 TCTTCTCACTCTCCAGCCTGTGG + Intergenic
1122485937 14:102079825-102079847 TCTTCTCACTCACTGGGCTGGGG + Intergenic
1122679082 14:103442954-103442976 TCTTCTCACTTCCTTGTCGGTGG - Intronic
1127283125 15:57509135-57509157 TCTTCTCACCATCATGTCTGTGG - Intronic
1129363391 15:75039033-75039055 TCTTCTCCCTCTATTGTCTCTGG + Intronic
1130114381 15:80993733-80993755 TCTTCTCACTCACTTCTCGGGGG + Intergenic
1130731134 15:86493297-86493319 GCCACTCACTTTCTTGTTTGGGG + Intronic
1130879583 15:88043604-88043626 GGTTCTCATTCTCTTGGCTTTGG - Intronic
1131260855 15:90886963-90886985 GCTTCTCAATGTCCTGGCTGTGG - Exonic
1132083801 15:98890147-98890169 GCTACTCACCCACTTGTCAGAGG + Intronic
1134036114 16:11032684-11032706 CCTTCTCACTCTCTGGGCTGTGG - Intronic
1136934346 16:34445022-34445044 TCTTCTCATTCTCTTATCTATGG - Intergenic
1136970226 16:34966792-34966814 TCTTCTCATTCTCTTATCTATGG + Intergenic
1139189757 16:64848585-64848607 TCTTCTCACTTTCTTGTCCCGGG - Intergenic
1139573545 16:67827725-67827747 GCCTGTCACTCTCTTTCCTGTGG + Intronic
1140868696 16:79087247-79087269 GCTTCACACGCTCCTGGCTGGGG - Intronic
1140887831 16:79260014-79260036 GCTGCCCACTCTCTTAGCTGGGG - Intergenic
1142532051 17:586257-586279 GTTCCTCACTCACTTGTCTTGGG + Exonic
1146744459 17:35314995-35315017 GCCTCTCTCTCTGTTCTCTGTGG + Intergenic
1147717720 17:42519552-42519574 GCTTCTCACCCACTTGTGTTAGG - Intronic
1147875610 17:43618477-43618499 CCTTCTCTCTCTCTTCCCTGGGG + Intergenic
1149005512 17:51801197-51801219 GTTTTACACTCTCTTCTCTGTGG - Intronic
1153469282 18:5425685-5425707 TCTTCTCACTCACTTTTCTCAGG + Intronic
1154943702 18:21139029-21139051 TATTCTCTCTCTCATGTCTGTGG + Intergenic
1154968307 18:21381575-21381597 GCTACTCACTAACTTGTCTTTGG - Intronic
1155857464 18:30850816-30850838 GCTTCTAACTAACTTGTCTCTGG - Intergenic
1156448876 18:37255238-37255260 TCTTCTCAGTTTATTGTCTGTGG + Intronic
1157942486 18:51944554-51944576 CCTTTTCATTCTCTTGTGTGAGG + Intergenic
1158960856 18:62586735-62586757 GCTTCTCTATGTGTTGTCTGTGG + Intronic
1160155163 18:76428364-76428386 GAATCTCACTCTGTTGTCTAGGG - Intronic
1160424270 18:78769504-78769526 GCTTGTGACTTTCTTGTCTCTGG + Intergenic
1162799284 19:13102170-13102192 GGTTCTCACTCTGTTGTCCAGGG + Intronic
1163074121 19:14873875-14873897 TCTTCTTACTGTCTTGTCTGGGG - Intergenic
1163465374 19:17465153-17465175 GGGTCTCACTCTATTGCCTGGGG - Intergenic
1164233406 19:23311136-23311158 GTGACTCACTCTCTTGCCTGGGG + Intronic
1167463541 19:49638639-49638661 GCTTCTCACGCTGTGCTCTGAGG - Intronic
925180906 2:1816431-1816453 GCTCCTCCCTCTCTCCTCTGGGG - Intronic
929629666 2:43446501-43446523 GCTTCACACTCACATTTCTGGGG - Intronic
929925566 2:46204403-46204425 ACTTCTCACTCCATTGTCTGTGG - Intergenic
931148487 2:59546031-59546053 GGCCCTCACTCTCATGTCTGGGG - Intergenic
931863388 2:66381248-66381270 CCTTCTGGCTTTCTTGTCTGTGG - Intergenic
933185015 2:79268983-79269005 GTTTCTCATTTTCTTGTGTGCGG + Intronic
936706059 2:115075026-115075048 GCTTCTCACTCTCTTGTCTGTGG - Intronic
938204400 2:129405539-129405561 GTTTCTCTCTCTCTTTTCTTTGG - Intergenic
940703628 2:157076879-157076901 GCTACCCACTCATTTGTCTGAGG + Intergenic
941848576 2:170156733-170156755 GCTTTCCATTCTCTTGTCAGAGG - Intergenic
1169292360 20:4363715-4363737 ACTTCTCCCTCCCTTGCCTGTGG - Intergenic
1169846999 20:10004789-10004811 GCTACACACTTTCTTGTGTGGGG - Intronic
1170530786 20:17288734-17288756 TCTTCTCACACTGCTGTCTGTGG - Intronic
1170647795 20:18212392-18212414 GCTTCTTCCTCTTGTGTCTGTGG + Intergenic
1175685575 20:61025687-61025709 CCTTCTGAGTCTATTGTCTGGGG - Intergenic
1176552606 21:8235360-8235382 GCTTCTCACTCTCGTGGAAGGGG - Intergenic
1176571504 21:8417763-8417785 GCTTCTCACTCTCGTGGAAGGGG - Intergenic
1176579416 21:8462326-8462348 GCTTCTCACTCTCGTGGAAGGGG - Intergenic
1181166744 22:20987988-20988010 GTTTCTCACTCTCTTTACTCAGG + Exonic
1181547139 22:23608519-23608541 TCTTCTCACTCTCTTGCCAAAGG + Exonic
1182189451 22:28443240-28443262 CGTTCTCAGTCTCTTCTCTGAGG - Intronic
1182624069 22:31633320-31633342 GATTCTCACACTCTTCCCTGTGG + Intronic
1182915233 22:34023339-34023361 CCTTCTCACTCCTGTGTCTGCGG - Intergenic
1184008870 22:41731783-41731805 GCATCTCTCTCCCTTTTCTGAGG - Intronic
1184701100 22:46173200-46173222 TCTTTTCACTCTCTTATTTGGGG + Intronic
1185098542 22:48825249-48825271 GCCTCTCACTCCCTTCTCTGGGG - Intronic
1203257585 22_KI270733v1_random:151762-151784 GCTTCTCACTCTCGTGGAAGGGG - Intergenic
949141199 3:635521-635543 GCTCATCACTCTCTTATCTCTGG - Intergenic
949449202 3:4166614-4166636 CCTTCTGCCTCTCTTCTCTGAGG - Intronic
951039718 3:17976238-17976260 GCTTCTTACACTCTGGTTTGGGG - Intronic
951219199 3:20051673-20051695 GCTTCTCACTGTCATTCCTGGGG - Intronic
952556159 3:34533547-34533569 GCTTTTCACTTAATTGTCTGTGG + Intergenic
953268639 3:41417743-41417765 GCTTCTCACTGGCTTGACTATGG + Intronic
955224584 3:57050338-57050360 TCTTCTCACTCTCTACTCTCAGG + Intronic
955933691 3:64082234-64082256 TCCTCTTACTCTCTTCTCTGAGG - Intergenic
956776070 3:72566615-72566637 GCTGCTCACTCACATGGCTGTGG + Intergenic
957590198 3:82186484-82186506 GCTGCCCACTCTCATCTCTGAGG + Intergenic
961394884 3:126579579-126579601 TCCTCTCCCTCTCTTGTGTGTGG + Intronic
965673663 3:171173019-171173041 GCTGTTCACTCACTTTTCTGTGG + Intronic
966709143 3:182952261-182952283 GCTTCTCACTTTCTTTTCCTGGG + Intronic
969114407 4:4862098-4862120 GCTGCTCCATCTCTGGTCTGCGG + Intronic
969745416 4:9067258-9067280 GCTTGTCTCTCTCTGGCCTGTGG + Intergenic
971346407 4:25815658-25815680 GCGTCTCCCTCTCCTGTTTGCGG + Intronic
973165831 4:47076558-47076580 GCTTCTTTCTCTATTGTCTTCGG + Intronic
974805332 4:66872304-66872326 CTTTTTCACTCTGTTGTCTGAGG + Intergenic
975846962 4:78535169-78535191 CCTTCTCACTCTCCTGTCCCTGG + Intronic
976126295 4:81836969-81836991 GCTGCTCACACTTTTGTGTGTGG - Intronic
979597622 4:122551659-122551681 GTTTCTCACAATCTTTTCTGGGG - Intergenic
980727412 4:136782199-136782221 GCTTGTCACTATTTTGCCTGAGG - Intergenic
981943101 4:150307525-150307547 GGTTCTCACTCTGTTGTCCAGGG - Intronic
982522844 4:156440975-156440997 GCTTCTCACTCTCTGGCTTCAGG - Intergenic
982632513 4:157848897-157848919 GTTTCTCTCTCTATTGTTTGTGG - Intergenic
982979603 4:162116083-162116105 GCCTCTCACTCTGTTGTGAGTGG + Intronic
985137815 4:186805630-186805652 TCTTCTTACTCTCTTTTCTCTGG - Intergenic
985976026 5:3419779-3419801 TCTTCTCACTCTCTGGAATGCGG + Intergenic
985996292 5:3599120-3599142 GCTTCCCACTCTCCCGTCTTGGG + Intronic
986283282 5:6340844-6340866 GTTTCTCACTCTGGGGTCTGAGG - Intergenic
989809200 5:45652253-45652275 GCTTCACATACTCTTGTTTGTGG + Intronic
990259799 5:54009958-54009980 GCTCCTGACTCTCTTTACTGAGG + Intronic
991157301 5:63454086-63454108 GATTCTTACTCACATGTCTGAGG - Intergenic
991957423 5:72009438-72009460 GCTACTCACTCTCTTACTTGAGG + Intergenic
993249477 5:85499887-85499909 ACTTTTCACTATCTTGACTGTGG + Intergenic
995100891 5:108303960-108303982 GATTCTCAAGCTCTGGTCTGTGG - Intronic
995827368 5:116315742-116315764 TCTTATCACTCACTTGACTGTGG + Intronic
996396966 5:123022843-123022865 GGGTCTCACTCTGTTGCCTGGGG + Intronic
997408033 5:133668003-133668025 ACTTCTCACTCACATGTTTGTGG + Intergenic
999102617 5:149038885-149038907 GGTTCTCACACACTGGTCTGTGG - Intronic
1002136409 5:177110493-177110515 GTCTCCCACTCTCTGGTCTGGGG + Intergenic
1002990639 6:2235178-2235200 GATTCTAACTCTGTTGGCTGTGG - Intronic
1004760927 6:18665239-18665261 GGGTCTCACTCTGTTGCCTGGGG + Intergenic
1005797427 6:29380330-29380352 CTTTCTCACTCTGGTGTCTGTGG - Intronic
1006149448 6:31978874-31978896 TCTTTTCACTCTCTTCTCTGTGG + Intronic
1010543238 6:77118409-77118431 ACTCCTCATTCTCTGGTCTGTGG - Intergenic
1012424648 6:99100599-99100621 GGGTCTCACTCTGTTGCCTGGGG - Intergenic
1012535748 6:100294860-100294882 GCTTCTCATCCTCATGTCTCAGG + Intergenic
1013017959 6:106178340-106178362 GCTGTTCAATCTGTTGTCTGAGG + Intergenic
1014847034 6:126289895-126289917 GCTTCTCACTCTAGTATGTGAGG + Intergenic
1018163568 6:161071774-161071796 CCTTCTCACCCTCTTGTTTCTGG + Intronic
1018165459 6:161090369-161090391 GCTTCTCAGCCTCTTGGATGTGG + Intronic
1018165477 6:161090464-161090486 GCTTCTCAGCCTCTTGGATGTGG + Intronic
1018165495 6:161090559-161090581 GCTTCTCAGCCTCTTGGATGTGG + Intronic
1018165514 6:161090654-161090676 GCTTCTCAGCCTCTTGGATGTGG + Intronic
1018165534 6:161090749-161090771 GCTTCTCAGCCTCTTGGATGTGG + Intronic
1018674472 6:166206968-166206990 TCCTCACTCTCTCTTGTCTGCGG + Intergenic
1018677326 6:166234585-166234607 GCCACTCACTGTCTTGTATGAGG + Intergenic
1024228803 7:47348265-47348287 GGCTCTCAGTCACTTGTCTGTGG - Intronic
1029691548 7:102185449-102185471 GGGTCTCACTCTTTTGCCTGGGG + Intronic
1030315786 7:108112955-108112977 GCTTTTCACTCTCTTGACTCTGG + Intronic
1032780082 7:135158411-135158433 GCTCCTCCCTCTCTGGTCTCAGG - Intronic
1034521762 7:151625882-151625904 GCTTCTCGCTGCCCTGTCTGAGG - Intronic
1035120453 7:156562315-156562337 GCTGCTCACCCTCATGGCTGTGG - Intergenic
1035148340 7:156843274-156843296 GCTTCTCACACTGTGGTCAGGGG - Intronic
1035240324 7:157524766-157524788 GCCTCTCTCTTTCTTCTCTGGGG - Intergenic
1035390382 7:158500565-158500587 GTTTCACACACTCTTCTCTGTGG + Intronic
1037708455 8:21335489-21335511 GCTTGTCACTCTCTTCTCCATGG + Intergenic
1038752476 8:30308560-30308582 TCTTCTCAATCTCTTGACAGTGG + Intergenic
1038911268 8:31967432-31967454 GCTTCTGACTCCACTGTCTGAGG - Intronic
1040082753 8:43305255-43305277 GCTTCTCACCTTCTACTCTGTGG + Intergenic
1041862196 8:62527096-62527118 GCTCCTCTCTCTCTGGTTTGGGG - Intronic
1046966569 8:120173775-120173797 GTTTCTCACTCTCTTGAAAGAGG - Intronic
1049072718 8:140369262-140369284 GCTTCTAACTTACGTGTCTGTGG - Intronic
1053353389 9:37427998-37428020 CCTGCTCACTGTCCTGTCTGGGG + Intronic
1055392083 9:75833821-75833843 GCTGCTCACTGTCATTTCTGGGG - Intergenic
1055859244 9:80728705-80728727 GCTTCTCACTTAGTTGTCTTGGG - Intergenic
1056666661 9:88586686-88586708 GCTTCTTACTCTCCTGGGTGGGG + Intergenic
1056684784 9:88750654-88750676 GCTTCACACACTTCTGTCTGGGG - Intergenic
1058442350 9:105021134-105021156 GTCTCTCTCTCTCTTGGCTGGGG + Intergenic
1058541857 9:106019922-106019944 CTTTCTCATTCTCTTGTCTTTGG + Intergenic
1058825728 9:108774596-108774618 GCTTCTCCCTTTCTTGTCCCAGG + Intergenic
1061950795 9:133934848-133934870 GCTTCTGTCTCTCTGGTCTCTGG + Intronic
1062277765 9:135738827-135738849 CCTTCTCACTCCCCTGTGTGAGG + Intronic
1203473777 Un_GL000220v1:133784-133806 GCTTCTCACTCTCGTGGAAGGGG - Intergenic
1185507309 X:640850-640872 GCATCTGATTCTCTTGTTTGCGG - Exonic
1189420517 X:40853323-40853345 GTTTCTTAATCTCTTGTATGTGG - Intergenic
1192331533 X:70179355-70179377 GCTCCTCACTTTCCTGGCTGAGG - Intronic
1192377606 X:70579592-70579614 GCTTATTAATCTCTTGTCAGAGG - Intronic
1195365917 X:104125199-104125221 GCTTCCCACAGTCTGGTCTGGGG + Intronic
1197495264 X:127172077-127172099 CCTTTTCTCTCTCTTGTTTGAGG - Intergenic
1197569815 X:128135606-128135628 GATTTTCAGTCTCTTCTCTGTGG - Intergenic
1199680270 X:150219694-150219716 GCCTCTCCCTCTGTGGTCTGAGG + Intergenic
1199784641 X:151093578-151093600 GATTTTCACTCTCTTGTTTGCGG + Intergenic
1200781683 Y:7222040-7222062 TCTTCTTTCTCACTTGTCTGTGG - Intergenic
1200938793 Y:8761417-8761439 GTATCTCAGTGTCTTGTCTGTGG + Intergenic
1201075451 Y:10184197-10184219 GCTTCTCACTTTCTTGGAAGAGG - Intergenic
1201649151 Y:16265974-16265996 CCTTTTGCCTCTCTTGTCTGAGG - Intergenic
1201653658 Y:16319326-16319348 CCTTTTGCCTCTCTTGTCTGAGG + Intergenic