ID: 936706062

View in Genome Browser
Species Human (GRCh38)
Location 2:115075045-115075067
Sequence AAGCAGTTATACGTGGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936706059_936706062 -4 Left 936706059 2:115075026-115075048 CCACAGACAAGAGAGTGAGAAGC 0: 1
1: 0
2: 0
3: 13
4: 244
Right 936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG 0: 1
1: 0
2: 0
3: 2
4: 78
936706058_936706062 -3 Left 936706058 2:115075025-115075047 CCCACAGACAAGAGAGTGAGAAG 0: 1
1: 0
2: 1
3: 25
4: 267
Right 936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG 0: 1
1: 0
2: 0
3: 2
4: 78
936706057_936706062 4 Left 936706057 2:115075018-115075040 CCTTGGTCCCACAGACAAGAGAG 0: 1
1: 0
2: 1
3: 19
4: 260
Right 936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG 0: 1
1: 0
2: 0
3: 2
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936706062 Original CRISPR AAGCAGTTATACGTGGGTCA TGG Intronic
906087569 1:43148879-43148901 AAGCAGGAACAAGTGGGTCAGGG - Intronic
906424447 1:45698465-45698487 AAGCAGTTTTGTTTGGGTCAAGG + Intronic
909734196 1:78935462-78935484 ACACAGTTATACGTGAGCCATGG - Intronic
910092102 1:83477921-83477943 AAGCAGTTATTTGTTGGTAATGG - Intergenic
923013558 1:230108136-230108158 AACCAGTTCCACGTGGCTCAGGG - Intronic
923608149 1:235464093-235464115 TAGCACTTATACGTAGGTCTTGG - Intronic
923636347 1:235701039-235701061 AAGCATTTAAATGGGGGTCAGGG + Intronic
924669701 1:246111069-246111091 AAGATGTTATGCATGGGTCAGGG - Intronic
1065544539 10:26806174-26806196 AAGCAGATATTCTTGGGGCAAGG - Intronic
1068403014 10:56554623-56554645 AAGCAGTTACAAGTGGCTGAAGG - Intergenic
1068589143 10:58835958-58835980 AAGCATTTATTCCTGGTTCACGG - Intergenic
1078281835 11:9910009-9910031 AATCAGTTCCACGTGGGTGAAGG + Intronic
1086589757 11:88499633-88499655 ACGTAGGTATACATGGGTCATGG + Intergenic
1094330232 12:29284040-29284062 AAACAGATAGACGTGGGACATGG - Intronic
1096673843 12:53215804-53215826 AAGCAGTGATGTGAGGGTCAGGG + Intronic
1103061647 12:117863180-117863202 AAACAGCTGTACTTGGGTCAAGG + Intronic
1103342740 12:120229811-120229833 AAGCAGGTAAATGTGGGGCATGG + Intronic
1113183445 13:107658742-107658764 AAGAAGTGATGAGTGGGTCAAGG - Intronic
1113184362 13:107670614-107670636 AAGAAATTATACGTGGCCCATGG - Intronic
1117913374 14:60654667-60654689 AAGCAGTGATACCTGGGTAGTGG - Intronic
1121855431 14:97265248-97265270 AAAAAGTTATACGTGTGTCCTGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1140893656 16:79306453-79306475 AAGCAATGCTCCGTGGGTCAGGG - Intergenic
1143451043 17:7036832-7036854 ACTCAGGTATAGGTGGGTCAAGG - Exonic
1144994503 17:19258093-19258115 AACCAGTTAGATGTGGGTGAGGG + Intronic
1153664815 18:7359439-7359461 GAGCAGTTATAGGTGACTCAAGG - Intergenic
1155760583 18:29560383-29560405 AAGCAGTTATTCTTTGCTCAGGG - Intergenic
1156746582 18:40399328-40399350 AAGCAGTTGTATCTTGGTCAAGG - Intergenic
1158073644 18:53503139-53503161 CAGCAGTTTTACATGGGTCTAGG + Intronic
1162075874 19:8186951-8186973 AAAAAGTTATATGTGGGTCCAGG + Intronic
1165271048 19:34707957-34707979 AAGCAGTTGTACCTTGGCCAAGG + Intergenic
1166692165 19:44828979-44829001 AAGCAGTTATAGGCAGGGCATGG - Intergenic
928223631 2:29426747-29426769 AAGCAGTTATAGGCCGGGCACGG + Intronic
930740021 2:54822738-54822760 AAGCAGTTATCTCTGGGTAATGG + Intronic
931890216 2:66662842-66662864 AAGCAGTTATATGTGAGTGGGGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
938275030 2:130011848-130011870 AAACAGATATACATGGGACATGG + Intergenic
938325990 2:130402573-130402595 AAACAGATATACATGGGACATGG + Intergenic
938363953 2:130718893-130718915 AAACAGATATACATGGGACATGG - Intergenic
941585989 2:167360004-167360026 AAGCAGATATACATGGTACATGG - Intergenic
1170128472 20:12991771-12991793 AAGCACTTATACTTGGGTATTGG - Intergenic
1173884308 20:46443953-46443975 AAGGAGTTAGATGTGGGGCAGGG - Intergenic
1174708668 20:52682844-52682866 AAGCAGTTGCAGGTGGGGCATGG + Intergenic
1179218483 21:39386787-39386809 TAACACTTATACGTGGGTCTTGG + Intronic
1180616949 22:17134629-17134651 CAGCAAGTATATGTGGGTCATGG + Intergenic
1185188186 22:49415792-49415814 AAGCAGTTCTGCATGGGCCATGG + Intronic
950609387 3:14116156-14116178 CAGCAGTTATAGGTAGGTTAAGG - Intronic
954559000 3:51539668-51539690 AATCAGCTTTATGTGGGTCATGG + Intergenic
959185162 3:103037637-103037659 AATCAGTTATAGGTGACTCAGGG - Intergenic
959712977 3:109403242-109403264 AATCAGGTTTACGTGGGGCAAGG - Intergenic
961187740 3:124930717-124930739 AAGCAGTTATAGGTGTGCCCTGG - Intronic
966872710 3:184301781-184301803 AAGCACTTCTCTGTGGGTCAAGG - Intronic
967046427 3:185741518-185741540 TAGCAGTTATTCATGGGACAGGG - Intronic
970834628 4:20387761-20387783 ATTCAGTTATACGTGGTTCTAGG - Intronic
971999946 4:34018996-34019018 ACACAGGTATACGTGTGTCATGG + Intergenic
975475722 4:74821209-74821231 AAGGAGTTAGATGTGGGGCAAGG + Intergenic
978109467 4:104945206-104945228 TAGTAAATATACGTGGGTCAAGG + Intergenic
981500445 4:145445659-145445681 AAGCAGCCATCCGTGAGTCAAGG - Intergenic
983985267 4:174052233-174052255 AAGGAGTTATGAGTGGGTCATGG - Intergenic
989489497 5:42033438-42033460 ACACAGATATACGTGTGTCATGG + Intergenic
990159604 5:52923112-52923134 AAGGAGTTAGATGTGGGGCAGGG + Intronic
991467809 5:66932668-66932690 AATTAGCTATGCGTGGGTCATGG + Intronic
992450862 5:76874600-76874622 AAGCATTTATACGTGGGGGAGGG - Intronic
1004955887 6:20727164-20727186 AAACAGTTACCTGTGGGTCAAGG - Intronic
1007757314 6:44108393-44108415 AGGCAGGTACACATGGGTCAGGG - Intergenic
1008904335 6:56659559-56659581 AAACACTTATTCTTGGGTCATGG - Intronic
1011290224 6:85769189-85769211 ACATAGGTATACGTGGGTCACGG - Intergenic
1023599946 7:41872313-41872335 ACACAGTTATATGTGGGTTAGGG - Intergenic
1027308962 7:76934401-76934423 AAGCAGTTATTTGTTGGTAATGG - Intergenic
1031433222 7:121699127-121699149 CAGCAGTCATCTGTGGGTCATGG - Intergenic
1031536965 7:122946669-122946691 AAGCACTTATAACTGGGCCAAGG - Intergenic
1035713514 8:1736935-1736957 AAACAGGTATATGTGGCTCATGG + Intergenic
1035726759 8:1829546-1829568 AGGCAGCTGGACGTGGGTCAGGG - Intronic
1037115427 8:15220450-15220472 AAGCAGTTAGAAATGGGGCAAGG - Intronic
1044244071 8:89920465-89920487 AAGCAGAAATAAGTAGGTCAAGG + Intronic
1044538459 8:93383788-93383810 AAGATGATATACATGGGTCATGG + Intergenic
1045195962 8:99930818-99930840 AAGCAGATATATGTGTGCCATGG + Intergenic
1046499067 8:115052417-115052439 AAACAGGTAAACGTGTGTCATGG - Intergenic
1058286073 9:103180093-103180115 AATCAGCTATTCCTGGGTCATGG + Intergenic
1187065506 X:15833338-15833360 AAGCAGTAAAAGGTGTGTCAGGG - Intronic
1189125470 X:38441285-38441307 AAGCAGTGAAATGTGGTTCATGG + Intronic