ID: 936706398

View in Genome Browser
Species Human (GRCh38)
Location 2:115079924-115079946
Sequence AAGGAGAGGCTTTGTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936706391_936706398 26 Left 936706391 2:115079875-115079897 CCTCATTGTTGTTGAATATTTCC 0: 1
1: 0
2: 1
3: 14
4: 244
Right 936706398 2:115079924-115079946 AAGGAGAGGCTTTGTGATGATGG 0: 1
1: 0
2: 2
3: 28
4: 313
936706394_936706398 5 Left 936706394 2:115079896-115079918 CCTACAATTGGAAACATTAAGGG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 936706398 2:115079924-115079946 AAGGAGAGGCTTTGTGATGATGG 0: 1
1: 0
2: 2
3: 28
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936706398 Original CRISPR AAGGAGAGGCTTTGTGATGA TGG Intronic
900687586 1:3958509-3958531 AAGGAGGGGCTTGGTTAAGATGG - Intergenic
902196143 1:14799855-14799877 AAGGAGAGGAATTCTGATGGGGG - Intronic
904784986 1:32976047-32976069 AAGGTGAGTCTTAGTTATGAAGG - Intergenic
906118851 1:43374059-43374081 AAGGAGAGGCTTTTTGTTAGGGG + Intergenic
906141219 1:43534682-43534704 AAGGAGGGGCTTTGGTGTGAGGG + Intronic
906948790 1:50317772-50317794 ATGGAGTGGCTATGTGATGCTGG - Intergenic
907463713 1:54621549-54621571 AAGGAGTTGCTGTGTGCTGAGGG + Intronic
907820940 1:57967803-57967825 AATGACAGGCATTTTGATGAAGG + Intronic
908927386 1:69272291-69272313 CAGGAAAGGCTTTGTGGAGAAGG + Intergenic
910165609 1:84324625-84324647 GAGGAGAGGCTTTGTCCTGAGGG + Intronic
912505455 1:110152638-110152660 AAGGAAAGGCTCTGTGATTGTGG + Intronic
912761526 1:112371528-112371550 GAGGACAGGCTATCTGATGAGGG - Intergenic
912995489 1:114528903-114528925 CAGGAAAGGCCTTGTGATGTTGG + Intergenic
913781307 1:122390800-122390822 AAGGAAACACTTTGTGACGATGG + Intergenic
914731605 1:150376149-150376171 AAATAGAGGCTCTTTGATGAAGG + Intronic
915971791 1:160360357-160360379 CTGGAGAGGCTGTGTGATGCTGG + Intergenic
917680172 1:177357792-177357814 AAGGGGAGGCTGTGTGAAGGCGG + Intergenic
918032017 1:180824076-180824098 AAAGAGAGGTTTTGTCATGCCGG + Intronic
919791821 1:201296146-201296168 CAGGAGAGGCTGTGGGAAGAGGG + Intronic
919846262 1:201644162-201644184 ATGAAGAGGTTATGTGATGAGGG - Intronic
920511535 1:206555870-206555892 AGGGAGAGGGTTTCTCATGAAGG + Intronic
920557288 1:206913464-206913486 GAGGAGAGGCTCTGAGATGGAGG - Intronic
921310202 1:213834905-213834927 AATGAGAGACTTTGTCTTGATGG - Intergenic
922932796 1:229403391-229403413 GAGGAGAGGCTGTGTGGAGAAGG - Intergenic
1063284724 10:4673920-4673942 AAAGATAGCCCTTGTGATGAAGG - Intergenic
1064885457 10:20106523-20106545 AATGAGAGGCTTGGTGAAGGGGG - Intronic
1065979348 10:30876196-30876218 AAGGAGGGAATTTGTTATGAAGG - Intronic
1066334948 10:34466388-34466410 AAGGAGAGAGTTTGACATGATGG + Intronic
1067013396 10:42736198-42736220 AATGAAAGGCTTTCTGGTGATGG - Intergenic
1067310383 10:45107549-45107571 AATGAAAGGCTTTCTGGTGATGG + Intergenic
1069207526 10:65710443-65710465 AAGGAGAGGGAGAGTGATGAGGG + Intergenic
1069754435 10:70764460-70764482 AAGGAGAAGATTTGTGGTGTAGG - Intergenic
1070663992 10:78330941-78330963 AAGGAGTGGTTTTGGAATGAAGG + Intergenic
1070664637 10:78334357-78334379 ATGGAGAGGCCATGTGAAGATGG + Intergenic
1073430030 10:103479914-103479936 AAGGAGAGACCTAGTGATGTGGG - Intergenic
1073665627 10:105530411-105530433 AAACAGAGGCTTAGAGATGAGGG - Intergenic
1075418738 10:122285319-122285341 AAGAAGAGGCTTTTTGATAGAGG - Intronic
1075435345 10:122436019-122436041 AAGAGGGGCCTTTGTGATGATGG - Exonic
1075931828 10:126303717-126303739 AAAGAGAGGCTTTGCTATGCAGG - Intronic
1077125194 11:931018-931040 AAGGGGTAGCTTTGTGATGATGG - Intronic
1078158046 11:8815558-8815580 AAGGAGAGGCATTCAGATAAAGG - Intronic
1080379800 11:31756521-31756543 AAGGAAAGGCTTTGAGGAGAAGG - Intronic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1085039041 11:73316149-73316171 AGGGAGAGGCTCTATGAAGAGGG + Intronic
1085565969 11:77513758-77513780 GATCAGAGTCTTTGTGATGATGG + Intergenic
1087427734 11:98012412-98012434 AAGCAGAGCCTTTGTGGTGTAGG - Intergenic
1087850267 11:103019747-103019769 AAGAAGAGGGTTTGTGGGGAGGG + Intergenic
1088073947 11:105823990-105824012 AAGGAGAGACCATGTGAGGATGG + Intronic
1088991455 11:114957171-114957193 AAGCATAAGCTTTGGGATGAAGG + Intergenic
1089291300 11:117439246-117439268 AAGGTGAGGCTCTGTGAGGCAGG - Exonic
1089688899 11:120173888-120173910 CCAGAGAGGCTGTGTGATGATGG - Intronic
1090844181 11:130517355-130517377 AAGCTGAGGCTTTGTTAGGAAGG + Intergenic
1092622753 12:10290769-10290791 AATCAGAGGTTATGTGATGATGG + Intergenic
1095767164 12:45909833-45909855 TAGGAAAGGCTTTGTGGAGAAGG + Intergenic
1095984137 12:47988529-47988551 AAGGAGACCCATTGTGAAGAGGG - Intronic
1096255932 12:50062479-50062501 GAAGAGAGGCTTTGTGGTTAGGG + Intronic
1096753050 12:53775263-53775285 GAGTAGAGGCTTTGTGTTCAAGG - Intergenic
1096756724 12:53805803-53805825 AAGGAGCCGCATTGTGATGGGGG - Intergenic
1099455534 12:82858301-82858323 AAGGAGAGGCATTGAGCGGACGG + Intronic
1100084662 12:90894698-90894720 AATGAGAGGGTTTGTGAAGTTGG + Intergenic
1102629063 12:114261034-114261056 AAAGACAGGCTATGTGAAGAGGG - Intergenic
1105790141 13:23790589-23790611 AGGGGGAGGCAATGTGATGAGGG + Intronic
1107742244 13:43463496-43463518 AAGGTGATGCTTTTTGATGCAGG - Intronic
1108056082 13:46486771-46486793 ATGGAGATGCTTTCTGAAGATGG + Intergenic
1110373486 13:74765895-74765917 AAGGAAAGGCTTGGTACTGAAGG + Intergenic
1111434082 13:88183794-88183816 AGGGAGAGGCTATTTCATGATGG + Intergenic
1111551137 13:89814354-89814376 CAGGTGAGGCTATGTGAAGATGG + Intergenic
1113674927 13:112200553-112200575 AGGGAGAGGGTTAGTGCTGAGGG + Intergenic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1115702901 14:35972693-35972715 GAGGAGATGTTTTATGATGAGGG + Intergenic
1116185535 14:41596332-41596354 AAGAAGAGTCATTCTGATGAAGG + Intergenic
1117800674 14:59441561-59441583 AATGAGAGGCATTGTTATGGAGG + Intronic
1119215929 14:72869020-72869042 CAGGAGAGGCCTGGTCATGAAGG - Intronic
1119778965 14:77265724-77265746 CAGGAGCGGGTTGGTGATGAAGG + Exonic
1121996739 14:98608577-98608599 AAGGAGAGGAGTTGCGAGGATGG - Intergenic
1122264951 14:100542218-100542240 AAGGAGAGGCATTGGGATTTGGG - Intronic
1122957451 14:105077328-105077350 AAGGTGTGGCTTTGGGGTGAGGG - Intergenic
1123062024 14:105598735-105598757 ATGGAGGGGCTTTGTGCTCATGG + Intergenic
1123086767 14:105720466-105720488 ATGGAGGGGCTTTGTGCTCATGG + Intergenic
1123985337 15:25641021-25641043 AAGGAGAGGCTTTCCAAGGACGG - Intergenic
1124104534 15:26725090-26725112 AAGGAGGGGCACTGTGATGGGGG - Intronic
1124367190 15:29080465-29080487 CAGCAGAGGCATTGTGAGGAAGG + Intronic
1125442774 15:39721372-39721394 AAGGAAAGGTTATTTGATGAAGG - Intronic
1126471762 15:49020087-49020109 CAGGAGGGTCCTTGTGATGATGG + Intronic
1127344924 15:58084765-58084787 AAGGAGAGGCTGTGTAACTAGGG + Intronic
1127815940 15:62608874-62608896 AAGGAGAGCCTGTGGGATTAGGG + Intronic
1128302399 15:66574720-66574742 GAGGAGAGTCTCTGTGAAGATGG + Intergenic
1129195984 15:73966870-73966892 CACGAGAGGCTTTGTGGTGATGG + Intergenic
1129626354 15:77204500-77204522 AATGAGAGCCTTTGTGAAGCTGG - Intronic
1130244752 15:82236180-82236202 AAGGAGAGGCATAGTGTTCATGG + Intronic
1130890372 15:88128420-88128442 AAAGAGGGGCTGTGTGAGGATGG - Intronic
1130939505 15:88495940-88495962 AAGGAGAGGCTCTCTGGAGAGGG + Intergenic
1130977305 15:88787326-88787348 AAGGATAGGCTATGTAAAGATGG - Intergenic
1131203521 15:90421571-90421593 AAGCTGAGGCTTTGTGGTTATGG + Intronic
1133523115 16:6577979-6578001 AAGCACAGGTTTTGTGATGAAGG + Intronic
1133827907 16:9295231-9295253 AAGGAGAGGGTTGGGCATGATGG + Intergenic
1134158602 16:11865472-11865494 AAGGAGAGGATTTTTTATTAAGG - Intergenic
1134779536 16:16883220-16883242 GAGGAAAGGCTGTGTGAGGATGG + Intergenic
1138172155 16:54862390-54862412 AAGGCGAGACTTTGTAATTAGGG - Intergenic
1139063351 16:63282640-63282662 AAGGAGAGATTTTCTGATTAAGG + Intergenic
1139547158 16:67654690-67654712 AAGGTGAGGCTTGCTGATGGGGG + Exonic
1139574154 16:67830847-67830869 AAGAAGAGGGTTTGGGAAGACGG - Intronic
1139714608 16:68802814-68802836 AAGAAGAGCCTTGGTGAAGAAGG + Intronic
1141050591 16:80759542-80759564 CAGGAAAAGTTTTGTGATGATGG + Intronic
1141717559 16:85735557-85735579 AAGGAAAGGCTTGGTGGTGTCGG - Intronic
1142001552 16:87667153-87667175 AAGGAGAGGCCACGTGACGAGGG - Intronic
1143763624 17:9122423-9122445 AATGAGAGGCTTTGGGATTGGGG + Intronic
1144668564 17:17118482-17118504 GAGGACAGGCATTGGGATGAGGG + Intronic
1145023395 17:19449602-19449624 AGGGAGATGCCTTGTGAAGATGG + Intergenic
1145109984 17:20154272-20154294 TAGGAGAGGGTGTGTGCTGAGGG + Intronic
1146521319 17:33527758-33527780 ACAGAGAGGCTGTGTGGTGAGGG + Intronic
1146571362 17:33956147-33956169 AAGGAAAGTCTTAGTGTTGAAGG + Intronic
1150494301 17:65595397-65595419 AATGAGAGCCTGAGTGATGATGG + Intronic
1150839566 17:68595343-68595365 GAGGACAGGCTTTGGAATGAGGG + Intronic
1151399288 17:73845159-73845181 ATGGAGAAGCTGTGTGATGCTGG - Intergenic
1152850286 17:82629933-82629955 AAGGAGAGGCTCAGTGAGGGAGG - Intronic
1156233459 18:35178440-35178462 ATGGAGAGGCTTGGTGTTGTGGG - Intergenic
1156276414 18:35587407-35587429 AAGGACAGTCTTTGTGATCTTGG + Intronic
1156690720 18:39703753-39703775 AAGAAAAGGCTATGTGATGATGG - Intergenic
1156946113 18:42833901-42833923 AAGGATTAGCTTTGTGAAGAGGG + Intronic
1157008069 18:43610535-43610557 AAGGAGAGGCTAGATCATGAAGG - Intergenic
1157583327 18:48786044-48786066 AATGATGGGCTTTGGGATGAGGG - Intronic
1157594899 18:48858552-48858574 CAAGGGAGGCTTTGTGAAGAAGG + Intronic
1158367706 18:56757247-56757269 CAGGAGATGCTGTGTGGTGACGG - Exonic
1158406008 18:57159907-57159929 CAGGAAAGTCTTTGTGGTGAAGG - Intergenic
1158961458 18:62591150-62591172 AAGGTCAGGCAATGTGATGAGGG - Intergenic
1159023426 18:63161709-63161731 GAGGTGAGGCTTTTTGTTGATGG - Intronic
1159770620 18:72542702-72542724 AAGGAAATGCTGTGAGATGAAGG - Intronic
1160335048 18:78031418-78031440 AAGGAGACGCCTGGCGATGAAGG - Intergenic
1160547552 18:79670432-79670454 AAGGAGTGGGTTCGTGATTACGG - Intergenic
1160987478 19:1845859-1845881 AAGGAGAGGGCATCTGATGAGGG - Intronic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1162100883 19:8337970-8337992 AAGGAGAGGCCATGTGTGGAGGG - Intronic
1163256428 19:16158689-16158711 AAGGAGACGAGTTGTGTTGAGGG + Intergenic
1164339641 19:24377199-24377221 AAGAAAAAGCTTTGTGATGTGGG + Intergenic
1164503822 19:28841640-28841662 CAGGAAAGGCTTTTTGAAGAAGG - Intergenic
1165306653 19:35006880-35006902 AAGGAGAGCATTTGAGCTGAAGG + Intronic
1166061316 19:40327530-40327552 AAGGGGAGACTTTGTGATGGAGG + Intronic
1166408951 19:42543506-42543528 AGGGAGAGGCCATGAGATGAGGG + Intronic
1167061682 19:47152166-47152188 CGGGAGAAGCTTTGTGATCATGG - Intronic
1167497366 19:49827500-49827522 AGGGAGAGGCCATGTGAGGACGG - Intronic
1167752352 19:51388627-51388649 TAGGAGTGGCTTTGGGATTAGGG + Exonic
1167910357 19:52697069-52697091 AAGGAGATGCTTTGTGGCAAAGG + Intergenic
1168474485 19:56666032-56666054 AAGGTGATGCTTTGTGGAGATGG + Intronic
925167684 2:1728346-1728368 AGAGAGAGGCTCTGTGCTGAGGG - Intronic
925664105 2:6234808-6234830 GAAGAGAGGCTTTGGAATGAGGG + Intergenic
926752742 2:16211191-16211213 AAGAACAGGCTTGGTGATGGAGG + Intergenic
926894423 2:17669227-17669249 AGAAAGAGGCTTTGAGATGAAGG + Intronic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
929009428 2:37426294-37426316 GATGAAAGGCTTTGTGATGGTGG + Intergenic
929567689 2:42999980-43000002 AAGGAGAGGCTAAGTGAAGGAGG + Intergenic
930833272 2:55768398-55768420 AAGGAAAGACTCTGTGAAGAAGG - Intergenic
931551030 2:63446443-63446465 AAAGAGAGGCTCTGGGAAGATGG - Intronic
933204396 2:79488796-79488818 CAGGAGAGGCTTTCTGAGGAGGG - Intronic
933572131 2:84026125-84026147 AAGGAGAGGGTCTGGGGTGAGGG - Intergenic
935441449 2:103102401-103102423 AAGAATAAGCCTTGTGATGATGG + Intergenic
936706398 2:115079924-115079946 AAGGAGAGGCTTTGTGATGATGG + Intronic
937099306 2:119256472-119256494 AGGGAGCGGCTTTCTGGTGAGGG - Intronic
937768677 2:125693802-125693824 AAGGAGAGGCTGGGTTGTGAAGG + Intergenic
937930041 2:127197476-127197498 AAGGAAAAGCTTTGAGATGATGG + Intronic
939558233 2:143702761-143702783 AAAGAGAGGGTATGCGATGAGGG - Intronic
940056125 2:149514291-149514313 TGGGAGAGGCTTTGTGTTGATGG - Intergenic
940580867 2:155577974-155577996 AAGAAGAGGCTTCTTGATGCTGG - Intergenic
941175542 2:162193721-162193743 CAGGACAGGCATTGTGATAATGG - Intronic
943748682 2:191488604-191488626 TAGGAAAGGCTTTGGGATGACGG - Intergenic
943829241 2:192438013-192438035 TAGCAGAGGCTTTGTTAAGAAGG - Intergenic
944248395 2:197556684-197556706 AAGGAAAAGCAATGTGATGATGG - Intergenic
945058101 2:205885638-205885660 AAGGAGAGGCTCTGCAAGGAAGG + Intergenic
946046572 2:216826342-216826364 AAGGAGAGCCCTTGTGAGGCAGG - Intergenic
946523147 2:220488425-220488447 TGGGAGAGGATTGGTGATGAAGG - Intergenic
946549387 2:220784036-220784058 AAGGAGAGTCTTTGGGATTTAGG + Intergenic
948761742 2:240196690-240196712 GAGGAGAGGCCATGTGAAGACGG + Intergenic
948857447 2:240736602-240736624 AAGGAGCAGCCTGGTGATGAGGG + Intronic
948990400 2:241551106-241551128 AAGGAGAGGCTTCGAGGTGATGG - Intergenic
1169490866 20:6070478-6070500 CAGGAAAGGCCATGTGATGATGG - Intergenic
1170413118 20:16111686-16111708 ATGGAGAGGCTTTGTGCACAGGG + Intergenic
1170422609 20:16207558-16207580 AAGGAGAGGCCTGGTGCTCAGGG + Intergenic
1173357437 20:42307069-42307091 AAGGGGAGGCTTAGTCATCATGG + Intronic
1173435881 20:43031908-43031930 ATGGAGAGGCTTTGTGGTTGGGG - Intronic
1174454278 20:50638554-50638576 AAAGAGAGGCTTTGTCTTCAAGG - Intronic
1175456064 20:59115401-59115423 AAGGAGATTCTTTCTGAGGAGGG - Intergenic
1175603661 20:60295380-60295402 AGGGAGGAGCTTTGTGGTGAAGG + Intergenic
1175711949 20:61228345-61228367 CAGGAGAGGCTTTGCGGTGCCGG - Intergenic
1175977972 20:62722676-62722698 AAACAGAGGCATGGTGATGATGG + Intronic
1176864625 21:14038954-14038976 AAACAGAAGTTTTGTGATGATGG - Intergenic
1177295329 21:19166327-19166349 CTGTAGAGGCTTTGTCATGAAGG - Intergenic
1178390884 21:32197217-32197239 AAGGACAGACATTGTGAAGAAGG - Intergenic
1179064965 21:38016462-38016484 AGGGAAAGGTTTTCTGATGATGG + Intronic
1179560165 21:42210753-42210775 AAGGAGGGGCCATGAGATGAGGG - Intronic
1180238725 21:46483452-46483474 AAGCAGAGGCTCTGTGCAGAGGG + Intronic
1180915408 22:19482616-19482638 ACTCAGAGGCTTAGTGATGAAGG + Intronic
1183031971 22:35113326-35113348 AGGGAGGAGCTTTGTGAGGAAGG - Intergenic
1183341208 22:37282937-37282959 GAGGAGATGCTGTCTGATGAGGG + Intronic
1183625610 22:38999635-38999657 AGGGGGAGGCTTTGGGCTGAAGG + Intergenic
1184425689 22:44407902-44407924 CAGCAGAGGCTTGGTGCTGAAGG + Intergenic
1184486944 22:44785480-44785502 AAGGGGAGGGTGTGTGAGGACGG - Intronic
1184838655 22:47039571-47039593 AATGAGGGGCATTGTCATGAGGG + Intronic
1185202506 22:49516826-49516848 TAAGAGTGGCATTGTGATGACGG + Intronic
1185290586 22:50024557-50024579 AAGGATGGTCTTTTTGATGATGG + Intronic
949148645 3:736634-736656 AATGAGAGGTTCGGTGATGAAGG + Intergenic
949442282 3:4094853-4094875 AAGGAGAGGGATCGTGATGTAGG + Intronic
949656067 3:6221439-6221461 TAGGAGGGGCTTTGTGATTTAGG - Intergenic
950323683 3:12083519-12083541 AAGGAGAAACTTTGGGAGGAAGG - Intronic
951051461 3:18098758-18098780 TTGGAGAGGCTTTATGGTGAAGG - Intronic
953180208 3:40587988-40588010 AAGAAGAGGCCATGTGAGGAAGG - Intergenic
953375381 3:42423839-42423861 GAGGAGAGTCTTTGTGAAAATGG + Intergenic
953446873 3:42975954-42975976 AAGAAAAGGCTTTGAGATGGAGG + Intronic
953753897 3:45630534-45630556 AGGGAGAGGCCTTGTGATTGAGG + Intronic
953808103 3:46089152-46089174 ATGGTGAAGCTTTCTGATGAAGG - Intergenic
955434066 3:58881846-58881868 AAGGACAGGCTTTTTAATCATGG - Intronic
955860346 3:63322948-63322970 AGGGAGAGGCTTTTTATTGAGGG + Intronic
956961184 3:74402998-74403020 AATGAGAGGCATTGTGAGGTAGG + Intronic
958999765 3:100949792-100949814 AAGGAGTGGCGTTTTGAAGAAGG + Intronic
959434367 3:106296123-106296145 AAAGATAGGCTTTGTGTTCAGGG - Intergenic
960509519 3:118531599-118531621 AAGGAGTTTCTTGGTGATGATGG - Intergenic
963563864 3:146902865-146902887 AAGGATAGGCTTAGTTAAGAAGG + Intergenic
964909296 3:161758505-161758527 ATGGAAAGTCTTTTTGATGATGG + Intergenic
969218889 4:5746506-5746528 GAGGAGAGGCTTGGAGATGGAGG + Intronic
969283894 4:6190563-6190585 AAGGAGAGGCCTGGGGAGGAAGG + Intronic
969494731 4:7520048-7520070 GAGGAGAGCCCTGGTGATGAGGG + Intronic
971126210 4:23758045-23758067 AAGAAAGTGCTTTGTGATGATGG + Intronic
971789991 4:31156902-31156924 AAGCACATGTTTTGTGATGAGGG - Intergenic
972818444 4:42671065-42671087 AAGGAGAGTCTCTGTGAACAGGG + Intergenic
973858658 4:55039034-55039056 AAAGAGAGGCTATATGAGGAAGG - Intergenic
974123856 4:57671685-57671707 TAGGAGAGGCTCTGTGGAGAAGG + Intergenic
974309682 4:60188887-60188909 GAGGAGACTCTTTTTGATGAAGG + Intergenic
975735399 4:77375987-77376009 ATGGAGTGGGTTTGTGATGAAGG - Intronic
975911052 4:79267338-79267360 GGGGAGAGGCTTAGTAATGAAGG + Intronic
977212270 4:94232560-94232582 AAGGACAGGCATAGTGATAAAGG + Intronic
978348054 4:107792588-107792610 AAGGAGAGGCTCTGTTAGGGTGG + Intergenic
979738855 4:124125172-124125194 CAGGAGAGGTTTTCTGAGGAAGG + Intergenic
980072399 4:128258098-128258120 AAGGAGTGCCTCTGTGATGGGGG + Intergenic
981199311 4:141960965-141960987 AAGGAGAGGTTATGTAATGTAGG - Intergenic
982640242 4:157949820-157949842 AAGAAGAATCCTTGTGATGATGG + Intergenic
983420580 4:167510287-167510309 TTGGAGTGGCTGTGTGATGAAGG - Intergenic
983965318 4:173802258-173802280 AAGGAGAGGGATTGTGAAGGTGG + Intergenic
985149777 4:186934874-186934896 AAGAAGAGGCTCTGTCCTGATGG - Intergenic
985748057 5:1658769-1658791 AAGCAGAGGCTTTGTGTAAATGG + Intergenic
985775379 5:1838575-1838597 TAGGAGAGGCTTCGTGTTAATGG + Intergenic
986158324 5:5199183-5199205 AAGAAGAGACTTGCTGATGACGG + Intronic
986783077 5:11084919-11084941 AAGGAGAGGGGATGAGATGATGG - Intronic
986979288 5:13428411-13428433 AAAGAGAGGAGTTGTGATGATGG - Intergenic
988412300 5:30902318-30902340 AACGACAGGTTCTGTGATGAAGG - Intergenic
989158636 5:38368981-38369003 GAGGAGAGGCTTTGTGTTAATGG - Intronic
989851555 5:46218656-46218678 AAGAAAAAGCTTTGTGATGTGGG + Intergenic
990854926 5:60254137-60254159 AAGGAGAGGCATTGCTATGTGGG + Intronic
990901284 5:60752373-60752395 TAGGAGAGGTTGTATGATGAAGG + Exonic
991603394 5:68375855-68375877 GAGAAGAGCTTTTGTGATGAGGG + Intergenic
992331758 5:75724103-75724125 AAGCAGAAGGTTGGTGATGAGGG - Intergenic
992373093 5:76165455-76165477 AAGGAGTTTCTTTGTGGTGATGG - Intronic
992918345 5:81483021-81483043 AAGGAGAGGAATAGTGATCAGGG + Intronic
992986832 5:82239053-82239075 AAGGAGAGGATTTGAGGAGATGG - Intronic
995067486 5:107878779-107878801 CACGAGAGGCTCTGTGAGGATGG - Intronic
995461181 5:112404908-112404930 AAAGTGAGGCCTTGTGAGGATGG - Intronic
997379599 5:133426235-133426257 AAGGAAAGTCTTTGCCATGAAGG + Intronic
997442781 5:133920376-133920398 AAGCACAGGCTTTGTGGTGGCGG - Intergenic
997768142 5:136525818-136525840 CAGGAGAAGCTTTGAGATGAAGG - Intergenic
998985494 5:147752015-147752037 AATAAGAGACTTTCTGATGATGG + Intronic
1000100058 5:158007734-158007756 AAGGAGATGCTGTGGGAAGAAGG - Intergenic
1001448290 5:171804592-171804614 CAAGAGAGGCTTTGGGATGCTGG + Intergenic
1002014672 5:176310686-176310708 AAGGAGTTCCTTTGTGCTGATGG + Intronic
1005141701 6:22639306-22639328 AAGCAGAAGCAATGTGATGAGGG - Intergenic
1006092360 6:31635554-31635576 AAGGAGAGGCCTCGTGGAGAGGG - Intronic
1007081602 6:39109147-39109169 AAGGAGAGCCTTTGAGCAGAAGG + Intronic
1007583890 6:42977018-42977040 CATGAAAGGCTTTGTGATAAAGG + Intronic
1007899886 6:45400737-45400759 ACAGAGAGTCTTTGTGAAGATGG - Intronic
1010786996 6:80015135-80015157 AAGGAAATATTTTGTGATGATGG + Intronic
1011478303 6:87769312-87769334 AAGAAGAGGCTTTGCCATGTTGG + Intergenic
1011706925 6:90010206-90010228 AAGGAGACTTTTGGTGATGATGG - Intronic
1014097101 6:117472432-117472454 TGGGACTGGCTTTGTGATGATGG - Intronic
1016391161 6:143577418-143577440 CAGGAGAGGCTTTGTGAGAAGGG + Intronic
1018048142 6:159982788-159982810 ATGGAGATGTTTTGTGTTGAAGG + Intronic
1018143177 6:160860140-160860162 AGGGAGAGCGTTTGGGATGAAGG - Intergenic
1018417948 6:163617626-163617648 AAGCAGAGGCCTTGTGATGATGG + Intergenic
1018590587 6:165416978-165417000 AATGAGTGCCTGTGTGATGATGG - Intronic
1018787804 6:167121776-167121798 CAGGAGAGGCTTTGTTTGGAAGG + Intergenic
1018885358 6:167930773-167930795 AAAGAAAGGCCTTGTGATGGTGG + Intronic
1021098145 7:16556431-16556453 CAGGAAAGGCTTTGTGAAAAAGG + Intronic
1021364430 7:19759129-19759151 AACAAGAGGCTTAGTGGTGAAGG - Intronic
1021530015 7:21633722-21633744 ACAGAGAGGCTTTGTGATTAAGG + Intronic
1021700625 7:23316188-23316210 AAGGAGGTGCTTTGAGATGTGGG - Intronic
1021800726 7:24304050-24304072 AAGGAGAAGCTTGGTGTTGGGGG + Intergenic
1024103443 7:46057378-46057400 AAGGAGATGCTTAGAGATGATGG + Intergenic
1024652423 7:51416498-51416520 AAGTAGAGGCTTAGTCAAGAAGG + Intergenic
1025037601 7:55607147-55607169 AAGTAGAGGCTTAGTCAAGAAGG + Intergenic
1026428527 7:70320816-70320838 AGGGAGAGGCTGTGCGTTGATGG + Intronic
1028095767 7:86758450-86758472 ATTCAGAGGCTTTGTAATGAGGG + Intronic
1028100921 7:86819724-86819746 AAGGAGATGGTTTGTGATTCTGG - Intronic
1028864927 7:95697832-95697854 AGGGAGGGTCTTTGTGATGATGG - Intergenic
1029598567 7:101550624-101550646 AAGGGGAGGCTTCGGGATGGGGG + Intronic
1032192255 7:129771832-129771854 AAGGAGAGGCTTGGTGGGGAAGG + Intergenic
1032414753 7:131727418-131727440 AAGGGGTGGCTCTGAGATGAGGG - Intergenic
1033088723 7:138365810-138365832 GAAGAGAGGCTTTGTGATGAAGG - Intergenic
1033585206 7:142769754-142769776 AAGGAGGGGCTTCCTTATGAGGG - Intergenic
1034410255 7:150937420-150937442 ATGGAGAGGCTTTATGGAGAGGG + Intergenic
1035026454 7:155829912-155829934 AAGGCAAGGCTCTGTGCTGAAGG - Intergenic
1035412315 7:158654751-158654773 TAGGAGAAGCTTTGTGAGGCTGG - Intronic
1036728579 8:11242014-11242036 AAGGAAAGGCCATGTGAGGATGG + Intergenic
1037165777 8:15826738-15826760 ATGGGGAGGCTTTATGGTGAGGG + Intergenic
1038239790 8:25797859-25797881 AAGGAGAGGCTGGGTTACGAGGG + Intergenic
1038701830 8:29856147-29856169 AAGAAAAGGCTGTGTGAAGAAGG + Intergenic
1039280331 8:35977399-35977421 AAGGAGAAGGTTTGGGATGAAGG + Intergenic
1039615039 8:38948803-38948825 AAGGTGGGGCATTGTGATGCTGG + Intronic
1039626257 8:39057910-39057932 AAGGAGTGGATTTTTGATGAGGG - Intronic
1041165526 8:55088880-55088902 GAGGAGATGATGTGTGATGAGGG - Intergenic
1041635843 8:60142937-60142959 AAGGAGATTCTTTCTGATGAAGG + Intergenic
1042791929 8:72617363-72617385 AAGGACAGGATTTGAGATGGAGG + Intronic
1045756613 8:105550702-105550724 AAGGAGAGGCTGTGTGAATCAGG + Intronic
1046096747 8:109571573-109571595 AAGGAGAGCCTTTGAAAAGAAGG - Intergenic
1048009070 8:130442457-130442479 ACAGAAAGGCTTTGGGATGAAGG + Intronic
1048294987 8:133207384-133207406 AAGGAGAGGCTTTGGGATCCTGG - Intronic
1049043514 8:140130613-140130635 CAGGAGTGGCTTTTAGATGAAGG - Intronic
1049310437 8:141931257-141931279 AAGGAGAGGCCTGGGGAGGAGGG + Intergenic
1051527232 9:18059185-18059207 GAGGAGAGACAATGTGATGAGGG - Intergenic
1051642449 9:19236473-19236495 AAGTAGAGGCTGTGTCATGAAGG + Intronic
1051857474 9:21585494-21585516 AAGGAGGAGCTGTGTGAAGATGG + Intergenic
1052198334 9:25745682-25745704 TAGGAGATGCTTGGTCATGAGGG + Intergenic
1052381326 9:27774064-27774086 AAGGAGATGCTTTTTGAGAAAGG - Intergenic
1052758041 9:32561648-32561670 AAGGGAGGGCTTTCTGATGATGG - Intronic
1058267134 9:102915642-102915664 TTGGAGAGGCTTTGTGATTATGG - Intergenic
1061476544 9:130871254-130871276 AAAAAGAGGCTTAGTGATGTAGG + Intronic
1185521234 X:741305-741327 AAGGATAGGCCTTCTGTTGAGGG + Intergenic
1186549992 X:10493703-10493725 AAGAAAAGGCTTTGAGATGATGG + Intronic
1187013139 X:15299959-15299981 AAAAAGAGGCCTTATGATGAAGG - Intronic
1187683869 X:21796862-21796884 GAGGGAAGTCTTTGTGATGATGG + Intergenic
1188611621 X:32106527-32106549 AAGGAGAGGCTGTCTGAGTAGGG + Intronic
1189082296 X:37987613-37987635 AAGGAAAGGCTTTATTAGGAGGG + Intronic
1190783739 X:53623503-53623525 TAGCAGAGGTTTTGTGTTGAAGG - Intronic
1190937780 X:55012288-55012310 TTGGAGAGGCTTTGTGAGTAAGG - Intronic
1191112354 X:56813855-56813877 ACCAAGAAGCTTTGTGATGATGG - Intergenic
1191287846 X:58757035-58757057 CAGAAAAGGCTTTGTGAGGATGG + Intergenic
1191392195 X:60150958-60150980 CAGAAAAGGCTTTGTGAGGATGG + Intergenic
1192159192 X:68770069-68770091 AAGTACAGGCTTTGTTTTGAAGG - Intergenic
1193426572 X:81347332-81347354 AAGAGGAGGCATTGTGATCATGG - Intergenic
1195616959 X:106920198-106920220 CAGGAGAGGCCTTGTGGGGAGGG - Intronic
1195874608 X:109525842-109525864 AAGAAGAGACTTTGTGCTCAGGG + Intergenic
1196222573 X:113128772-113128794 CAGGAGAGTTTTTGAGATGATGG - Intergenic
1197771547 X:130092538-130092560 TAGGAGAGGGTTTGTGGAGAGGG - Intronic
1198164227 X:134037871-134037893 TAGGAGAGGCTTCATGAAGAAGG + Intergenic
1198388542 X:136150345-136150367 AAGGAGAGGCATGGGGAAGAAGG - Intronic
1198397979 X:136242060-136242082 CAGTAGAGGCTTTGTAAGGATGG - Intronic
1198621546 X:138517492-138517514 AAAGAGAGGGGCTGTGATGATGG - Intergenic
1200314972 X:155122883-155122905 AAGGAGTTCCTTTGTGCTGATGG + Exonic