ID: 936707653

View in Genome Browser
Species Human (GRCh38)
Location 2:115094460-115094482
Sequence TACCATGTGATGTAAGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936707653_936707655 10 Left 936707653 2:115094460-115094482 CCTCTAACTTACATCACATGGTA 0: 1
1: 0
2: 1
3: 8
4: 96
Right 936707655 2:115094493-115094515 TTTGCAATCCATAAAATGAAAGG 0: 1
1: 0
2: 3
3: 45
4: 389
936707653_936707656 16 Left 936707653 2:115094460-115094482 CCTCTAACTTACATCACATGGTA 0: 1
1: 0
2: 1
3: 8
4: 96
Right 936707656 2:115094499-115094521 ATCCATAAAATGAAAGGTACAGG 0: 1
1: 0
2: 0
3: 21
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936707653 Original CRISPR TACCATGTGATGTAAGTTAG AGG (reversed) Intronic
906446727 1:45905814-45905836 TACCATTTGATGGGGGTTAGGGG - Intronic
910169409 1:84361454-84361476 TACCCTGTGCTGTGAGGTAGGGG + Intronic
915071051 1:153267618-153267640 TTGCATATGATGTAAGATAGGGG + Intergenic
924410710 1:243802293-243802315 TACCATGTCATGTAGCGTAGAGG - Intronic
1063250823 10:4272139-4272161 TCCCATTTAATGTAAGTTTGAGG + Intergenic
1065772455 10:29090162-29090184 TGCAATGTGATGGAATTTAGAGG + Intergenic
1072424937 10:95322061-95322083 TACCTTGTGATGAAAGTCAAGGG + Intronic
1079253432 11:18805431-18805453 TACCATGTGATTTCAGTCACAGG + Intergenic
1082717386 11:56630966-56630988 TTCCATATGATGTAATTTATAGG - Intergenic
1083512180 11:63220109-63220131 TACCTTTTGTTGTAAGGTAGAGG + Intronic
1088403450 11:109445969-109445991 TACCATGTGTGGTGAGATAGGGG + Intergenic
1090609278 11:128455810-128455832 TTCCATGTGATACAATTTAGCGG - Intergenic
1094196655 12:27756997-27757019 TACCATGTGATTTAGGGTGGGGG + Intergenic
1096054429 12:48639625-48639647 TACCATGAAATGTAAAGTAGTGG - Intergenic
1096281586 12:50259614-50259636 TAACATTTGATGTTATTTAGTGG - Intronic
1099155784 12:79174227-79174249 CACAATGTGGTGTAAGCTAGTGG + Intronic
1108094967 13:46891954-46891976 TACCATGTGCTGTAGCTTGGAGG - Intronic
1108774648 13:53751127-53751149 TACTATGTGATGGAAATTTGGGG - Intergenic
1111890436 13:94075055-94075077 TCCCATGTGTTGTAACTTAGGGG - Intronic
1115376230 14:32679408-32679430 TAACATGTAATGTAACTTTGGGG - Intronic
1117500730 14:56348578-56348600 TACCATGTAAGGTAAATTATAGG + Intergenic
1118812230 14:69283688-69283710 TACCCTGTGATGTAGGTATGAGG - Intronic
1120509555 14:85396915-85396937 TACTATCTGATGTCAGTTATAGG - Intergenic
1120655209 14:87181104-87181126 TCCTATGTGATTTAAGGTAGGGG - Intergenic
1121343646 14:93119494-93119516 TACCTTATGAAGTAAGATAGAGG - Intergenic
1122999522 14:105285479-105285501 TTGCATGTGATGTAAGGTAAGGG - Intronic
1125909851 15:43426544-43426566 TAACATTTGATGTTAGTTTGAGG - Intronic
1128583927 15:68830674-68830696 TACCATGTTATGCAAGTTCAAGG - Intronic
1130874321 15:87999137-87999159 TATCCTGTGATGCAAGTCAGTGG - Intronic
1138024445 16:53511700-53511722 TGCCATGTGACTTAAGGTAGAGG - Intergenic
1144136177 17:12297237-12297259 AAACTTGTGGTGTAAGTTAGAGG - Intergenic
1146775406 17:35610113-35610135 TACCATATGGTGTTACTTAGGGG - Intronic
1150853482 17:68728058-68728080 TTGTATGTGATGTAAGGTAGGGG - Intergenic
1155413538 18:25571681-25571703 TTCCATGTGATGTTAGTCTGTGG - Intergenic
1155463310 18:26108117-26108139 TTGTATGTGATGTAAGATAGAGG + Intergenic
1159207720 18:65274904-65274926 TACTCTGTGATTAAAGTTAGTGG + Intergenic
928585788 2:32756679-32756701 TGCCAACTGATGTATGTTAGGGG + Intronic
928742242 2:34368899-34368921 TACCATGTGATGAAACTAACTGG - Intergenic
929427938 2:41863163-41863185 TCCCATGTGAAGTATGTTTGTGG - Intergenic
930904594 2:56551216-56551238 TACCAAGTCCTGTTAGTTAGAGG + Intergenic
933435767 2:82247793-82247815 TACCTTGTGAATTAAGTTGGAGG - Intergenic
934808084 2:97254627-97254649 TAGTATGTGGTGTAAGTTAAGGG + Intronic
934829426 2:97502560-97502582 TAGTATGTGGTGTAAGTTAAGGG - Intronic
935316001 2:101834339-101834361 TACCCAGACATGTAAGTTAGTGG + Intronic
935355411 2:102194558-102194580 TACCATGTGTTGTCAGGTATAGG - Intronic
936546717 2:113396143-113396165 TAGTATGTGGTGTAAGTTAGGGG + Intergenic
936707653 2:115094460-115094482 TACCATGTGATGTAAGTTAGAGG - Intronic
936922229 2:117700715-117700737 CACCCTGTGATGTATGTCAGTGG + Intergenic
939335215 2:140818392-140818414 TAGCATGTGATGTAACTTATTGG - Intronic
939644416 2:144679084-144679106 AACCATGTGCTGTAAGTTCAAGG + Intergenic
941999653 2:171633251-171633273 TACAATGAGATGTAAGGAAGAGG - Intergenic
942109494 2:172666207-172666229 TAGCATGTGTAGTAGGTTAGTGG - Intergenic
943897327 2:193381946-193381968 TTCCATCTGAGTTAAGTTAGAGG - Intergenic
943933871 2:193889567-193889589 TAACATGTAATGTAAGTAATAGG + Intergenic
1178068175 21:28930557-28930579 TACTTTATGATGTATGTTAGAGG - Intronic
949500854 3:4678802-4678824 TACCATGGGATGCAGGTCAGTGG + Intronic
949578778 3:5365642-5365664 AACCATGTGATCTAGGGTAGGGG + Intergenic
956127087 3:66020870-66020892 TCCCAGGTGAAGTAGGTTAGGGG - Intronic
957640904 3:82852057-82852079 TATGATAAGATGTAAGTTAGAGG + Intergenic
959426586 3:106197308-106197330 TACTATTTGATGTAACTTGGTGG - Intergenic
960198252 3:114797833-114797855 CACCATGTACTGAAAGTTAGTGG - Intronic
961373205 3:126445137-126445159 TACCTTCTGATGCAAATTAGTGG - Intronic
963490144 3:145989394-145989416 TTGCATGTGATGAAAGGTAGAGG - Intergenic
963636030 3:147797221-147797243 TAACATGTGTTATAAGTTAGTGG + Intergenic
963894206 3:150667842-150667864 TAACATGAGATGTTAGCTAGGGG - Intronic
967223721 3:187271703-187271725 TACCATGGGGTGGAAGCTAGAGG - Intronic
972603375 4:40592213-40592235 TACCAGGTGGTGTAAATAAGAGG - Intronic
973877088 4:55230636-55230658 CAACATGTGATGTGATTTAGTGG - Intergenic
975271746 4:72443249-72443271 TACCATGTAATGGAAGTTTGAGG - Intronic
977336258 4:95703382-95703404 TACCATGTGATCTCACTTATGGG - Intergenic
980042822 4:127959120-127959142 TACCTTTTGATGTAATGTAGTGG + Intronic
982572360 4:157066254-157066276 TAACATGTGATGCTAATTAGGGG + Intergenic
990289396 5:54333334-54333356 TTCTATGTGATTTAAGATAGGGG - Intergenic
990509697 5:56479445-56479467 TTCAATGTGATGGAATTTAGAGG - Intronic
994180216 5:96756057-96756079 TAACGTGTGAGGTAAGTCAGAGG - Intronic
994864796 5:105253664-105253686 TAACAGTTTATGTAAGTTAGAGG + Intergenic
998713633 5:144854663-144854685 TACAATGTGATGTTTGTTATAGG + Intergenic
1001537973 5:172512559-172512581 TTCCATGTGTACTAAGTTAGGGG - Intergenic
1001872815 5:175171469-175171491 TCCCATGTGATGTAGCTGAGAGG - Intergenic
1004807330 6:19218308-19218330 TATCATGTGATTTAAATAAGAGG + Intergenic
1010684955 6:78843310-78843332 TAGCCTCTAATGTAAGTTAGAGG + Intergenic
1012753917 6:103199541-103199563 TAACATGTAATGGAAGTTACTGG + Intergenic
1014473431 6:121843971-121843993 TACTATGTGCTGTAAGTTGTAGG - Intergenic
1016171216 6:141019388-141019410 TTCTATATGGTGTAAGTTAGGGG + Intergenic
1016288593 6:142502829-142502851 TTGCATGTGGTGTAAGTAAGGGG + Intergenic
1018759224 6:166876426-166876448 TAGCATGTGATCTAAGTGGGTGG + Intronic
1024769353 7:52700331-52700353 TTCAATGTGTAGTAAGTTAGTGG - Intergenic
1028815287 7:95136893-95136915 TAATATGTAATGTAAGTTTGAGG + Intronic
1033026302 7:137776367-137776389 TACCAGGTGATCTATGTTAGAGG - Intronic
1034118264 7:148603872-148603894 TACCATTTGATGGTAGTTACTGG + Intronic
1038127969 8:24695595-24695617 TACCATGTGACGAAAGTCAGGGG + Intergenic
1040719702 8:50304063-50304085 TACCATATGATGGAATTAAGAGG + Intronic
1042054671 8:64751307-64751329 TTCCATGTGATGTCATTTTGTGG - Intronic
1044510233 8:93068314-93068336 TACCATGTAATGTATGTAATAGG - Intergenic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1048476975 8:134752352-134752374 TGCCATGTGAGGTAAGTCACTGG - Intergenic
1050726211 9:8652100-8652122 TACCCTGAGCTGTAAATTAGAGG - Intronic
1055869742 9:80860884-80860906 AACCATGTGCTGTCTGTTAGAGG - Intergenic
1056155049 9:83825910-83825932 TACCATGTTATGTAAGATAGGGG - Intronic
1058188699 9:101887185-101887207 AACCATATGATTTAAGGTAGAGG - Intergenic
1186583301 X:10844394-10844416 TACCACATAATGTAAGTTAAGGG + Intergenic
1187480397 X:19649749-19649771 CACCATATGATTTCAGTTAGTGG + Intronic
1187567560 X:20467013-20467035 TACAATGAGATGGAATTTAGTGG + Intergenic
1188870801 X:35368485-35368507 AACCATGTGACTTAACTTAGGGG - Intergenic
1195177469 X:102324781-102324803 TTGCACGTGATGTGAGTTAGGGG - Intronic
1195181395 X:102362312-102362334 TTGCACGTGATGTGAGTTAGGGG + Intronic