ID: 936709619

View in Genome Browser
Species Human (GRCh38)
Location 2:115117791-115117813
Sequence ACAAGGAACCTTAAGGGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936709619 Original CRISPR ACAAGGAACCTTAAGGGTCG GGG Intronic
902404927 1:16177405-16177427 ACAAGGAACCTGAAGTGAAGGGG - Intergenic
907155990 1:52334410-52334432 AAAAGGAATCTTAATGGTTGAGG - Intronic
908946270 1:69501397-69501419 ACAAAGAACCTTAGGGGACAGGG - Intergenic
912460769 1:109829459-109829481 AAGAGGAACCCTAAGGCTCGAGG + Intergenic
915592800 1:156880200-156880222 AAAAGGAACCTGAAGGGGCATGG - Intronic
915619457 1:157071479-157071501 ACAGAGAACCTTAGGGGTGGGGG - Intergenic
918371394 1:183864912-183864934 ACAAGGAACCATAAGGGTACTGG + Intronic
1067929409 10:50545191-50545213 ACTAGGAACCTTAAGGCACTGGG - Intronic
1071550323 10:86561461-86561483 ACAAAGTACCTTAAGGGTGGGGG + Intergenic
1072863572 10:99032891-99032913 ACAAGGATCCTTAAAAGTGGAGG - Intronic
1081751384 11:45513661-45513683 ACAAGGAAACTGAAGTGTCTTGG + Intergenic
1083558318 11:63650916-63650938 ATAAGCAACATTAAGGATCGAGG + Intronic
1084492244 11:69485263-69485285 CCTTGGAACCTTAAGGGTCTGGG - Intergenic
1087765159 11:102143540-102143562 TCAAGGAAACTTGAGGGTTGGGG - Intronic
1102074591 12:110049572-110049594 ACAAAGTACCTTAAGGGTGGGGG + Intronic
1109045450 13:57405551-57405573 GCAAAGTACCTTAAGGGTGGGGG - Intergenic
1111204333 13:84984789-84984811 ACAAGGAATCTTAAAGCTCAGGG - Intergenic
1115240279 14:31246629-31246651 ACAAAGTACCTTAAGGGTGGGGG + Intergenic
1115240991 14:31250937-31250959 ACAAAGTACCTTAAGGGTGGGGG + Intergenic
1129591708 15:76920877-76920899 ACAAGGAACCCAAAGTGTCAAGG + Intergenic
1129941309 15:79499355-79499377 GCAAGGAACCTCAAAGATCGAGG - Intergenic
1135377226 16:21957858-21957880 TCAAGGAACATGAAGGGTTGTGG - Intronic
1135571927 16:23556338-23556360 AGAAGGAACCTTCTGGGTAGAGG - Intronic
1138441885 16:57040212-57040234 ACAAGGACCCATTAGGGTCCTGG + Intronic
1140863715 16:79041401-79041423 GCAAGGAACCGCAAGGGGCGTGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142601332 17:1054458-1054480 ACAAGGAACCTCAGGGGATGGGG + Intronic
1142601348 17:1054509-1054531 ACAAGGAACCTCAGGGGATGGGG + Intronic
1142601356 17:1054534-1054556 ACAAAGAACCTGAGGGGACGGGG + Intronic
1142601373 17:1054584-1054606 ACAAGGAACCTGAGGGGATGGGG + Intronic
1142601380 17:1054609-1054631 ACAAGGAACCTCAGGGGATGTGG + Intronic
1142601389 17:1054634-1054656 ACAAGGAACCTCAGGGGATGGGG + Intronic
1142601398 17:1054659-1054681 ACAAGGAACCTGAGGGGATGGGG + Intronic
1142601407 17:1054684-1054706 ACAAGGAACCTCAGGGGATGGGG + Intronic
1142601416 17:1054709-1054731 ACAAGGAACCTGAGGGGATGGGG + Intronic
1142601423 17:1054734-1054756 ACAAGGAACCTGAGGGGATGTGG + Intronic
1146109177 17:30071987-30072009 ACAGGGAAGGTTAAGGGTAGAGG + Intronic
1147784620 17:42970250-42970272 ACAAAGAAACTGAAGGGTTGAGG + Intronic
1150704894 17:67477778-67477800 ACATGGAACCCTCAGGGTAGAGG - Intronic
1154470327 18:14693955-14693977 ACATGGAACCCTAAGGGCCTTGG - Intergenic
1158049820 18:53203455-53203477 ACAAGGAATCTCAAGGTTCCAGG + Intronic
933297256 2:80504626-80504648 ACATGGAACCTGAAGGGCCTTGG + Intronic
934888353 2:98044782-98044804 ACAAAGTACCTTAAGGGCAGGGG + Intergenic
936697150 2:114964725-114964747 ACATGGAACCTTTAGGGTCATGG + Intronic
936709619 2:115117791-115117813 ACAAGGAACCTTAAGGGTCGGGG + Intronic
939433852 2:142147305-142147327 ACTAGGAATCCTAAGGGTAGAGG - Intergenic
1176804166 21:13463911-13463933 ACATGGAACCCTAAGGGCCTTGG + Intergenic
1179565495 21:42245304-42245326 ACAAGGAACCTGTTGGGTTGTGG + Intronic
1183340375 22:37277148-37277170 ACAAGGACACTTAAGAGTCTCGG + Intergenic
949274790 3:2266598-2266620 ACAAGGAGCCTTAAGGGACTAGG + Intronic
953655998 3:44855282-44855304 ACAAAGAACCTTAAGGGTGGGGG + Intronic
961253464 3:125525654-125525676 ATAAAGAAACTTAAGGGTGGGGG + Intergenic
962438976 3:135394568-135394590 AGAAGGAACCTTGAGGCTAGAGG - Intergenic
964445659 3:156754670-156754692 ACAAGGAAACTTTGGGGTCATGG - Intergenic
975324197 4:73041538-73041560 TCAAGGCACCTGAAGGGTCAAGG - Intergenic
977504290 4:97882236-97882258 ACAAGGAATATTAAGGGACAGGG + Intronic
979571578 4:122232759-122232781 GCAAGCAACCTTGAGGGTTGAGG - Intronic
980781059 4:137492994-137493016 ACAAGTAATCTTAAGGGACCTGG + Intergenic
981662451 4:147183788-147183810 CCCAGGAAGCGTAAGGGTCGAGG + Intergenic
984611868 4:181850003-181850025 ACAAGGAATATTCAAGGTCGGGG - Intergenic
1007083092 6:39122703-39122725 ACAAAGTACCTTAAGGGCGGGGG - Intergenic
1014290129 6:119548486-119548508 ACAAGGAACCTGGAGGGTATAGG - Intergenic
1014561454 6:122896076-122896098 AGAAGGAAACTCAAAGGTCGAGG - Intergenic
1015851042 6:137572991-137573013 GAAAGGAACCTTAAGAGTCTGGG + Intergenic
1016280665 6:142414534-142414556 GCAAGGAACCTAAAGGCTTGAGG + Intronic
1017225393 6:152015250-152015272 ATAAGGAACCGTAATGGTGGAGG - Intronic
1029237250 7:99131420-99131442 ACAAGGAACACTAAGGGACTTGG + Intronic
1032444871 7:131973642-131973664 GCAAGTAACCTTAAGGGTTGGGG + Intergenic
1040860556 8:51994422-51994444 ACAGGGAACCTTAAGCCCCGAGG - Intergenic
1041423495 8:57695040-57695062 CCCAGGAAGCATAAGGGTCGGGG + Intergenic
1041532055 8:58880150-58880172 ACAAGAAGCCTTGAGGGTGGAGG + Intronic
1045505497 8:102775476-102775498 ACAAAAAACCTTAAAGGTCAAGG + Intergenic
1047722935 8:127658936-127658958 ACAAAGAAACTTAAGGTTTGAGG + Intergenic
1048238721 8:132719148-132719170 CCAAGGAACCTTAAAGGGCGCGG - Intronic
1189036207 X:37495875-37495897 ACAAAGAAACATAAGGGTAGAGG - Intronic
1189037713 X:37509417-37509439 ACAAAGAAACATAAGGGTAGAGG - Intronic
1198769297 X:140111820-140111842 ACAAGGAACCTACAGGGCAGGGG + Intergenic
1199417361 X:147600478-147600500 ACATGGAACTTTAAGTGTCAAGG - Intergenic