ID: 936712213

View in Genome Browser
Species Human (GRCh38)
Location 2:115144262-115144284
Sequence GGGAAGCATGGGTCAGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936712213_936712223 23 Left 936712213 2:115144262-115144284 CCTTATTCTGACCCATGCTTCCC 0: 1
1: 0
2: 4
3: 20
4: 233
Right 936712223 2:115144308-115144330 GGGAAATGTATCTTGTTCTTTGG 0: 1
1: 0
2: 1
3: 26
4: 237
936712213_936712219 1 Left 936712213 2:115144262-115144284 CCTTATTCTGACCCATGCTTCCC 0: 1
1: 0
2: 4
3: 20
4: 233
Right 936712219 2:115144286-115144308 CTCTCTAGGATTGCTCTCCACGG 0: 1
1: 0
2: 0
3: 8
4: 146
936712213_936712221 3 Left 936712213 2:115144262-115144284 CCTTATTCTGACCCATGCTTCCC 0: 1
1: 0
2: 4
3: 20
4: 233
Right 936712221 2:115144288-115144310 CTCTAGGATTGCTCTCCACGGGG 0: 1
1: 0
2: 0
3: 1
4: 64
936712213_936712220 2 Left 936712213 2:115144262-115144284 CCTTATTCTGACCCATGCTTCCC 0: 1
1: 0
2: 4
3: 20
4: 233
Right 936712220 2:115144287-115144309 TCTCTAGGATTGCTCTCCACGGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936712213 Original CRISPR GGGAAGCATGGGTCAGAATA AGG (reversed) Intronic
900356794 1:2268831-2268853 GGGAAGAAGGAATCAGAATACGG - Intronic
900661857 1:3788671-3788693 GGGCAGCATGGCTCAGAAATGGG + Intronic
901592762 1:10359404-10359426 GGGAAACATGGGGCAGAATTGGG + Intronic
901900668 1:12359038-12359060 GGGAAGTCTGGGTCAGAAGTAGG + Intronic
902332433 1:15737039-15737061 GGGGAGCATGGATCAGAGCAAGG - Intronic
904675153 1:32194716-32194738 GGGCAGCATGGTGCAGAAAAGGG - Intronic
905762233 1:40569409-40569431 GGGAAGCAAGGGTAAGAGTGAGG + Intergenic
907831187 1:58065746-58065768 AGGAAGCAGGGGTCAGCAGAGGG + Intronic
908645700 1:66275616-66275638 GGGAAGCAGGAGGCAGAAAAAGG - Intronic
909669634 1:78173593-78173615 AGGCAGAATGGGTCACAATATGG - Intergenic
909706655 1:78593332-78593354 GGTAATCATAGATCAGAATAAGG + Intergenic
910035853 1:82787366-82787388 GGGAAAGCTGGGTGAGAATAAGG + Intergenic
911010587 1:93276897-93276919 GGGAACCAGGGTTCAGCATATGG + Intronic
911735510 1:101332272-101332294 AGGAAGAATGAGGCAGAATATGG + Intergenic
912468152 1:109888101-109888123 GGGAAGAATGGGCCAGAAACAGG + Intergenic
914994722 1:152533500-152533522 GGGCAGCATGGGACAGAGGAAGG - Intronic
916431232 1:164730993-164731015 GGGTAGCATTCATCAGAATAAGG + Intronic
917024867 1:170631096-170631118 AGGAAGGATGGGTCAGAATTAGG + Intergenic
917486488 1:175459581-175459603 GGGAACCTTGGTTCAGAGTAAGG - Intronic
917751712 1:178059310-178059332 GGGAAACATAGATCAAAATAAGG + Intergenic
918774180 1:188608211-188608233 TGGCAGCATGGGTCAGATTGGGG - Intergenic
919531406 1:198725762-198725784 GTGAATCATGGGTCAGAACATGG - Intronic
919814396 1:201428516-201428538 GGGTAGCGTGGGGCAGAATTGGG - Intronic
922788780 1:228298091-228298113 GGGAAGCAGGTGTCAGGACAAGG + Intronic
924903957 1:248432505-248432527 GGGTAGCATGGGGAAGAATTTGG + Intergenic
924923914 1:248659496-248659518 GGGTAGCATGGGGAAGAATTTGG - Intergenic
1068026181 10:51647930-51647952 GGGAAACATGGTTGAAAATAGGG - Intronic
1069575705 10:69526821-69526843 AGCAAGCATTGGTGAGAATATGG + Intergenic
1070362128 10:75700842-75700864 GGGAAGCATGGCTGATAGTAGGG + Intronic
1070465590 10:76720230-76720252 AGGAGGAATGGGACAGAATAAGG - Intergenic
1070701945 10:78610278-78610300 TGGAAGCAGGGGTCAGAGAAAGG + Intergenic
1070911427 10:80122239-80122261 GGGAAGTTTTGGTCAGATTAGGG - Intergenic
1073470213 10:103717480-103717502 GGGAACCATGGGGCAGAGCATGG + Intronic
1073831993 10:107395254-107395276 GAGAAGCTTGGGTAGGAATATGG + Intergenic
1075196998 10:120368366-120368388 GTCAAGCATGGCTCTGAATATGG + Intergenic
1075312915 10:121429829-121429851 GGGCAGCTTGGGACAGAAAAAGG - Intergenic
1075613910 10:123877110-123877132 GGGAAGCAGAGGCCAGAAAATGG + Intronic
1075691864 10:124401769-124401791 GGGGAGCATGGGTCCACATACGG - Exonic
1077886699 11:6392282-6392304 GGGAAGGAGGAGTCAGATTAGGG - Intronic
1078000018 11:7486054-7486076 GAGAAGCATGGGTAAAAATAAGG - Intronic
1078232423 11:9455460-9455482 TGGAAGTATTGGTAAGAATATGG + Intergenic
1084462560 11:69304008-69304030 GGGAAGGATGGGTCCGACTCAGG + Intronic
1084724025 11:70928677-70928699 GGGATCCATGGGGCAGAATTAGG + Intronic
1087169133 11:95032498-95032520 GAGAGGCAGGGGGCAGAATATGG + Intergenic
1088711967 11:112516358-112516380 GGGAGAAATGGGACAGAATAGGG + Intergenic
1088866295 11:113851172-113851194 GACAAGCATGGGTCAGATTAGGG - Intronic
1089611661 11:119672740-119672762 GGGAAGCATGGGAAGGAAAATGG - Intronic
1089853656 11:121521650-121521672 GAGAAGCATGAGTCAGAAAGAGG + Intronic
1090967164 11:131609065-131609087 GGGGTGCATGGGTCAGGATGTGG + Intronic
1091197557 11:133744885-133744907 GGGAAGCTTGAGTCAGAAGCTGG + Intergenic
1092249627 12:6885969-6885991 GGGAAGCAGCGTTCAGCATATGG + Intronic
1093413666 12:18895968-18895990 AGGAAGGATGGGTCAGGATCAGG + Intergenic
1094419617 12:30256842-30256864 GGGAAGGATGGGGCAGGATGGGG + Intergenic
1095876414 12:47083701-47083723 AGGAGGCATGGGTCAGCTTATGG + Intronic
1098013969 12:66084827-66084849 GGGAAGCTTGGGTGAGAGGATGG + Intergenic
1098306737 12:69109873-69109895 AGGAAGCATGAGTGAGAACAAGG - Intergenic
1099280246 12:80635125-80635147 AACAAGCATAGGTCAGAATAGGG - Intronic
1101677581 12:106932250-106932272 GGTAAGAATGGGTAAGAATGAGG - Intergenic
1101723816 12:107373591-107373613 GGCAAGCAGGGGTCAGGTTAAGG - Intronic
1102199401 12:111047036-111047058 GAGAAGCATGGGTCAGGGGAAGG + Intronic
1102531027 12:113546966-113546988 GGGAGGCCTGGGTCAGCACATGG - Intergenic
1103006783 12:117427169-117427191 GGGGAGCATGGATTAGAATTGGG - Intronic
1103180418 12:118906477-118906499 GGTAAGCAAGGGCCAGAAAATGG + Intergenic
1103859555 12:124001470-124001492 GGCAAGCACGGGACAGAACAGGG - Intronic
1105706027 13:22967855-22967877 GGGAACCATGGGTCAGGTGAGGG - Intergenic
1106634703 13:31515595-31515617 AGAAAGAATGGGTCAGAATTTGG + Intergenic
1106755715 13:32821206-32821228 ACGAAGCATGGGTCAGAACTGGG + Intergenic
1106908556 13:34437343-34437365 GGGAAGCATTTTTCAAAATAAGG + Intergenic
1107109330 13:36678971-36678993 GGGAAGAATGGGTCACAGTGAGG - Intronic
1107135258 13:36937885-36937907 GGGAAGCAGGGAACAGAAAATGG - Intergenic
1107258974 13:38467924-38467946 GGAAACCATGGGCCAGAAAAGGG - Intergenic
1107826996 13:44337758-44337780 GGTGAGAATGGGTCAGCATAAGG - Intergenic
1108805265 13:54147515-54147537 AGGAAGCAGAGGTCCGAATATGG + Intergenic
1108835010 13:54533360-54533382 AGGAAGCATGGATGAAAATATGG - Intergenic
1109166902 13:59046939-59046961 GTGAAGCATGGGCAAGAAAAAGG - Intergenic
1109553347 13:63935791-63935813 AGGAAGGATGGGTCAGAGTCAGG + Intergenic
1111200337 13:84927892-84927914 AGGAAGGATGGGTCAGAATCAGG - Intergenic
1114490418 14:23097420-23097442 GGGAAGAATGGGTTTGAAAAAGG + Intronic
1116295467 14:43101060-43101082 GGGAAGCATGGGCCCAAATGGGG - Intergenic
1116560919 14:46377339-46377361 AGGAAGGATGGGTCAGAGTTAGG + Intergenic
1120253163 14:82085064-82085086 GAGAAATATGGGTCACAATAAGG + Intergenic
1120416007 14:84218987-84219009 GAGAAGCAAGGGTCAGAGTCAGG + Intergenic
1121333950 14:93065335-93065357 GGGAAGCGTGAGTCTGAATGAGG - Intronic
1125177297 15:36839113-36839135 AGGAAGCATGGATGAGCATATGG - Intergenic
1128631905 15:69276686-69276708 GGGGACGATGGGTCAGAACATGG - Intergenic
1128709522 15:69861259-69861281 AGGGAGCATGGGGCAGAATCGGG + Intergenic
1130035899 15:80361249-80361271 GGGAAGACTGGGTCAGGAAAAGG + Intronic
1135173025 16:20203263-20203285 GGGAGGAATGGGTCAGAACCAGG + Intergenic
1135382216 16:22004685-22004707 GGGAAGCAGGGGTGGGAAGAGGG - Intergenic
1135428756 16:22363732-22363754 GGGAAGCATGGGTTGGGACATGG + Intronic
1137534430 16:49307509-49307531 GGTAAGAAGGGGTCAGAATTTGG - Intergenic
1138558884 16:57788355-57788377 GGGAGGCATGGGTGAGATGAAGG + Intronic
1141524720 16:84604087-84604109 GGGGAGCATGGGTGAGAAGGCGG - Intronic
1143542667 17:7578899-7578921 GGGAAGCAGGGGAGAGAAAATGG + Exonic
1143802103 17:9391755-9391777 GGGAAGCATATGGCAGAGTAGGG + Intronic
1147545638 17:41399307-41399329 GGGAAGCCCAGGACAGAATATGG - Intergenic
1148211342 17:45810651-45810673 GGGAGGCATGGAGGAGAATATGG - Intronic
1148764387 17:50028726-50028748 AGGAAGGACGGGTCAGAAAAGGG - Intergenic
1149557850 17:57586968-57586990 GGGAAGCATAGGGCAGAGTCAGG + Intronic
1155166985 18:23239673-23239695 AGGAAGCTTGGCTCATAATAAGG - Intronic
1156469444 18:37368283-37368305 GGGAAGGATGGGGCTGAAGAGGG - Intronic
1157241690 18:46015681-46015703 GAGAAGCATGGCTCTGAGTAAGG + Intronic
1157719839 18:49915276-49915298 GGGGAGAATAGGGCAGAATAGGG - Intronic
1158613918 18:58968577-58968599 GGGAACCGTGGGTCACAAGAAGG - Intronic
1159795135 18:72833483-72833505 TGCAAGCATGGTTCAAAATAGGG - Intronic
1162367273 19:10257105-10257127 GGGAAGTGTGGGTCAGGAGAGGG - Intronic
1162824703 19:13244457-13244479 GGGAAGCAATGGTCAAAAAAGGG - Intronic
1167165674 19:47798303-47798325 GGGGAGCATGGGTCTGCACAGGG + Intergenic
1168154946 19:54468261-54468283 GGGAAGTATTGGTGATAATATGG + Intronic
925903444 2:8524889-8524911 GGGAATCTTGGGACAGAAAAAGG + Intergenic
926392996 2:12413288-12413310 GGGGACCATGCGTCAGAAAATGG + Intergenic
926837920 2:17044928-17044950 GGGAAGCAAGGGGCAGACCAAGG - Intergenic
926871197 2:17419719-17419741 GTGAAAAATAGGTCAGAATAGGG - Intergenic
927504614 2:23604840-23604862 AGGAAGCATGGGTCAGGATGGGG - Intronic
929640754 2:43577071-43577093 CGGAAGCATGGGTCGGAGTGGGG - Exonic
931978556 2:67669742-67669764 GAGAAGCAGGGGTCAGAGTAGGG + Intergenic
932340551 2:70960530-70960552 GGGAAGGAAGGGTCACAGTAGGG - Intronic
933602534 2:84347782-84347804 AGGAAGGATGGGTCAGAATCAGG + Intergenic
936712213 2:115144262-115144284 GGGAAGCATGGGTCAGAATAAGG - Intronic
937029356 2:118725226-118725248 AGGAAGCAGGGGTCAGGCTAGGG + Intergenic
938408480 2:131045612-131045634 GGGAAGCCTGGGTCAGTATATGG + Intronic
939853702 2:147331031-147331053 GGGAGGCATGGGACAAAAAAGGG + Intergenic
943527220 2:189031421-189031443 GAGAAGAATGGATCAGAAGAGGG + Intergenic
943646629 2:190413288-190413310 GGGTAGAATGGGGGAGAATAGGG + Intronic
945500919 2:210573719-210573741 GGGAGGTATGGGTCTGATTAAGG + Intronic
946054654 2:216890093-216890115 GTGAAGCATGGGGCATAACATGG - Intergenic
946514570 2:220397655-220397677 GGGAGACATGGGTCACAATGAGG + Intergenic
947418349 2:229921297-229921319 GGGAAGCGAGGGTCAGAGAAGGG - Intronic
948202348 2:236138346-236138368 GGGAAGCATAGGCTAGAAGATGG - Intergenic
1168838518 20:893890-893912 GGGCAGCCTGGCCCAGAATAAGG - Intronic
1171182684 20:23102487-23102509 GGGAAGCATGGGGCAGCTGAGGG + Intergenic
1171517635 20:25750559-25750581 GGGAAGTATGGGTTAGAGGAGGG - Intergenic
1173844311 20:46178370-46178392 GGGCAGCATGGGGCAGAATTTGG - Intronic
1174992147 20:55522767-55522789 AGGAAGGATGGGTCAGAGTCTGG + Intergenic
1175297947 20:57922076-57922098 GGGAAGCTGGGGTCAGGATCAGG + Intergenic
1177545557 21:22553239-22553261 GTGAGGAATGGGTCAGATTATGG + Intergenic
1177878924 21:26669324-26669346 AGGAAGGATGGGTCAGGATCAGG + Intergenic
1179584822 21:42367879-42367901 GGGGAGCCTGGGCCAGAATGGGG + Intergenic
1181237638 22:21457256-21457278 GGTAAGCAGGGGTCAGAACTTGG + Intergenic
1181433988 22:22899789-22899811 GGCAAGCAAGGGTCTGAACAGGG - Intergenic
1181434925 22:22905159-22905181 GGCAAGCAAGGGTCTGAACAGGG - Intergenic
1183318802 22:37151897-37151919 ATGAACCATTGGTCAGAATAGGG - Intronic
1184335298 22:43849293-43849315 GGGAAAGATGGGGCAGAAGACGG + Intronic
1184933986 22:47705594-47705616 GTGAAGCAAAGGTCAGAAGAGGG - Intergenic
1185356770 22:50377569-50377591 GGGAAACATAGGCCAGAACATGG + Intronic
949571280 3:5295805-5295827 GGGAAGCATGGGGCAGACCAAGG + Intergenic
950702342 3:14759143-14759165 TGGAAGCAGGTGTCAGATTAGGG + Intronic
951386120 3:22044913-22044935 TGGAAGTATGGTGCAGAATACGG + Intronic
952258399 3:31715058-31715080 GGGAAGTATGGGTCAGATTGAGG - Intronic
953882887 3:46700783-46700805 GGGCAGCCAGGGTCAGAAAATGG + Intergenic
957981119 3:87511668-87511690 GGGAAAAAGGGGTCAGAAGAAGG + Intergenic
959808718 3:110591682-110591704 GGGAAGCAAGAGAGAGAATAGGG + Intergenic
960477249 3:118144875-118144897 AGGAAGGATGGGTCAGAGTTAGG + Intergenic
963426055 3:145125526-145125548 GTGAAGCGTGTGTCAGAATGTGG + Intergenic
963837901 3:150075470-150075492 GGGAATCATGGGTCAGAACAGGG - Intergenic
964912221 3:161797230-161797252 GGGAGGCAGGGGTAAGTATAAGG - Intergenic
965044396 3:163557036-163557058 GGTAAGCATGAGTCAGATTGTGG - Intergenic
966013870 3:175116917-175116939 TTGAAGAATGGATCAGAATAAGG + Intronic
967226473 3:187296493-187296515 CGGAAGCATGGCACAGAAGATGG + Intergenic
968398158 4:262743-262765 AGGCTGCATGGTTCAGAATAGGG - Intergenic
970155108 4:13133734-13133756 AGGAAGGATGGGTCAGAGTTAGG - Intergenic
970505945 4:16730667-16730689 GGAAAGCATGGGACGGAATCAGG + Intronic
970539652 4:17064654-17064676 GAGATGCATGGGACAGAATCTGG + Intergenic
971327226 4:25654630-25654652 GGAAAGCAAGGGGCAGAACAGGG + Intergenic
971453396 4:26821050-26821072 GGGATGCATGGGTGCCAATATGG + Intergenic
972269522 4:37497075-37497097 GGGAAGAGTGGGACAGAATGAGG - Intronic
972368539 4:38398677-38398699 GATAAGCATTGGTAAGAATATGG - Intergenic
973686050 4:53370971-53370993 GGGAAGCCAAGGTCAGAATATGG - Intergenic
976519479 4:86009355-86009377 GAGAAGCAGGGGTCAGAGCATGG - Intergenic
977097335 4:92762882-92762904 GTAAAGCATAGGTCAGAAAAAGG - Intronic
977272092 4:94929660-94929682 GGGAAGAATGAGCCAGAATAGGG - Intronic
977296734 4:95218223-95218245 TGGAACCATGGGTCATAAAAGGG - Intronic
978867243 4:113528569-113528591 GGGAAGCAGGACTCAGCATAAGG - Intronic
979631269 4:122905617-122905639 GTGACTCATGGGTGAGAATATGG - Intronic
979924295 4:126541183-126541205 GGGAAGAATGGTTCGTAATATGG - Intergenic
980114578 4:128666885-128666907 AGGAAGCATGGGATAGAAAATGG + Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984739533 4:183146863-183146885 GGTAAGCAAGGATCAGAAAATGG + Intronic
986073091 5:4306831-4306853 GGGAAGCATGGTCCTTAATAGGG - Intergenic
986549688 5:8938571-8938593 GGGAACCAGGGTTCAGCATATGG - Intergenic
986621932 5:9685001-9685023 GGTATGCATGGTTCAGAACAGGG + Intronic
987453869 5:18119608-18119630 AGGAAGGATGGGTCAGAGTTAGG - Intergenic
989342611 5:40393054-40393076 GGACAGCCTGGGTCAGAATCAGG + Intergenic
989522670 5:42420247-42420269 GGGAAGGGTGGGCCATAATAAGG + Intergenic
991695061 5:69263266-69263288 GGAGAGCAGGGGTCAGAATATGG - Intronic
995080674 5:108047700-108047722 AGGAAGGATGGGTCAGAATGAGG - Intronic
995111000 5:108428598-108428620 AGGAAGGATGGGTCAGGATTAGG + Intergenic
995685352 5:114766336-114766358 AGGAAGGATGGGTCAGGATCAGG + Intergenic
998591604 5:143485054-143485076 GGCAAGAATCAGTCAGAATATGG + Intergenic
998856667 5:146400791-146400813 GGGAAGGATGGGGCAAAGTAAGG - Intergenic
999644852 5:153707553-153707575 GGGAGTCATGGCTCAGAATTTGG + Intronic
1000735277 5:164891481-164891503 GAGAAGCATGGGCAAGAATAAGG - Intergenic
1004226749 6:13792084-13792106 GGGAAACCTGGGTAAGACTATGG + Intronic
1006666327 6:35696932-35696954 GCCAAGCATTGGTGAGAATATGG + Intronic
1008468253 6:51854667-51854689 AGGAAGGATGGGTCAGAGTTAGG + Intronic
1010276108 6:73970421-73970443 GGGAAGAAAAGGTCAGTATAGGG - Intergenic
1010577645 6:77552390-77552412 AGGAAGCCAGGGTCAGAATTTGG + Intergenic
1011663183 6:89611548-89611570 GACAACCAAGGGTCAGAATAAGG - Intronic
1012924809 6:105256604-105256626 GGGAAGCATTGTTAAGAATTAGG - Intergenic
1012967907 6:105695512-105695534 GGGAAACATAGGGCAGGATAAGG + Intergenic
1017087796 6:150730438-150730460 GGCATGCATAGGTCACAATAGGG + Intronic
1018249874 6:161858702-161858724 GGGGAGCATGGGTTAGAATAAGG - Intronic
1019018765 6:168900477-168900499 GGGAAGTAGGGGTGAGAAGAGGG + Intergenic
1019089211 6:169511940-169511962 GGGAAGCAAGGGTCTCAGTAAGG + Intronic
1020343038 7:7133259-7133281 GGGAAGAAAGGGATAGAATAAGG + Intergenic
1020352211 7:7233377-7233399 GGGAAGAATTGGTAAGAATAAGG - Intronic
1021101539 7:16589911-16589933 TAGAAGCATGGTACAGAATATGG - Intergenic
1022473341 7:30694903-30694925 GAGAAGAAGGGGTCAGAAAAGGG + Intronic
1024492103 7:49997248-49997270 CTGAAACATGGGTCAAAATATGG - Intronic
1026651009 7:72215926-72215948 GGTAAGCATGGGTCGGACCAAGG + Intronic
1028350763 7:89844626-89844648 GTGATGCATGGGGCAGGATATGG - Intergenic
1028440248 7:90851408-90851430 GGGAAGCATGGGTCAGTAGAAGG + Intronic
1030174075 7:106632348-106632370 GGGAAGCAGAGGTTAGAATGAGG - Intergenic
1030363634 7:108622170-108622192 GGGAAGCAGAGGACAGAATGGGG + Intergenic
1031707831 7:125004229-125004251 GGGAAGCCTGGTTGAGGATAAGG + Intergenic
1031804593 7:126292757-126292779 AGGAAGGATGGGTCAGAGTCAGG - Intergenic
1033113935 7:138608576-138608598 GGGATGTCTGGGTCAGAATCTGG + Intronic
1036441511 8:8785822-8785844 GGGAAGCATGGACGAGAACATGG - Exonic
1037394290 8:18425865-18425887 TGGAATGATGGGTAAGAATAGGG - Intergenic
1038538858 8:28374544-28374566 GGGAAGCATGGCCCAGATTCAGG - Intronic
1042442383 8:68843193-68843215 GGGAAGCAGTGATCAGAAAATGG - Intergenic
1042979064 8:74505543-74505565 GGGAAGTATGGGTTAACATAAGG - Intergenic
1043833947 8:85023773-85023795 AGCAAGCATGGGTGAGAAGAGGG + Intergenic
1044177299 8:89143664-89143686 GAGACGCATAGCTCAGAATATGG + Intergenic
1048299904 8:133244096-133244118 GGTCATCATGGGTCAGAATCTGG - Intronic
1048526627 8:135208748-135208770 AGGAAGCATGTTTCAGAATCAGG + Intergenic
1048959813 8:139567094-139567116 GGCAGGCATGGCTCAAAATAAGG + Intergenic
1049692763 8:143969827-143969849 GGGCAGCAGGGGTGAGAATGAGG + Intronic
1051022550 9:12561810-12561832 GGGAGGAATTGGTGAGAATATGG + Intergenic
1051473267 9:17474127-17474149 GGGAGTCATAGGTCAGAATATGG - Intronic
1052369243 9:27645573-27645595 GGGAAGGATGGGTCAGAGTCAGG - Intergenic
1052596293 9:30562369-30562391 GGGAAAACTGGGTCAGGATATGG + Intergenic
1055694395 9:78868134-78868156 GGAAACCAGGGCTCAGAATATGG + Intergenic
1056068383 9:82960711-82960733 GGGAAGGATGGCTTAGAAGAAGG + Intergenic
1056912753 9:90718258-90718280 GGCAAGGATGGCTCAGAGTATGG + Intergenic
1059465911 9:114468804-114468826 GGGCAGGATGGGTCAGATCATGG - Intronic
1059998743 9:119939282-119939304 GGGAAGGAGGGGACAGAAGAAGG + Intergenic
1061274777 9:129563552-129563574 GGGAAGCATGGGTGACTTTAAGG - Intergenic
1061717091 9:132525739-132525761 GGGAAGCAGGGTTCACTATAGGG - Intronic
1187556832 X:20359678-20359700 GGGAAGCAAGGTGCAGAACACGG - Intergenic
1190529614 X:51361688-51361710 AGGAAGGATGGGTCAGATTCAGG - Intergenic
1192207993 X:69108771-69108793 GGGAGACATGGCTGAGAATATGG + Intergenic
1192612439 X:72580877-72580899 GGGAAGGATGGGACAGAAAGGGG + Exonic
1193740143 X:85207242-85207264 GGGAAGCAATGCTCAGAACAAGG - Intergenic
1194520850 X:94917304-94917326 CTGAAACATGGGTCAAAATATGG + Intergenic
1194920385 X:99758315-99758337 GGGAAGAATGGGGAAGAATGTGG + Intergenic
1195237700 X:102917926-102917948 GGGAGGCAGGGTTCAGCATAGGG + Intergenic
1195948839 X:110245486-110245508 GGGAAGCTGGGCTCAGCATAAGG + Intronic
1197148337 X:123192715-123192737 GGGGAGCAAGGATAAGAATAAGG + Intronic
1197218185 X:123886736-123886758 GAGAAGCATGACTCATAATATGG - Intronic
1197634098 X:128895055-128895077 TAGAAGCATGGCACAGAATATGG - Intergenic
1197759762 X:130019743-130019765 GCGAGGCATGGGTCAGCTTAGGG + Intronic
1198145854 X:133857181-133857203 AGGAAGAATAGGTCAGAAGAAGG - Intronic
1198462584 X:136877737-136877759 GGGAAGCATGTTTTAGATTATGG - Intronic
1199206876 X:145159616-145159638 GGGAAAAATTGGTCAGAACAAGG + Intergenic
1199238152 X:145513919-145513941 TAGAAGCATGGCACAGAATATGG + Intergenic
1199279930 X:145989619-145989641 GGGAAGCATTGGTGAGAGTGTGG - Intergenic
1199535776 X:148901348-148901370 GGGAACCATGGCACAAAATAAGG + Intronic