ID: 936718501

View in Genome Browser
Species Human (GRCh38)
Location 2:115219341-115219363
Sequence TTGTACATGAATCATGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936718498_936718501 15 Left 936718498 2:115219303-115219325 CCCTGCTATTCATTACATAATAG 0: 1
1: 0
2: 1
3: 11
4: 173
Right 936718501 2:115219341-115219363 TTGTACATGAATCATGAGCATGG 0: 1
1: 0
2: 0
3: 5
4: 144
936718499_936718501 14 Left 936718499 2:115219304-115219326 CCTGCTATTCATTACATAATAGG 0: 1
1: 0
2: 1
3: 6
4: 90
Right 936718501 2:115219341-115219363 TTGTACATGAATCATGAGCATGG 0: 1
1: 0
2: 0
3: 5
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936718501 Original CRISPR TTGTACATGAATCATGAGCA TGG Intronic
904719716 1:32499017-32499039 GTGTACAGGAAACATGGGCAAGG - Intronic
905704848 1:40047522-40047544 TTGTAGATGAATCATGGCTAAGG + Intronic
906644833 1:47467023-47467045 ATGTACATGAATGATGACCTTGG - Intergenic
906728157 1:48058954-48058976 TTCCTCATGAATCAGGAGCAGGG - Intergenic
910098260 1:83548761-83548783 ATGTACTTGAAGCAGGAGCAAGG + Intergenic
912562568 1:110561113-110561135 TTGAAAATGAATCATGAGGGTGG - Intergenic
914419060 1:147511711-147511733 TTGTAAATGAATCATTTACAGGG + Intergenic
915822166 1:159035798-159035820 ATTGACATGAATCAGGAGCAGGG + Intronic
919205867 1:194421028-194421050 ATATACATGTATCATAAGCAAGG - Intergenic
920008225 1:202848997-202849019 TTCTACTTGAAGCATGAGCATGG - Intergenic
921682135 1:218046139-218046161 TTGTATAGGAATCAAGAGCTTGG + Intergenic
923629367 1:235639844-235639866 TTGTAAATGCCTCAGGAGCAGGG + Intronic
923955587 1:239014986-239015008 TTATACATGAATTCTGAGAATGG - Intergenic
1068064192 10:52108428-52108450 TTGAATATGAAACAAGAGCAGGG - Intronic
1069251770 10:66276027-66276049 TTTTACATGAATCATTTACATGG - Intronic
1070682785 10:78460870-78460892 TTGTACATGTGCCCTGAGCAAGG - Intergenic
1072378655 10:94842748-94842770 GGGTACATGAATCATGATGAAGG - Intronic
1073855982 10:107673715-107673737 TTTTGAATGAATCATGAGCCTGG - Intergenic
1077798306 11:5514205-5514227 TGGTATATGAAACTTGAGCATGG - Intronic
1084374754 11:68768764-68768786 TTTTTCATGGATCATGTGCAGGG + Intronic
1085792768 11:79510308-79510330 TGTTAAATGAATGATGAGCAAGG + Intergenic
1092023038 12:5217969-5217991 TTGTCCAAAAATCATGAGCCTGG - Intergenic
1092963372 12:13617439-13617461 GTGTCCCTGAATCATGAACATGG + Intronic
1093502719 12:19830591-19830613 TTGTACATCTATCATAAACAAGG - Intergenic
1094714172 12:32995163-32995185 TTGAAAATTAATCATGTGCAGGG + Intergenic
1095795321 12:46212525-46212547 TTGTACATGGGTCATGGGGAAGG + Intronic
1096133005 12:49175426-49175448 TTGTACATGAACCAAGTGGATGG - Intergenic
1100163362 12:91888040-91888062 TTTTACAGGAAGCATGACCAGGG + Intergenic
1104786445 12:131452719-131452741 CTGCACATGAATCAGGAGCTGGG + Intergenic
1104804732 12:131578417-131578439 TTGTACATCACTCAAAAGCAAGG + Intergenic
1107969387 13:45626668-45626690 TTGTAAATGAGTCTTGAGTAAGG - Intergenic
1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG + Intronic
1109317058 13:60762362-60762384 TTTTACATGAATGTTCAGCAAGG + Intergenic
1109529047 13:63616326-63616348 TTGTTCATGAATTTTGAACATGG + Intergenic
1111882520 13:93975433-93975455 TTATTCATGAATGATGAGCTGGG + Intronic
1113024391 13:105924055-105924077 TTTTACATGACTCTTGAGCATGG - Intergenic
1114388644 14:22282246-22282268 GTGTTCCTGAATCTTGAGCAAGG - Intergenic
1114920763 14:27325221-27325243 TTGAAAATGAGTCATGAGAAAGG + Intergenic
1115509566 14:34126400-34126422 TAGCAGATGAACCATGAGCAGGG - Intronic
1118969371 14:70620210-70620232 TTTTAAATAAATCCTGAGCATGG + Intergenic
1119626751 14:76184002-76184024 TTTCACATGCATCATTAGCATGG + Intronic
1120142936 14:80948631-80948653 TTGTAGAGGAATTATTAGCATGG - Intronic
1123922976 15:25083567-25083589 TTGGGCATGAATAATGTGCATGG + Intergenic
1124600332 15:31128412-31128434 TGGTTCATGAGTCAGGAGCAGGG - Intronic
1125213998 15:37248234-37248256 ATATACATGAGTAATGAGCATGG - Intergenic
1126024505 15:44432962-44432984 TTGAACATGAATGATCAACATGG + Intronic
1126600033 15:50418881-50418903 TTGTACCTCCATCATGATCAGGG - Intergenic
1130696715 15:86138729-86138751 TTGATTATAAATCATGAGCAAGG - Intergenic
1134458262 16:14410500-14410522 ACGCACATGAATCATGACCAGGG - Intergenic
1135389930 16:22083164-22083186 TTTTAACTGGATCATGAGCATGG + Exonic
1138095529 16:54208379-54208401 CTGAACATGAATCATAAGAAGGG + Intergenic
1138418137 16:56883074-56883096 TTTTACAGGAATCAGGAGCCTGG + Intronic
1139717711 16:68826841-68826863 TTGTTGATGAATCATGGACAAGG + Intronic
1146529573 17:33596827-33596849 TTGTACAAGAGTCCTGGGCAGGG + Intronic
1148840479 17:50493021-50493043 TTCTTCATGACTAATGAGCATGG - Intergenic
1154170400 18:12046949-12046971 TTCTTCAGGAATCCTGAGCATGG - Intergenic
1155614384 18:27704133-27704155 TAGTAGATGAATTATGAACAAGG + Intergenic
1163821846 19:19500492-19500514 GTGTACATGAAGCATGTGCTCGG - Intronic
925901908 2:8514868-8514890 TTGTACTTAAATCATCAGCTGGG - Intergenic
927656618 2:24953090-24953112 CAGAACATGAAACATGAGCAGGG - Intronic
930516351 2:52412229-52412251 TTGTACAGGAAGCATGAGGCTGG - Intergenic
933320716 2:80772533-80772555 TTTTTCATGAAACATGAGTAAGG - Intergenic
935138733 2:100332648-100332670 TTGTACATCAATTAAGAGCAAGG + Intergenic
935647688 2:105354254-105354276 TTCTACATGAACCATAAACAAGG - Intergenic
935823659 2:106919445-106919467 TTGTAAATAAATCAGGAGAATGG - Intergenic
936540692 2:113348428-113348450 ATGTACATGAATCAGGATGATGG - Intergenic
936718501 2:115219341-115219363 TTGTACATGAATCATGAGCATGG + Intronic
937509371 2:122576741-122576763 TTGTACAGAAATCATGCTCAAGG + Intergenic
937532561 2:122846600-122846622 TTGTAGATGCATCATGTGAAGGG + Intergenic
939315668 2:140546617-140546639 AGGTACTTGAATCATGAGGATGG - Intronic
939756813 2:146123887-146123909 TTGTCAATGAATCATCTGCAGGG + Intergenic
941049436 2:160715773-160715795 CTGTACCTCAAGCATGAGCAGGG - Intergenic
941200633 2:162504726-162504748 TTGGTCAGGAATCATTAGCAGGG - Intronic
942471477 2:176265281-176265303 TTGTACATGAGATTTGAGCAGGG - Intergenic
945588298 2:211695285-211695307 TTGTACATGAATCTAGAAAAAGG - Intronic
946126305 2:217566119-217566141 TTGTACAGGAAGCATGATGACGG + Intronic
946350966 2:219152302-219152324 ATGTTCATAAGTCATGAGCAGGG + Intronic
946373723 2:219296084-219296106 ATATGTATGAATCATGAGCAGGG + Intronic
1170351450 20:15446510-15446532 TTGTACATGAACCCTCAGGAAGG + Intronic
1171751422 20:29053507-29053529 TTTTACATAAGTCATGAGCTAGG + Intergenic
1173706146 20:45111697-45111719 TTGTGCATGAAATATGAACATGG - Intronic
1176703331 21:10085986-10086008 TTTTAGATGAATGATGTGCATGG - Intergenic
951019441 3:17766612-17766634 TTCTACATGTCTTATGAGCAGGG - Intronic
954045054 3:47922747-47922769 TTGTACATGAAAAAAAAGCAGGG + Intronic
957464752 3:80573018-80573040 ATGTTCTAGAATCATGAGCATGG - Intergenic
957523784 3:81354274-81354296 TGGCATATGAATCATGAGCTTGG + Intergenic
958659086 3:97042380-97042402 CTGTACAGGAAGCATGAGCCTGG - Intronic
959058018 3:101587347-101587369 TTGTAGAGGAATTTTGAGCAAGG + Intronic
963665852 3:148184955-148184977 ATGTCCATGAATCATGACTAGGG - Intergenic
964737160 3:159928969-159928991 TTATACTCGAATCATGACCATGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967626622 3:191693566-191693588 TTGTAAATAATTCATGAGCTTGG + Intergenic
969062125 4:4444916-4444938 TTGTCCCTTAATCAAGAGCAAGG + Intronic
970822123 4:20229948-20229970 TTTTACATGGATCATGTCCAAGG - Intergenic
974839521 4:67284828-67284850 TTTTACATGCAACATGTGCAAGG - Intergenic
977179016 4:93850542-93850564 TTGTATAAGAGTCATGAGAATGG - Intergenic
977811051 4:101356481-101356503 TAGCACATGATTCATGTGCAAGG + Intergenic
980375546 4:131942353-131942375 TTTTAGATGAATGATGTGCATGG - Intergenic
982604821 4:157501347-157501369 TTTGACATGAATTATAAGCAGGG + Intergenic
983384456 4:167041041-167041063 CTGTCTCTGAATCATGAGCAAGG - Intronic
985799854 5:1998168-1998190 TTGTGGGTGAGTCATGAGCAAGG + Intergenic
988320179 5:29684954-29684976 CTGTACATGAATCATGCCCGAGG - Intergenic
989076364 5:37567608-37567630 TTGGACATGAGTTTTGAGCATGG + Intronic
990943675 5:61228906-61228928 TTGTAAATGAGTCATCACCAGGG - Intergenic
993545034 5:89201614-89201636 TTCTATATGAATCCTAAGCATGG + Intergenic
994069195 5:95579504-95579526 TTGTAATTGAATCATGGGGATGG - Intronic
994619238 5:102143365-102143387 CTGTCCATTAATCATGTGCAGGG + Intergenic
995866929 5:116701415-116701437 TTGTACATGTAACATGGGCCAGG + Intergenic
1004498674 6:16189288-16189310 TTTTACATAAATCATGGGAAAGG - Intergenic
1006195674 6:32240506-32240528 TTGTAAATGTTTGATGAGCATGG + Intergenic
1007881643 6:45174862-45174884 TTTTAGATGAATCATGTGTAAGG - Intronic
1008160989 6:48075334-48075356 TTATAAATGAATCATAAGTATGG + Intergenic
1009617950 6:66034730-66034752 TTGTACAGGAAGCATGATCCTGG - Intergenic
1010773634 6:79861042-79861064 TTTTAAATTAATCATGAGTATGG + Intergenic
1012311758 6:97734185-97734207 TATTACCTGAATCATTAGCAAGG - Intergenic
1013036970 6:106394295-106394317 TTGTATATGTATCATAAGAAAGG - Intergenic
1014613229 6:123569592-123569614 TTGTACAGGAATCATGATGCTGG + Intronic
1015756760 6:136615198-136615220 TTATTCATGATTCATGAGCCAGG + Intronic
1016706937 6:147119862-147119884 TTGTACATTCATTATGAACAAGG - Intergenic
1016914897 6:149235738-149235760 TAGGACATGAATCTTGAGCAGGG - Intronic
1018875383 6:167817976-167817998 GTGTAGGTGAGTCATGAGCAGGG + Intergenic
1019720435 7:2567364-2567386 CTGGACGTGAATCCTGAGCAGGG + Intronic
1019958258 7:4434609-4434631 TTGTGCATGATTCGTGAGAAAGG + Intergenic
1021706496 7:23373152-23373174 TAGTACTTGGAACATGAGCAAGG - Intronic
1022614608 7:31916485-31916507 TTGTCCATGAACCAGCAGCATGG - Intronic
1029588206 7:101488895-101488917 TTGTGCAGTAATCATGAGAATGG + Intronic
1029638367 7:101801574-101801596 TTGTTCATGATTCATTAGCCAGG - Intergenic
1030648853 7:112095182-112095204 TTTTATATGGATTATGAGCAAGG + Intronic
1038925115 8:32130193-32130215 GTGTACATGAATCATTTGGAAGG - Intronic
1040392242 8:46960170-46960192 TTATACATGATTCATGAACTAGG + Intergenic
1041718460 8:60953247-60953269 GTGTACATAAAGCATGAGCAGGG - Intergenic
1045348549 8:101316891-101316913 TTGTACATGAATCCTCAACTTGG + Intergenic
1045872011 8:106937953-106937975 TTGTAGTTGACTGATGAGCAGGG + Intergenic
1051027578 9:12631411-12631433 ATGTACATTAATTATGTGCAGGG + Intergenic
1053640596 9:40072996-40073018 TTTTAGATGAATGATGTGCATGG - Intergenic
1053765542 9:41392470-41392492 TTTTAGATGAATGATGTGCATGG + Intergenic
1054544154 9:66303629-66303651 TTTTAGATGAATGATGTGCATGG + Intergenic
1057059767 9:91993311-91993333 TAGTACATGAATTAATAGCATGG - Intergenic
1057608816 9:96522247-96522269 TTCTCCATGAATAATCAGCATGG - Intronic
1058522830 9:105828812-105828834 TGGGCCCTGAATCATGAGCAGGG - Intergenic
1058744061 9:107972717-107972739 TCATACATGAAGCAAGAGCAGGG - Intergenic
1059571138 9:115437370-115437392 TTGTATTTGAATCATTAGAAGGG + Intergenic
1060088494 9:120722173-120722195 TTGTACCTCCATCATGACCAGGG - Intergenic
1060359330 9:122940629-122940651 TTGCACATGAAAGGTGAGCAGGG + Intergenic
1061425487 9:130495752-130495774 TAGTCCAGGAATCATCAGCATGG - Intronic
1202788363 9_KI270719v1_random:56091-56113 TTTTAGATGAATGATGTGCATGG - Intergenic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1191951988 X:66602590-66602612 TTTCACATGAATCAGGAACAAGG - Intronic
1196076703 X:111585730-111585752 CTATACAAGAAGCATGAGCATGG - Intergenic
1201242022 Y:11968330-11968352 TTGAATATGACTGATGAGCACGG + Intergenic