ID: 936720206

View in Genome Browser
Species Human (GRCh38)
Location 2:115242367-115242389
Sequence CTGTGGGATATATACATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936720206_936720211 5 Left 936720206 2:115242367-115242389 CCCATCATGTATATATCCCACAG 0: 1
1: 0
2: 3
3: 21
4: 236
Right 936720211 2:115242395-115242417 TTATCCACTCATCGATTGATGGG 0: 7
1: 553
2: 1174
3: 1827
4: 3479
936720206_936720213 12 Left 936720206 2:115242367-115242389 CCCATCATGTATATATCCCACAG 0: 1
1: 0
2: 3
3: 21
4: 236
Right 936720213 2:115242402-115242424 CTCATCGATTGATGGGCATTTGG 0: 6
1: 534
2: 897
3: 1244
4: 2517
936720206_936720210 4 Left 936720206 2:115242367-115242389 CCCATCATGTATATATCCCACAG 0: 1
1: 0
2: 3
3: 21
4: 236
Right 936720210 2:115242394-115242416 TTTATCCACTCATCGATTGATGG 0: 7
1: 619
2: 1893
3: 5012
4: 9536
936720206_936720214 13 Left 936720206 2:115242367-115242389 CCCATCATGTATATATCCCACAG 0: 1
1: 0
2: 3
3: 21
4: 236
Right 936720214 2:115242403-115242425 TCATCGATTGATGGGCATTTGGG 0: 7
1: 608
2: 1332
3: 3933
4: 13080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936720206 Original CRISPR CTGTGGGATATATACATGAT GGG (reversed) Intronic
900034330 1:394335-394357 CTGTGGGAAACCTGCATGATGGG + Intergenic
900055164 1:624227-624249 CTGTGGGAAACCTGCATGATGGG + Intergenic
903717966 1:25383194-25383216 CTGTGGGATTTTTAAGTGATGGG - Intronic
904989137 1:34577389-34577411 ATGTGGGATACATACACAATGGG - Intergenic
909078237 1:71078861-71078883 CTGGGGGAAAAATACTTGATTGG + Intronic
909271916 1:73633531-73633553 CTGTGGGATACATCCAAAATTGG - Intergenic
909772111 1:79436720-79436742 CTGTGGTATGTATACATCATGGG + Intergenic
910547010 1:88429589-88429611 ATGTGGTATATATACATAATGGG + Intergenic
910606055 1:89086306-89086328 CTGCGGAATATGTAAATGATTGG - Intergenic
912049389 1:105506005-105506027 CTGTGGGCTATTTACATATTTGG - Intergenic
913555043 1:119957546-119957568 CTGTGGTATATACTCATGAGTGG - Intronic
914202667 1:145500031-145500053 ATGTGGTACATATACATCATGGG - Intergenic
914481790 1:148073182-148073204 ATGTGGTACATATACATCATGGG - Intergenic
915742208 1:158127448-158127470 CTGTGGGATATTGAAATTATTGG - Intergenic
916127382 1:161583230-161583252 CTGTGGAATGGATACATAATTGG + Intronic
916137301 1:161665034-161665056 CTGTGGAATGGATACATAATTGG + Intronic
916159942 1:161899795-161899817 CTGTGGAATATATAGGTCATAGG - Intronic
916513015 1:165489969-165489991 TTGTGGGATGTATCCATCATTGG - Intergenic
916762934 1:167833320-167833342 CTATTGGATATATGCATGAAGGG + Intronic
917079562 1:171243095-171243117 GTGTGGCATATATACAGCATGGG + Intergenic
918470263 1:184865242-184865264 ATGTGGTATATATACACAATGGG + Intronic
918834705 1:189446575-189446597 ATGTGGCACATATACATCATGGG + Intergenic
919172159 1:193968574-193968596 ATGTGGTATTTATACATAATAGG + Intergenic
920192819 1:204204653-204204675 TTGTGGGGTATATACCTGAAAGG - Intronic
921388072 1:214590661-214590683 TTGTGGGAGATATAATTGATAGG + Intergenic
924218165 1:241846897-241846919 ATGTGTGATATATTCATGGTTGG + Intergenic
924337891 1:243001385-243001407 CTGTGGGAAACCTGCATGATGGG + Intergenic
924907111 1:248467502-248467524 ATGTGGTACTTATACATGATAGG - Intergenic
1063566562 10:7176455-7176477 GTGCGGGATACATACCTGATGGG + Intronic
1063779610 10:9306418-9306440 ATGTGGTATATATACACTATGGG + Intergenic
1064619010 10:17195236-17195258 ATGTGGTATATATACACCATTGG + Intronic
1064875262 10:19986981-19987003 TTGTGGGATATATATTTAATTGG + Intronic
1065212840 10:23421240-23421262 CTGTGGGATATAAAATTTATTGG - Intergenic
1068059508 10:52049754-52049776 CTGTGGGCAATATTAATGATGGG + Intronic
1069231631 10:66016447-66016469 CTCTGGGATAGATAGATTATTGG - Intronic
1070040862 10:72778308-72778330 ATGTGGTATATATACACAATGGG + Intronic
1070346589 10:75548760-75548782 CTGTCGGAAATATACATACTCGG + Intronic
1070554297 10:77516164-77516186 CTGTGGGTACTCTACATGATGGG - Intronic
1071405352 10:85324695-85324717 CTGTGGTATATATATACAATGGG - Intergenic
1072592199 10:96836807-96836829 GTAAGGGATATACACATGATAGG + Intronic
1073890833 10:108098593-108098615 ATGTGGCATATATACAGTATGGG + Intergenic
1079661681 11:23045079-23045101 CTGGGAGATATATAAATGATTGG - Intergenic
1080340509 11:31258231-31258253 CTGTGGGAGAAATACATCCTGGG + Intronic
1082563199 11:54643593-54643615 ATGTGGCACATATACATCATGGG + Intergenic
1085552375 11:77386543-77386565 CTGGGGGATGCATAAATGATTGG - Intronic
1087504678 11:99004153-99004175 ATGTGGTACATATACATTATGGG - Intergenic
1088046954 11:105464582-105464604 ATGTGGTACATATACATAATGGG + Intergenic
1088906793 11:114161189-114161211 CTGTGGGAAATCTACCTAATGGG - Intronic
1091162452 11:133437452-133437474 CTGTGGGATTTCTCCATGAAAGG - Intronic
1092082708 12:5730986-5731008 CTTGGGTATATATGCATGATTGG - Intronic
1092927592 12:13285987-13286009 CTGTGGCATATACACACAATGGG + Intergenic
1092943845 12:13435369-13435391 CTGAGGCATATATTCATGACAGG + Intergenic
1092979111 12:13776060-13776082 ATGTGGTATATATACAGCATGGG + Intronic
1095366552 12:41413149-41413171 ATGTGGTATACATACATAATGGG + Intronic
1097717983 12:62987273-62987295 CTGTGGGATGTGTATATGTTGGG + Intergenic
1097972000 12:65643344-65643366 GTGTGGAATATATACACAATGGG - Intergenic
1099881544 12:88473126-88473148 CTGTGGTATAAATACTTGAATGG + Intergenic
1099896604 12:88655578-88655600 ATATAGGATATATACATTATCGG - Intergenic
1100872881 12:98930564-98930586 CTGTGGTGTATCTATATGATGGG + Intronic
1101187633 12:102296046-102296068 ATGTGGCATACATACACGATGGG - Intergenic
1102222938 12:111206814-111206836 CTGTTGGATAAATAGATGGTTGG + Intronic
1102926992 12:116833855-116833877 CTGTGGTACAAATACATCATGGG + Exonic
1103111828 12:118286852-118286874 CTGTGGTATATATATTTAATGGG + Intronic
1103169776 12:118806846-118806868 GTGTGGTATATATACACAATGGG - Intergenic
1104531391 12:129574353-129574375 TTGGGGGATATATACATGCTGGG + Intronic
1104738981 12:131158776-131158798 CTGTAGGGGATATACTTGATGGG + Intergenic
1108141799 13:47431237-47431259 ATGTGGTATATATACACCATGGG - Intergenic
1108849683 13:54712643-54712665 GTGTGGTATATATACACAATGGG - Intergenic
1109125843 13:58516122-58516144 GTGAGAGATATATATATGATGGG + Intergenic
1109387935 13:61657024-61657046 ATGTGGTATATATACATGATGGG - Intergenic
1109805426 13:67434488-67434510 CTGTGCCATATATAAATGAGGGG + Intergenic
1110639395 13:77804581-77804603 ATGTGGTATATATACACCATGGG - Intergenic
1111122650 13:83874439-83874461 AGGTGAGATATATACATCATTGG - Intergenic
1114155184 14:20094614-20094636 ATGTGGTATATATACACCATAGG + Intergenic
1114679483 14:24472865-24472887 CTGTGGGATAGATTTAGGATAGG + Intergenic
1115270487 14:31546376-31546398 ATGTGGTATATATACACAATAGG + Intronic
1115270582 14:31547850-31547872 ATGTGGTATATATACACAATAGG - Intronic
1115299811 14:31871612-31871634 CTGTAGTATATATACATGATGGG + Intergenic
1116997158 14:51335919-51335941 CTGTGGGTTATACTCAGGATTGG + Intergenic
1118133294 14:62992186-62992208 ATGTGGCATATATACACAATGGG - Intronic
1118956382 14:70486184-70486206 ATGTGGTATATATACACAATGGG + Intergenic
1118994800 14:70826067-70826089 CTCTGGGCTCTGTACATGATGGG - Intergenic
1119016736 14:71064975-71064997 ATGTGGCATATATACACCATTGG - Intronic
1120800073 14:88678075-88678097 ATGTGGTATATATACACCATGGG + Intronic
1122316811 14:100830385-100830407 CTGTGGGGTAGATACACGAGGGG - Intergenic
1123099815 14:105789997-105790019 ATGTGGTATATATACACCATGGG + Intergenic
1123871170 15:24575111-24575133 CTGAGTGATACATACATGTTGGG + Intergenic
1127650092 15:60998697-60998719 CTGTCAGAAATATACATGGTGGG - Intronic
1128031092 15:64480622-64480644 CTCTGGGCTATATACCTCATAGG + Intronic
1129204574 15:74028861-74028883 ATGTGGCATATACACATAATGGG - Intronic
1130004138 15:80078415-80078437 ATGTGGTACATATACATTATGGG - Intronic
1130425785 15:83797814-83797836 CTCTGGGATATATACCTGAGCGG - Intronic
1133714876 16:8438295-8438317 CTGTGGTGTATTTATATGATGGG - Intergenic
1135223169 16:20631649-20631671 ATGTGGTATATATACACCATGGG + Intronic
1135898090 16:26428790-26428812 ATGTGGTATATATACACAATGGG + Intergenic
1135973699 16:27090916-27090938 CTGTGGTGTATATATATGCTGGG + Intergenic
1137868705 16:51928954-51928976 CTGTGCGATATATATGTAATGGG - Intergenic
1139066452 16:63321506-63321528 TTGTGGAATATATACATGGTGGG - Intergenic
1140159021 16:72465448-72465470 TTGTGTGCAATATACATGATTGG + Intergenic
1146066909 17:29643285-29643307 CTGTTGGATATATAGCTGTTAGG - Intronic
1147466318 17:40613875-40613897 CTGTGGGAAACATAAATGGTGGG + Intergenic
1149709227 17:58724301-58724323 CTCTGGAATATTTAAATGATGGG + Intronic
1153348131 18:4050411-4050433 CTGTGAGGTATATGCAGGATAGG + Intronic
1157108725 18:44799698-44799720 CTGTTGGAGGTATACTTGATAGG + Intronic
1159182378 18:64925278-64925300 ATGTGGTACATATACATCATGGG + Intergenic
1159303548 18:66610258-66610280 ATGTGCTATATATACATAATGGG + Intergenic
1160236728 18:77091749-77091771 GTGTGGCATATATACATGTATGG - Intronic
1165332571 19:35149145-35149167 CTGTGGGAAAGATACCTGACTGG + Intronic
1167955809 19:53062936-53062958 CCGTGGGATGTATACATTAAAGG + Intergenic
1168392128 19:56018061-56018083 CTGTGGTGTATATACACAATGGG + Intronic
925961775 2:9023998-9024020 ATGTGGTATATATACACCATGGG + Intergenic
927127579 2:20026726-20026748 ATGTGGCACATATACATCATGGG + Intergenic
928814028 2:35267760-35267782 ATGTGGTATATATACACAATGGG - Intergenic
930962710 2:57280269-57280291 ATGTGGTACATATACACGATGGG + Intergenic
932623818 2:73283278-73283300 CTCTGGGAGGTATACATGTTGGG - Intronic
933085300 2:78047635-78047657 ATGTGGTATATATACACCATAGG - Intergenic
933693793 2:85200109-85200131 ATGTGGGATATCCACACGATGGG - Intronic
935200871 2:100855549-100855571 TTGTGGAATAAATGCATGATGGG - Intronic
936619876 2:114084427-114084449 CTGTGGTTTATTTAGATGATAGG - Intergenic
936619898 2:114084638-114084660 CTGTGGTTTATTTAGATGATAGG - Intergenic
936619909 2:114084745-114084767 CTGTGGTTTATTTAGATGATAGG - Intergenic
936720206 2:115242367-115242389 CTGTGGGATATATACATGATGGG - Intronic
937830510 2:126416707-126416729 ATGTGGTATATATACACAATGGG + Intergenic
937850891 2:126634737-126634759 CTGTTGAATACATAAATGATTGG + Intergenic
939526773 2:143305110-143305132 ATGTGGCATATATACACCATTGG + Intronic
939696689 2:145334266-145334288 GTGTAAGATATATACATTATTGG + Intergenic
940130984 2:150381617-150381639 ATGTGGTATATATACACCATGGG - Intergenic
941483536 2:166048560-166048582 ATGTGGTACATATACATCATGGG - Intronic
941792172 2:169564925-169564947 ATGTGGTATATATACACAATGGG - Intronic
942683133 2:178500301-178500323 AGGTTGGATATATACATCATTGG - Intronic
943600774 2:189918648-189918670 CTTTGGGATATATACTGGAGAGG - Intronic
944012340 2:194987417-194987439 ATGTGGTATATATACACAATGGG + Intergenic
944941637 2:204634348-204634370 ATGTGGTATATATACACAATGGG - Intronic
946479582 2:220041100-220041122 CAGAGGGATATAGACATTATAGG + Intergenic
1174211453 20:48881974-48881996 CTGTATGATATATACAGAATAGG - Intergenic
1179233278 21:39524365-39524387 CTGTGGGATATAATCAGGAATGG + Intergenic
1179472101 21:41617978-41618000 GTGTGTGTTACATACATGATTGG - Intergenic
1180603747 22:17039620-17039642 ATGTGGTATATATACACCATGGG - Intergenic
1182167179 22:28187774-28187796 CTGGGAGATATATTCATCATTGG + Intronic
1182449837 22:30413029-30413051 CTGTGAGATATAAAAATGTTGGG + Intronic
949647732 3:6117062-6117084 CTGTGGTATATAAATAGGATTGG - Intergenic
949700899 3:6756615-6756637 ATGTGGTATATATACACAATGGG + Intergenic
957143116 3:76386799-76386821 CTGTGGGACATACATATGCTAGG + Intronic
958477270 3:94600796-94600818 CTGTGGTAAATATATATGATGGG + Intergenic
958792330 3:98666238-98666260 ATGTGGTATATATACACAATGGG - Intergenic
959031339 3:101302301-101302323 GTGTGGCAAATATATATGATGGG - Intronic
959629133 3:108488643-108488665 ATGTGGTATATATACACAATAGG - Intronic
959981008 3:112517423-112517445 ATGTGGTACATATACATCATGGG - Intergenic
960137156 3:114117453-114117475 CTGTGGTATATACATATAATAGG - Intergenic
960641404 3:119827443-119827465 ATGTGGTATATATACACAATGGG + Intronic
960986072 3:123281911-123281933 CCGTGGCATATAAACATGTTTGG + Intergenic
962591720 3:136896496-136896518 ATGTGGCATATATACACAATGGG - Intronic
964593600 3:158395968-158395990 ATGTGGTACATATACATCATGGG + Intronic
966990280 3:185222831-185222853 CTGTGGAATATTCACATGCTAGG - Intronic
967342191 3:188411086-188411108 TTGTGGTATATATACACTATGGG - Intronic
970379838 4:15495590-15495612 ATGTGGTATATATACACCATGGG - Intronic
970425715 4:15944235-15944257 ATGTGGTACATATACATTATGGG - Intergenic
971729816 4:30362637-30362659 CTCTGGAATATATTCCTGATAGG + Intergenic
972007621 4:34131011-34131033 ATGTGGTACATATACATGATGGG + Intergenic
976470598 4:85424386-85424408 ATGTGGTACATATACATCATGGG - Intergenic
977500775 4:97834142-97834164 ATGTGGCATATATACACCATGGG + Intronic
977644692 4:99399676-99399698 CTGTGGTACATATACACAATGGG + Intergenic
978147306 4:105390969-105390991 ATGTGGTACATATACATCATAGG + Intronic
978212991 4:106160898-106160920 ATGTGGTATATATACAAAATAGG + Intronic
978236380 4:106465920-106465942 ATGTGGCACATATACATCATGGG - Intergenic
978934986 4:114363694-114363716 CTGTGGTATGTATACATGGTGGG - Intergenic
979191081 4:117859533-117859555 AAGTGGTATATATACATCATGGG + Intergenic
979239246 4:118433947-118433969 CTGTGGGAAACCTGCATGATGGG - Intergenic
980674157 4:136052636-136052658 CTGTGGGACAAATATATCATTGG - Intergenic
981218783 4:142206499-142206521 TGGTGGTATATATATATGATTGG + Intronic
982691373 4:158551096-158551118 ATGTGGTATATATACATAATGGG + Intronic
983256854 4:165409504-165409526 CTGTGGGATATAAGCATGAGTGG - Intronic
987556387 5:19456546-19456568 ATATAGGATATATACAAGATGGG + Intergenic
987991400 5:25217253-25217275 ATGTGGTATATATACACCATGGG + Intergenic
988316843 5:29642460-29642482 ATGTACCATATATACATGATAGG - Intergenic
989567836 5:42918594-42918616 ATGTGGTATATATACACCATGGG - Intergenic
991443189 5:66672885-66672907 CTGGGGGATATGTACCTGATAGG - Intronic
991745145 5:69731750-69731772 CTGTGGCATAAATACATATTTGG - Intergenic
991752561 5:69823472-69823494 CTGTGGCATAAATACATATTTGG + Intergenic
991796714 5:70311479-70311501 CTGTGGCATAAATACATATTTGG - Intergenic
991802179 5:70380208-70380230 CTGTGGCATAAATACATATTTGG + Intergenic
991824523 5:70607064-70607086 CTGTGGCATAAATACATATTTGG - Intergenic
991831880 5:70698601-70698623 CTGTGGCATAAATACATATTTGG + Intergenic
991889092 5:71311036-71311058 CTGTGGCATAAATACATATTTGG - Intergenic
993794882 5:92254850-92254872 ATGTGGTATATATACATCGTGGG + Intergenic
994040157 5:95249791-95249813 ATGTGGCACATATACATCATGGG + Intronic
995296480 5:110530508-110530530 ATGTGGTATATATACACAATGGG + Intronic
995932534 5:117465243-117465265 TTGTGGCATATATACACAATGGG - Intergenic
996139039 5:119882128-119882150 ATGTGGTATATATACACAATAGG + Intergenic
996495764 5:124153953-124153975 CTGTAGTATGTCTACATGATGGG + Intergenic
997050346 5:130372874-130372896 ATATTGGATATATATATGATTGG - Intergenic
998314598 5:141170850-141170872 CTGTGGGATGAATAAGTGATAGG + Intergenic
998774581 5:145585069-145585091 ATGTGGTATATATACACAATGGG + Intronic
1000653746 5:163850731-163850753 AGGTGGTATATATACATAATGGG + Intergenic
1002739490 5:181424533-181424555 CTGTGGGAAACCTGCATGATGGG - Intergenic
1003921792 6:10839410-10839432 ATGTGGTATATATACACCATAGG + Intronic
1005435817 6:25810887-25810909 ATGTGGTATATATACACAATGGG + Intronic
1005555811 6:26982158-26982180 CTGTGGCATAAATACATATTTGG - Intergenic
1007308338 6:40924557-40924579 CTGTGGAATAAATAAATGAGAGG + Intergenic
1011326867 6:86158048-86158070 ATGTGGTACATATACATCATGGG + Intergenic
1011853337 6:91657925-91657947 CTTTTGGATTTAAACATGATGGG + Intergenic
1013064748 6:106672895-106672917 CTGCTGTATATATGCATGATAGG - Intergenic
1015053200 6:128867380-128867402 ATGTGGTATATATACTTCATAGG + Intergenic
1016198243 6:141373592-141373614 TTTTGGAACATATACATGATAGG - Intergenic
1017372908 6:153734863-153734885 TAGTGTGATATATACATGGTAGG + Intergenic
1017401396 6:154068563-154068585 ATGTGGTATATATACACAATGGG - Intronic
1018660669 6:166083811-166083833 ATGTGGCATATATACACAATGGG + Intergenic
1019244606 6:170700104-170700126 CTGTGGGAAACCTGCATGATGGG - Intergenic
1021130541 7:16907377-16907399 CTGTAGTATATATACAGGATGGG + Intergenic
1021669609 7:23022137-23022159 CTGTGGTATATATCCAGGAGGGG + Intergenic
1023221468 7:37923340-37923362 CTGAGGAAAATGTACATGATTGG + Intronic
1027294046 7:76748082-76748104 ATGTGGTACATATACATCATGGG - Intergenic
1029568172 7:101353322-101353344 CTTTGGGATATATACCTGCTGGG + Intergenic
1030950633 7:115787058-115787080 ATGTGGCACATATACATCATGGG - Intergenic
1034068430 7:148159087-148159109 CTGTGAGATAAAAACATGAGAGG - Intronic
1035503520 8:108072-108094 CTGTGGGAAACCTGCATGATGGG + Intergenic
1036227630 8:6973069-6973091 ATGTGGTACATATACATGATGGG + Intergenic
1036230084 8:6992228-6992250 ATGTGGTACATATACATGATGGG + Intergenic
1036232536 8:7011331-7011353 ATGTGGTACATATACATGATGGG + Intronic
1037074707 8:14700239-14700261 ATGTGGTGTATATACATCATAGG + Intronic
1037966959 8:23142380-23142402 ATGTGGCATATATACACCATAGG + Intronic
1041336161 8:56786708-56786730 CTGTGGGATATATTAATAGTTGG - Intergenic
1041883637 8:62782554-62782576 ATGTGGCACATATACATAATGGG + Intronic
1043342470 8:79256768-79256790 ATGTGGTATACATACATGATGGG - Intergenic
1044032061 8:87250605-87250627 ATGTGGTATATGTACATAATGGG + Intronic
1046781346 8:118218726-118218748 ATGTGGTATATATACACAATGGG - Intronic
1047939032 8:129809775-129809797 ATGTGGTACATATACATCATGGG - Intergenic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1055562782 9:77537439-77537461 GTGTGGTATATATACATAGTGGG - Intronic
1057610701 9:96540866-96540888 CTGTGGGATATGGAGCTGATTGG - Intronic
1058392784 9:104515390-104515412 ATGTGGTACATATACATTATGGG + Intergenic
1059054023 9:110959778-110959800 ATGTGGTATATATACACAATGGG + Intronic
1059463295 9:114449060-114449082 CTGTGGGATAGAAACATGAAGGG - Intronic
1059876260 9:118638528-118638550 ATATGGTATATATACATCATGGG - Intergenic
1061185921 9:129053242-129053264 CTGTGGCATATCTACATGCCAGG + Intronic
1203604796 Un_KI270748v1:49334-49356 CTGTGGGAAACCTGCATGATGGG - Intergenic
1186920916 X:14279265-14279287 ATGTGGTATATATACACAATTGG + Intergenic
1189422508 X:40868749-40868771 ATGTTGTATATATACATGATGGG - Intergenic
1189566933 X:42251667-42251689 CTGTTGAATAAATGCATGATTGG + Intergenic
1189971540 X:46422704-46422726 CAATAGGATAGATACATGATAGG + Intergenic
1190533001 X:51399070-51399092 CTGTTGGATATATACTTGTGTGG + Intergenic
1190957932 X:55214708-55214730 TTGTGGTACATATACATAATGGG - Intronic
1190993034 X:55572292-55572314 ATGTGGTACATATACATGATGGG + Intergenic
1191023094 X:55884071-55884093 ATGTGGTTCATATACATGATGGG + Intergenic
1192614989 X:72610478-72610500 ATGTGGTATATATACACAATTGG - Intronic
1193187621 X:78531699-78531721 CTATGTGATATATAAATAATTGG - Intergenic
1193436465 X:81479608-81479630 CACTGGGATAGAAACATGATAGG + Intergenic
1193773405 X:85614975-85614997 TTGTGGCATATATACACCATGGG - Intergenic
1193913414 X:87334161-87334183 ATGTGGCATATATACACAATGGG - Intergenic
1194124678 X:90001272-90001294 ATATGGTATATATACATAATGGG + Intergenic
1194805332 X:98319890-98319912 ATTTGGTACATATACATGATGGG - Intergenic
1195075250 X:101321238-101321260 ATGTGGTATATATACACAATGGG + Intergenic
1195728589 X:107942179-107942201 ATGTGATACATATACATGATGGG + Intergenic
1196969463 X:121093004-121093026 CTGTGGAAAATAGACAAGATGGG + Intergenic
1197261113 X:124319259-124319281 ATGTGGTATATATACACTATGGG + Intronic
1198564738 X:137892955-137892977 CTGTGGTACATTTAGATGATAGG + Intergenic
1198573882 X:137988853-137988875 TTGTGGGAAATATATTTGATAGG + Intergenic
1198609446 X:138381704-138381726 ATGTGGTACATATACATCATGGG - Intergenic
1200477572 Y:3658883-3658905 ATATGGTATATATACATAATGGG + Intergenic
1201251448 Y:12062548-12062570 ATGTGGCACATATACATCATGGG + Intergenic
1201348455 Y:13011213-13011235 ATGTGGTATATATACATGATTGG - Intergenic