ID: 936722325

View in Genome Browser
Species Human (GRCh38)
Location 2:115267694-115267716
Sequence TAGGAGAAGAATAAGCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936722325 Original CRISPR TAGGAGAAGAATAAGCATGT GGG (reversed) Intronic
902809728 1:18881261-18881283 CAGGAGAAGAATATATATGTTGG - Intronic
905728337 1:40274986-40275008 TAGGAGAAGAGTAGGTTTGTGGG + Intronic
906305759 1:44718033-44718055 TAGCAAAAGATTAAGCATTTAGG + Intronic
906357355 1:45118256-45118278 GAGGAGAAAAATAATCATCTTGG - Intronic
907342069 1:53742296-53742318 TAGGAGAAGGATGAGGATGGAGG - Intergenic
907713071 1:56902454-56902476 TCAGAGAAGAACAAGCATGAGGG - Intronic
907904976 1:58776314-58776336 CAGGTGAAGAATCAGCATGAAGG - Intergenic
908345942 1:63233321-63233343 TAGCAGAACACTAAGCATGTGGG - Intergenic
908596018 1:65689724-65689746 TAGGGGAAGAAAAAGCTTATTGG - Intergenic
909589360 1:77328753-77328775 TAGTAGAACAATATGCATTTGGG + Intronic
911000611 1:93161507-93161529 TAGTGGAACACTAAGCATGTAGG + Intronic
912940675 1:114042007-114042029 GAGGATAAGAATAAGCCAGTTGG - Intergenic
913031762 1:114913272-114913294 TAGCAGAAAAATATGCATATTGG + Intronic
913373944 1:118130732-118130754 TAAGAGATGAATAACCATGTTGG - Intronic
914965097 1:152249583-152249605 TAAGAGAAGAAAAGGCATCTAGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917784792 1:178442912-178442934 AAGGACAAGAATAATTATGTAGG + Exonic
919167588 1:193915470-193915492 TTGGAGAACAGAAAGCATGTGGG - Intergenic
919704128 1:200660148-200660170 AAGGAAAATAGTAAGCATGTGGG - Intronic
920743453 1:208603060-208603082 TATGGGAAGGAGAAGCATGTTGG - Intergenic
921680593 1:218026560-218026582 TAGGGGAAGAGTAAGCAGGGTGG - Intergenic
923510447 1:234647678-234647700 TAAGAGAAGAGTAATCATTTAGG + Intergenic
1068481953 10:57601296-57601318 GAAGAGAAGAATAAGCAGATGGG - Intergenic
1068663975 10:59653117-59653139 TTGGATAAGAATAAGCAGGCAGG + Intronic
1069024718 10:63527267-63527289 TGGGAGAAGTAATAGCATGTTGG - Intronic
1070362264 10:75702047-75702069 TAGGTGAAGATTGAGGATGTGGG - Intronic
1070572130 10:77648144-77648166 TAGGCAGAGAAAAAGCATGTAGG + Intergenic
1072204234 10:93188265-93188287 GAAGAGAAGAGTAAGCATTTCGG - Intergenic
1074661229 10:115660073-115660095 TAAGAGGAGAATAAGAATGGAGG + Intronic
1075350207 10:121717627-121717649 AAGGAAAAGAATAATTATGTTGG + Intergenic
1077458523 11:2695771-2695793 TAGGAGAAGCATTAGAAAGTAGG - Intronic
1078140059 11:8685759-8685781 GAGGAGAAGATTAAGAGTGTTGG + Exonic
1078353794 11:10618176-10618198 CAGCAGAAGCAAAAGCATGTAGG - Intronic
1080478060 11:32616685-32616707 TAGGGGAAGAAAAAGCATGTTGG - Intronic
1080892550 11:36422068-36422090 TATGCAAAGAATAATCATGTAGG + Intronic
1081311852 11:41583944-41583966 TATGGGAACACTAAGCATGTGGG - Intergenic
1081560731 11:44213775-44213797 TAGAAGAAGAGAAAGAATGTGGG + Intronic
1085163029 11:74366598-74366620 AAGGATAAAAATAAGCAAGTTGG + Intronic
1085440624 11:76559360-76559382 TAGAAGAGGAAGAAGCAGGTAGG + Intergenic
1087920257 11:103858853-103858875 TAGGAGATGAATTAGCATCAAGG - Intergenic
1087955604 11:104283284-104283306 AAGCAGAAGAATAAACATGGAGG - Intergenic
1088539621 11:110900096-110900118 AAGGAGTAGAATGAGGATGTTGG + Intergenic
1089384254 11:118057639-118057661 TGGGAGAAGAACAAGGATGAAGG + Intergenic
1091001356 11:131912416-131912438 GAGGAGAAGAAGAAGAATCTTGG + Intronic
1092068488 12:5612985-5613007 TAGGGGAAGAGAAAGCATGCAGG + Intronic
1093778684 12:23108353-23108375 TAGGAGAAAAGTAATCATTTAGG - Intergenic
1097957519 12:65501307-65501329 TACAAGAAGAATGAGCATATGGG - Intergenic
1099207061 12:79740955-79740977 TAAGGCAATAATAAGCATGTAGG + Intergenic
1103151892 12:118648094-118648116 TGGGAGAAGTATCAGGATGTGGG + Intergenic
1103875844 12:124126487-124126509 TAGGAGAAGAAGGAAGATGTGGG + Intronic
1105398857 13:20070045-20070067 TAAGCAAAGAATAAGCAAGTGGG - Intronic
1106582558 13:31030782-31030804 TAGGAGCCAAATAAGCATGGTGG + Intergenic
1107495976 13:40926266-40926288 AAGGTGAAGAATAACCATGCTGG + Intergenic
1107847953 13:44538098-44538120 TAGTATTAGAATAAGCCTGTAGG - Intronic
1109236693 13:59830376-59830398 TAGGAGAAAAATAAGCATGAAGG - Intronic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1110463271 13:75770927-75770949 TGGGAGAAGCACAAGCATGCAGG - Intronic
1111534188 13:89580285-89580307 TAACAGAAGAATATTCATGTTGG + Intergenic
1111719457 13:91923424-91923446 TATGAGAGGAATATGCTTGTAGG + Intronic
1113161154 13:107382626-107382648 CAGGAGAAGAAAAAACATGTGGG - Intronic
1115414987 14:33122042-33122064 TAGAAGAAAAATGAGCACGTTGG + Intronic
1115463219 14:33684981-33685003 TAGTAGAAGAATTAGCTTGAGGG + Intronic
1115982661 14:39071143-39071165 AAGGAAAAGAAAAAGCATGCAGG + Intronic
1116216716 14:42025756-42025778 TGGGAGAACACTAAGGATGTGGG - Intergenic
1117297229 14:54391494-54391516 TAGGATGGGAATAAGCCTGTGGG + Intergenic
1119433810 14:74585208-74585230 GGGGAGAAGAAGGAGCATGTGGG - Intronic
1120377208 14:83725490-83725512 TAGGAGGAGAATATGAATTTGGG - Intergenic
1123927598 15:25133621-25133643 AAGGAGATAAATAACCATGTTGG + Intergenic
1126653070 15:50945961-50945983 TCAGAGAAGAAGAAACATGTAGG + Intronic
1126807784 15:52369678-52369700 TATTAGAACACTAAGCATGTGGG + Intronic
1127123595 15:55791622-55791644 TAGGAGGTGACTAAGCATGAGGG - Intergenic
1127566124 15:60190152-60190174 TAGGAAAAAGAGAAGCATGTTGG + Intergenic
1129592053 15:76924780-76924802 TTGAAGAAGAAAAAGAATGTGGG - Intergenic
1130286335 15:82558036-82558058 TAGGAGAAGAAAGAGGCTGTTGG - Intronic
1133460685 16:5983986-5984008 AAGGAGAAGAAGAAGAATGTGGG - Intergenic
1133514870 16:6498805-6498827 CAGGAGAAGAACTAGCAGGTGGG - Intronic
1137823359 16:51466442-51466464 TAGGAGGAGAATATACATCTGGG - Intergenic
1138909184 16:61375936-61375958 AATGAAAAGAACAAGCATGTTGG - Intergenic
1139388293 16:66588578-66588600 TATGAGAAAAATAAGTTTGTTGG + Intergenic
1140261588 16:73385079-73385101 AAGGAAAAGAACAAGCATGGAGG + Intergenic
1140706545 16:77635810-77635832 TAGGTGAACAATAAAGATGTGGG - Intergenic
1141151003 16:81564743-81564765 TAGGGGAAGAGTCAGCAAGTCGG + Intronic
1149166156 17:53755307-53755329 TGAGAGAAGAATAGGCATGGTGG + Intergenic
1150251432 17:63706988-63707010 TATGAGAAGAGTGAGCATTTTGG - Intronic
1150456528 17:65310900-65310922 TAGGAGAAGCAAAATCCTGTTGG + Intergenic
1152839229 17:82556143-82556165 TAGATGAAGAAAAAGCAAGTTGG + Intronic
1155870930 18:31027111-31027133 TATGAGAAGAATAGACATATAGG + Intronic
1155874949 18:31074585-31074607 TAGGAGAAAATTCACCATGTGGG - Intronic
1157754444 18:50205582-50205604 TTGGGGAAGAACATGCATGTGGG - Intergenic
1159105773 18:64000947-64000969 TAGCAGAGGAATAAAAATGTAGG + Intronic
1159873321 18:73783207-73783229 TAGGAGAAGAAAAAGGTAGTAGG - Intergenic
1160308456 18:77764638-77764660 TACTAGAAAAATAAGAATGTAGG - Intergenic
1168572177 19:57480438-57480460 TGGGAGAATCAGAAGCATGTTGG + Intergenic
926397725 2:12461620-12461642 AAAGAGAAAAATAAACATGTGGG + Intergenic
928644869 2:33341289-33341311 TTGGAGAAGGATGAGCAGGTGGG + Intronic
928789151 2:34930299-34930321 GGGGAGAAAAATAAGCATGTAGG + Intergenic
930240589 2:48931985-48932007 TAGGAGGAGCATAGACATGTGGG + Intergenic
930413837 2:51063856-51063878 TAGCAGATGAATAAGAATGAAGG + Intergenic
931074083 2:58689570-58689592 TTGGAGGAGAATAAGCATTCTGG - Intergenic
932445587 2:71779129-71779151 AAGGGGAAGAATAGGCAAGTGGG - Intergenic
933448872 2:82419960-82419982 AAGAAGAAGAATAAGAATCTAGG - Intergenic
935809169 2:106779908-106779930 AAGGAGAAGAAAAAGAATGCTGG + Intergenic
936722325 2:115267694-115267716 TAGGAGAAGAATAAGCATGTGGG - Intronic
937603305 2:123767010-123767032 TAGGTGAAGAAACGGCATGTAGG - Intergenic
939034758 2:137117568-137117590 TAGGGGAAGATTAACCTTGTGGG - Intronic
939768100 2:146279136-146279158 CAAGAGAAGAATAGGGATGTGGG - Intergenic
939967031 2:148620282-148620304 CAGGAGAAGAAAAACAATGTGGG - Intergenic
941898901 2:170658887-170658909 TTGGAGAAGAAAAACAATGTTGG - Intergenic
945705959 2:213232044-213232066 GAGTAGAAAAATAAGAATGTGGG + Intergenic
945947040 2:216004291-216004313 TAGGAGATAAATAAGTGTGTAGG - Intronic
946721690 2:222615565-222615587 TAGGAGCAGAGTAAGCATGGAGG - Intronic
947348395 2:229217838-229217860 GAGGAGAAGATTAAGCAAGAAGG - Intronic
1168981019 20:2003617-2003639 TAGGAGAAGAAAAAGCAGTGAGG - Intergenic
1170342122 20:15340789-15340811 AAGGAGAATAGTAAGCATGGAGG - Intronic
1170462008 20:16586352-16586374 GAGGAGTTGAATAAGGATGTGGG - Intergenic
1177332762 21:19683462-19683484 TAGGAGAAGAAGAGGCATTCTGG + Intergenic
1178201058 21:30405756-30405778 GAGGAGAAGAATAAGAAAGAGGG - Intronic
1179604208 21:42502526-42502548 TAGGTGAAGAATAAACATTTGGG - Intronic
1182024333 22:27105944-27105966 AGGGAGAAACATAAGCATGTAGG - Intergenic
1182925499 22:34119903-34119925 CAGGAGAAGAGAAAGCATGATGG - Intergenic
949855542 3:8457902-8457924 GAGGAAAGGAATAAGCAAGTTGG + Intergenic
951062787 3:18229383-18229405 TGGGAGAAGAAAACTCATGTTGG + Intronic
951088227 3:18539837-18539859 TGTGAGAAGAATAAGAATTTGGG + Intergenic
951168907 3:19515866-19515888 TCGGAAAGGTATAAGCATGTTGG + Intronic
952936805 3:38405044-38405066 TAAAAGAAGAGTAAGAATGTGGG + Intronic
953363820 3:42324846-42324868 CTGGAGAAGCATAAGCAAGTGGG - Intergenic
953591723 3:44263022-44263044 TTGGAGAAGCATCATCATGTAGG + Intronic
954754067 3:52829556-52829578 TTGGAGAAGAACAAGCATGCAGG + Intronic
954820804 3:53325694-53325716 TAAGACAAGAATAAGCATGGAGG + Intronic
955121481 3:56064080-56064102 TAGGAAAAGATTGAGGATGTAGG - Intronic
955864293 3:63366254-63366276 TAGGAGAAAAATAAACCTATAGG - Intronic
955924667 3:63993514-63993536 TAGGTGGAAAACAAGCATGTAGG - Intronic
956283640 3:67585616-67585638 TGGGAGAAGCATCAGCATGATGG - Intronic
957224923 3:77430961-77430983 TGGGAAAAGAATAAGCAGATTGG - Intronic
957731640 3:84146353-84146375 TATGAGAAAAATATGGATGTTGG + Intergenic
957808139 3:85179034-85179056 TAGGAAAATTATAATCATGTTGG - Intronic
958258247 3:91349515-91349537 CAGAAGGAGAATGAGCATGTGGG + Intergenic
958896281 3:99833109-99833131 TTGGAGGAGATTAAGCAAGTTGG + Intronic
959247251 3:103887858-103887880 TAGAAGAAGAATAGTCATATTGG - Intergenic
960322640 3:116255288-116255310 TAAGAGAAGGAAAAGAATGTTGG + Intronic
961613388 3:128159419-128159441 GAGGAGGAGAATAAGCAGGCAGG - Intronic
961843790 3:129742648-129742670 TAGGAGTAGATTAATCATTTAGG - Intronic
961961173 3:130856875-130856897 TATTGGAACAATAAGCATGTGGG + Intronic
963391027 3:144664552-144664574 GAAGAGAAGAAAAACCATGTTGG - Intergenic
964361955 3:155907916-155907938 TTGGAGCAGAGTAAGCATGGTGG + Intronic
965261105 3:166487177-166487199 GAGAAGAAAAATAAGCATGATGG - Intergenic
965901600 3:173647148-173647170 TATTAGAAGCATAAGCATTTAGG - Intronic
967196201 3:187027918-187027940 TAGGTGAAGAATATGCATCAAGG + Intronic
970826182 4:20278880-20278902 CAGAAGAAGAATAAGTATTTAGG + Intronic
970882997 4:20953863-20953885 TAGGAGAAGAAGAAGAATCAGGG - Intronic
971156019 4:24083735-24083757 TAGTAGCAGAAGAAGCATGTGGG - Intergenic
971221499 4:24711781-24711803 GAGGAGAAGAAAAAGATTGTGGG - Intergenic
971436849 4:26635864-26635886 TTAGACAAGAATAAGAATGTTGG + Intronic
971688877 4:29806936-29806958 TGTGAGTAGAATTAGCATGTGGG + Intergenic
971743310 4:30547480-30547502 AAGGAGAAGAATAATTATGAAGG + Intergenic
972086715 4:35226476-35226498 AAGGAGAAGGAGGAGCATGTGGG + Intergenic
972357487 4:38294139-38294161 TAGGAATAAAATAACCATGTAGG - Intergenic
972802013 4:42486346-42486368 TTGGACCAGTATAAGCATGTCGG + Intronic
975073697 4:70178091-70178113 TGAGAGAAGAATAACCATATTGG + Intergenic
975412601 4:74071269-74071291 TAAGAAAAGAATAAGCATAAAGG + Intergenic
976430603 4:84959648-84959670 TAGGAGAAGAAAATACATTTTGG + Intronic
978156072 4:105490408-105490430 TAGGAAATGAATAACCATCTTGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978644251 4:110910110-110910132 TCAGAGAACAATGAGCATGTTGG + Intergenic
979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG + Intergenic
980459949 4:133096655-133096677 TAAGAGGAGAATCAGGATGTTGG + Intergenic
980758568 4:137198364-137198386 TAAGGGAAAAATAAGCAAGTGGG - Intergenic
980978410 4:139633226-139633248 TAGGAGAAAGAAAACCATGTTGG - Intergenic
982656772 4:158159930-158159952 TAGGTGAATGCTAAGCATGTTGG + Intronic
982746173 4:159105042-159105064 TAAGAGAAGAGTAAGCCTGCAGG - Intronic
983209782 4:164946607-164946629 TTGGAGTAGAAAAAGAATGTGGG + Intergenic
983601924 4:169540449-169540471 TTAGAGAGGACTAAGCATGTGGG - Intronic
984279689 4:177654642-177654664 TAGGAGAAGTAAATTCATGTAGG + Intergenic
985295354 4:188431951-188431973 TAGGGGAAGTGTAAGGATGTGGG + Intergenic
987291677 5:16514241-16514263 TAGGTTAAAAATAAGAATGTGGG - Intronic
988315783 5:29625674-29625696 TAGGAGTAGTAGAAACATGTTGG + Intergenic
989023827 5:37042682-37042704 AAGGAGAAGCACCAGCATGTCGG - Intronic
989279023 5:39620822-39620844 GTGGAGAAGAAAAAGGATGTAGG - Intergenic
990169920 5:53036641-53036663 TGGGAGAAAAATAAGCAGGCTGG - Intronic
990940615 5:61199875-61199897 TTGGAGAAGAATAAGCACTCTGG + Intergenic
993608220 5:90020916-90020938 TGAAAGAAGAATAAGCATTTTGG + Intergenic
994552211 5:101250423-101250445 TTGCAGAAGAATAAACATATGGG + Intergenic
995144056 5:108766673-108766695 AAGGAGAGGAATAATCTTGTTGG + Intronic
995267100 5:110175050-110175072 AAGGGGAAGAATAATCATGCAGG + Intergenic
996767475 5:127048914-127048936 TAGGAGAAGAATCAGCAACCTGG + Intronic
996796486 5:127353654-127353676 CAGGAGAAGACAAGGCATGTGGG - Intronic
997619684 5:135278228-135278250 TAAGAGAAAAATAAGAATATGGG - Intronic
999172142 5:149604533-149604555 GAGGAGAAGAAAAGCCATGTGGG - Intronic
999914873 5:156247447-156247469 TAGTAGAACAAGAAGAATGTAGG + Intronic
1001039912 5:168326873-168326895 TAGAACAAAAATAAGCATGTGGG + Intronic
1002761221 6:203887-203909 TGGGAGAGGAAAAAGCATGCCGG - Intergenic
1004122534 6:12838499-12838521 TAGGAGAAGAAAATTCATGCTGG + Intronic
1004252806 6:14035655-14035677 AAGGGGAAGAAGGAGCATGTCGG - Intergenic
1005686943 6:28262294-28262316 TAGAAGAAGAATAAGGTAGTTGG + Intergenic
1008091957 6:47303042-47303064 GAGGGGAGGAATAAGCAAGTGGG - Intronic
1008149658 6:47935336-47935358 TAGGGGAAAAATTAGTATGTTGG + Intronic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1008997010 6:57671194-57671216 CAGAAGGAGAATGAGCATGTAGG - Intergenic
1009185526 6:60570523-60570545 CAGAAGGAGAATGAGCATGTGGG - Intergenic
1011110368 6:83831140-83831162 TAGGAGAAGACCAAGAATCTTGG - Intergenic
1012839112 6:104307019-104307041 TATTAGAACACTAAGCATGTGGG + Intergenic
1012910134 6:105108918-105108940 AAGGGGAAGAATAAGAAAGTAGG + Intronic
1013838593 6:114362386-114362408 TTAGAGAAGAAGAAGCAGGTAGG + Intergenic
1014015562 6:116526316-116526338 TAGGAGAAGAATTTGGATGGAGG + Intronic
1014099251 6:117491755-117491777 CAGGAAAAGAAAAAGTATGTGGG - Intronic
1017329714 6:153182170-153182192 TCGGAGAAGAATGAGCATAAGGG + Intergenic
1017337762 6:153282312-153282334 GAGGAGAAGATTAAGAGTGTTGG - Intergenic
1022738951 7:33103022-33103044 AAGGAGATAGATAAGCATGTTGG - Intronic
1023088596 7:36597053-36597075 TAGGATAAGAATAAGGATGGAGG - Intronic
1024881622 7:54092189-54092211 TAAGAGAATTATGAGCATGTGGG + Intergenic
1026140289 7:67699821-67699843 GAGGAGAGGAAGAAGTATGTGGG - Intergenic
1026494008 7:70887548-70887570 TAGGAGATGATTCAGCATGAGGG - Intergenic
1028414950 7:90569749-90569771 TAGGAGAAAAGGAAACATGTAGG + Intronic
1028593341 7:92521885-92521907 TAGTAGAATAAGAAGCAAGTAGG + Intronic
1030612511 7:111705279-111705301 TTGGAGGAGAAAAAGCATTTTGG + Intergenic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031082671 7:117273694-117273716 TAGAAAAATAATAATCATGTTGG + Intergenic
1031747256 7:125516063-125516085 TAGGAAAAGCTTAACCATGTTGG - Intergenic
1033200947 7:139369598-139369620 TAGTAGAAGAAAAACCTTGTAGG - Intronic
1033407525 7:141084716-141084738 TAGGAGAAGGACAGGCATCTGGG - Intronic
1033940714 7:146649764-146649786 TAGGAAGAGAAAAAGCCTGTTGG - Intronic
1034745274 7:153518447-153518469 TGGGTGCAGGATAAGCATGTGGG + Intergenic
1034917576 7:155053557-155053579 AAGAAGAAGAAGTAGCATGTTGG - Intergenic
1036004936 8:4651604-4651626 TATGAGAATATTAACCATGTGGG - Intronic
1038115264 8:24546700-24546722 TAGGAGAAAAATAATAATGAGGG + Intergenic
1038140058 8:24834780-24834802 AAAGAGAAGAATAGACATGTTGG + Intergenic
1038773738 8:30509203-30509225 AAGGAGAAGAATATGAAAGTAGG - Intronic
1038987516 8:32828477-32828499 TATTAGAACAGTAAGCATGTGGG - Intergenic
1039294400 8:36133534-36133556 TAGGAAAAGAAGAAGCATGAAGG - Intergenic
1042118538 8:65458878-65458900 TAGGAATAGAGTGAGCATGTGGG - Intergenic
1043005922 8:74818528-74818550 CTGAAGAAGAATAAGCATGAAGG - Intronic
1043802196 8:84623676-84623698 TAGGAGCAGGAAAATCATGTGGG + Intronic
1044352136 8:91178906-91178928 CAGGAGAAGAAAAAGCATTCAGG - Intronic
1046307528 8:112389385-112389407 TAGTAGAATAATAAGGATTTTGG - Intronic
1046448372 8:114356180-114356202 TAGGATAATAAAAAGCAAGTAGG + Intergenic
1046669835 8:117045182-117045204 TAGGAGAAGAATAAGGCTAATGG - Intronic
1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG + Intergenic
1048081403 8:131132034-131132056 TAGGATAAGAATAAGCAAGGTGG - Intergenic
1048383101 8:133885636-133885658 TATTAGAAGAATAAGAAAGTCGG + Intergenic
1050259109 9:3822375-3822397 TAGCAGAAGAATAAGCAGAGGGG + Intergenic
1052145929 9:25049447-25049469 TAGGTGAAGAACATGGATGTAGG + Intergenic
1057414055 9:94845752-94845774 CAGGGGAAGAATAAGGTTGTAGG + Intronic
1057790776 9:98123462-98123484 TAGGGGAAGACTAAGCAGGAAGG - Exonic
1058573803 9:106378448-106378470 TAGAAGAGAAATAAGCATTTTGG - Intergenic
1058682425 9:107451817-107451839 TAAGACAAGATTGAGCATGTAGG - Intergenic
1060394135 9:123303776-123303798 TTGGGGAAGAATAAGAAGGTTGG - Intergenic
1060994084 9:127866409-127866431 TAGCAGAAGACAAGGCATGTAGG - Intergenic
1186018981 X:5233000-5233022 TATTAGAACACTAAGCATGTGGG + Intergenic
1187480634 X:19651949-19651971 TAAGAGAATAATGAGCATTTAGG - Intronic
1188526900 X:31097140-31097162 CTGGGGAAGAATAAGCATCTTGG - Intergenic
1189337798 X:40181175-40181197 TATGAGAACATTAAGCATGTGGG + Intergenic
1191800751 X:65076481-65076503 TAGGAGATGAGAAAGAATGTGGG - Intergenic
1192635320 X:72810227-72810249 TTGGAAAAGAACAAGCATGAAGG - Intronic
1192646394 X:72910576-72910598 TTGGAAAAGAACAAGCATGAAGG + Intronic
1192820974 X:74644882-74644904 TAGCGTAAGAATAAGCATGTAGG - Intergenic
1193457652 X:81750644-81750666 TATTGGAACAATAAGCATGTGGG - Intergenic
1193801290 X:85939689-85939711 TAGAAAAAGAATAAGAATATGGG - Intronic
1197267342 X:124389136-124389158 TAGGAGAAAAATAATTATTTGGG - Intronic
1198825918 X:140697798-140697820 GAGGGGATGAATAAGCCTGTAGG + Intergenic
1199112320 X:143949488-143949510 AAGGAGAAGAATAAGCAAAAGGG + Intergenic