ID: 936722981

View in Genome Browser
Species Human (GRCh38)
Location 2:115276006-115276028
Sequence TAGCATATTTCAACTCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936722972_936722981 25 Left 936722972 2:115275958-115275980 CCCAAAGTGCTGGGATTACGGGC 0: 1655
1: 220799
2: 273755
3: 186508
4: 142945
Right 936722981 2:115276006-115276028 TAGCATATTTCAACTCTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 134
936722969_936722981 28 Left 936722969 2:115275955-115275977 CCTCCCAAAGTGCTGGGATTACG 0: 2604
1: 296063
2: 268467
3: 154459
4: 133890
Right 936722981 2:115276006-115276028 TAGCATATTTCAACTCTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 134
936722976_936722981 -6 Left 936722976 2:115275989-115276011 CCGCGCCCGGCCTATTCTAGCAT 0: 1
1: 2
2: 28
3: 227
4: 1925
Right 936722981 2:115276006-115276028 TAGCATATTTCAACTCTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 134
936722975_936722981 -3 Left 936722975 2:115275986-115276008 CCACCGCGCCCGGCCTATTCTAG 0: 2
1: 34
2: 309
3: 2405
4: 11392
Right 936722981 2:115276006-115276028 TAGCATATTTCAACTCTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 134
936722973_936722981 24 Left 936722973 2:115275959-115275981 CCAAAGTGCTGGGATTACGGGCG 0: 845
1: 125027
2: 272616
3: 224826
4: 154182
Right 936722981 2:115276006-115276028 TAGCATATTTCAACTCTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936722981 Original CRISPR TAGCATATTTCAACTCTTGG TGG Intronic
904299203 1:29543242-29543264 CAGCCTTATTCAACTCTTGGGGG - Intergenic
909346359 1:74592088-74592110 TAGCATCTCTCAAATCTTTGTGG - Intronic
910216115 1:84846888-84846910 TAGCACATTAAAACTCTTGTAGG - Intronic
910384799 1:86670142-86670164 TATCTTGTTTCAGCTCTTGGAGG - Intergenic
911507874 1:98775908-98775930 TAGGATATTTCAACTTATGATGG - Intergenic
916300573 1:163269149-163269171 TAGTATATTACAACTGTTTGTGG + Intronic
919501926 1:198348023-198348045 AAAAATATTTGAACTCTTGGGGG - Intergenic
920256041 1:204655163-204655185 TACCTCATTTCCACTCTTGGAGG - Intronic
920521759 1:206632853-206632875 GGGCATTTTTCAAATCTTGGTGG + Intergenic
920878685 1:209860437-209860459 TAGCAAATTCCAACTCTTAGGGG + Intergenic
922225131 1:223639354-223639376 TATGTGATTTCAACTCTTGGAGG - Intronic
923327406 1:232892854-232892876 TATTATCTTTCAACTCTTGAGGG - Intergenic
1064680516 10:17806907-17806929 TAGCATATTTCAACTCACATTGG + Intergenic
1065063095 10:21928844-21928866 TAGCATCTCTAAATTCTTGGAGG - Intronic
1066935170 10:41820835-41820857 AAGAAAATTTCAACTCTTTGAGG + Intergenic
1068759003 10:60686935-60686957 TAGCATATTTATAATCTTGTGGG - Intronic
1072309772 10:94143246-94143268 TAGCATCTTTCTACTCTGGAGGG - Intronic
1078744805 11:14101813-14101835 TTGCTTATTTCAACTGTTGTGGG + Intronic
1079570961 11:21942818-21942840 TACCATTTTTGAAGTCTTGGTGG + Intergenic
1080849711 11:36057553-36057575 TAGCGTATTTCAACATTTGCTGG - Intronic
1082589354 11:54986853-54986875 AAGCATATTTTAACTCTGAGAGG - Intergenic
1085783416 11:79430018-79430040 TCCCAAATTTCACCTCTTGGTGG - Intronic
1091223168 11:133942812-133942834 AAGCATATTTGAAATCTTGGGGG - Intronic
1091483423 12:858485-858507 CAGCCTGTTTCAACTCTTGTTGG + Intronic
1094617412 12:32048416-32048438 CAGTTTATTTCAAATCTTGGTGG - Intergenic
1096309723 12:50510047-50510069 TGGCAGATTTCAATTCTTTGAGG + Intronic
1097589007 12:61550452-61550474 TAGCAATTTTCAACATTTGGAGG - Intergenic
1098571722 12:71995383-71995405 TCGCATTTTTCATCCCTTGGTGG - Intronic
1098824543 12:75278306-75278328 TAGAATATTTCAAATGATGGAGG - Intronic
1099567009 12:84264329-84264351 AACCATATTTCCATTCTTGGAGG - Intergenic
1103599130 12:122043259-122043281 TAACATATTTAAAATCCTGGGGG - Intronic
1106903404 13:34379199-34379221 TAGGATATTGCAACTTTTAGAGG - Intergenic
1107544001 13:41420145-41420167 TAACATATGTTAATTCTTGGTGG + Intergenic
1114883442 14:26815740-26815762 TAGCATATTTGAATTCTTTGAGG - Intergenic
1115470285 14:33761528-33761550 TAGCACATTTGAACTCAAGGGGG + Intronic
1121476204 14:94206934-94206956 TTGCCTATTCCAACTTTTGGTGG + Intronic
1123894434 15:24814378-24814400 TAGCAAATTTTATCTCTTGATGG - Intergenic
1126561312 15:50047575-50047597 TAGGAAATTTCAACTCTGTGTGG + Intronic
1127241441 15:57119677-57119699 TAGAATATTTTAACTCTTAAAGG + Intronic
1131907132 15:97155028-97155050 TAGCATATTCCACCCTTTGGAGG + Intergenic
1147321477 17:39648754-39648776 TGGCATATTTCAACTCTCCCGGG + Intronic
1147490584 17:40862372-40862394 TACCATATTAAAACTTTTGGGGG - Intronic
1148941730 17:51219973-51219995 TAGAATCTTTCAACATTTGGGGG - Intronic
1149397510 17:56260114-56260136 TACCAAATTTAAACTTTTGGAGG + Intronic
1150158454 17:62873535-62873557 TAGCCTATTCTACCTCTTGGGGG + Intergenic
1156038159 18:32789219-32789241 TTGCATATTTCATCCCTTGTTGG + Intergenic
1157599349 18:48884630-48884652 CAGCAAAGTTCAGCTCTTGGGGG + Intergenic
1164042148 19:21502858-21502880 TAGCAGATTTCAACACAAGGAGG + Intronic
1168574309 19:57496261-57496283 TAGCATATTTAAGTTCTTCGTGG + Intronic
1168575963 19:57509769-57509791 TAGCATATTTAAGTTCTTTGTGG + Intronic
926721939 2:15967376-15967398 TGGCAGATTTCACCTCCTGGTGG - Intergenic
928991019 2:37232888-37232910 TAGAATATTTCATCTTTTGCTGG + Intronic
930274395 2:49294876-49294898 TTGCTTATTTCAGCTCATGGAGG - Intergenic
931905145 2:66834505-66834527 AACCCTATTTCAACCCTTGGAGG + Intergenic
936722981 2:115276006-115276028 TAGCATATTTCAACTCTTGGTGG + Intronic
938647368 2:133345513-133345535 CAGCATATTTCAACTCTACTTGG - Intronic
940949403 2:159655356-159655378 TGGCATATTTAAAGTCCTGGAGG - Intergenic
943994985 2:194751136-194751158 AAGCATTTTTCAACTCTCAGTGG - Intergenic
944215666 2:197252704-197252726 TAAAATATTTGAACACTTGGGGG - Intronic
945156002 2:206838668-206838690 TAGCATTTATTAAATCTTGGTGG - Intergenic
947093429 2:226539692-226539714 AAGCATATTTCTAATCTTGTGGG - Intergenic
948076571 2:235169464-235169486 TATCCTCTTTCATCTCTTGGAGG + Intergenic
948495273 2:238344834-238344856 TGGCATGTTTCATCACTTGGGGG + Intronic
1169912969 20:10662240-10662262 TAGGATGTTTCATCTCCTGGGGG - Intronic
1171480579 20:25453007-25453029 TAGCTTATTAGAACTCTTGGTGG - Exonic
1174396324 20:50248907-50248929 ATGCATATTTCTACTTTTGGGGG - Intergenic
1177325649 21:19584999-19585021 TAGCAATTTTCAACTCTTTTTGG + Intergenic
1177480677 21:21683124-21683146 TAGCAGATTTCTAACCTTGGGGG - Intergenic
1183803635 22:40189832-40189854 TGGCAAATTTCAACTCATGATGG - Intronic
949543959 3:5056008-5056030 TAGGACATTACAAATCTTGGGGG - Intergenic
952721639 3:36539897-36539919 TAACATATTCCAAGTTTTGGAGG - Intronic
952723667 3:36559672-36559694 TAGGATAATACCACTCTTGGGGG - Intergenic
957653219 3:83035703-83035725 AAGCACCTTTCCACTCTTGGGGG - Intergenic
959197153 3:103199149-103199171 GAGCTTATTTCATTTCTTGGAGG + Intergenic
960215048 3:115023547-115023569 TAGCATATTTCAATTCCTTATGG - Intronic
963564414 3:146909895-146909917 TTGCACATTTCAACTCCTGAAGG - Intergenic
966560480 3:181314482-181314504 TATCATATTTGAACTTTTAGGGG - Intergenic
971278908 4:25224933-25224955 TAGAAAATTTAAACTGTTGGAGG + Intronic
971538228 4:27781361-27781383 TTGCATATTTCAAGTTTTGAAGG - Intergenic
971838392 4:31799669-31799691 TAGCATATTTAAAGTATTGAAGG - Intergenic
972209858 4:36823757-36823779 TTGCAAGTTTCACCTCTTGGCGG + Intergenic
973034882 4:45393628-45393650 TAGCAGATTTTGACTCTTGTGGG - Intergenic
973261420 4:48168412-48168434 TAGCTTATTTCAATTTTTTGTGG - Intronic
974171777 4:58276035-58276057 CAGCATATTTCAAAGCCTGGAGG + Intergenic
975387216 4:73771163-73771185 CAGCAGCTTTCAACTCTTGTGGG - Intergenic
977445322 4:97124187-97124209 CTGCATGTTTTAACTCTTGGGGG - Intergenic
978162543 4:105566230-105566252 TAGTATATTTAAAGGCTTGGTGG - Intronic
978808094 4:112821400-112821422 TAGCATATTTATATTCTTTGTGG + Intronic
978880796 4:113700411-113700433 TAGGCTATTTCAACTCCTGCTGG + Intronic
980535810 4:134120633-134120655 TAGCATGTTTAAAATCTTGAAGG - Intergenic
987467576 5:18290709-18290731 TTGCATATTTCTCCTCCTGGAGG + Intergenic
988507289 5:31834464-31834486 TTGCATAGTTCAAATTTTGGGGG - Intronic
989315592 5:40074767-40074789 TAGATTATTTCAACCCCTGGTGG + Intergenic
989832273 5:45934942-45934964 AAGAATATTTTAACTCTAGGAGG - Intergenic
999976902 5:156921104-156921126 TAGCATTTTAAAACTTTTGGGGG + Intronic
1000195738 5:158955790-158955812 TAGCACACTTCTACTCTTTGAGG - Intronic
1001645969 5:173282691-173282713 TAGCAGTTTTTAATTCTTGGTGG - Intergenic
1001947132 5:175788605-175788627 TAGCATGTTTCCACTCCTTGTGG - Intergenic
1004487836 6:16084203-16084225 TGGCATCTTTCAGCTTTTGGTGG + Intergenic
1004863499 6:19831495-19831517 TAACATATTTCATCACTTGTTGG - Intergenic
1008847813 6:55989325-55989347 TGCCATATTTCAAATCTTAGAGG + Intergenic
1009042913 6:58202268-58202290 TAGAATATTTCAATTCTTTGAGG - Intergenic
1009218751 6:60956508-60956530 TAGAATATTTCAATTCTTTGAGG - Intergenic
1010903482 6:81456582-81456604 TAGCATGTTTCATTTGTTGGAGG + Intergenic
1011025006 6:82858806-82858828 TATCATGTCTCAACTCTTTGAGG + Intergenic
1014805820 6:125828173-125828195 TAGGAAATTTCAACATTTGGTGG + Intronic
1015749680 6:136548038-136548060 TGGCAATTTTCAACTCTTGATGG + Intronic
1022728221 7:32999451-32999473 AAGGATAATTAAACTCTTGGTGG + Intronic
1025045431 7:55688569-55688591 AAGGATAATTAAACTCTTGGTGG - Intergenic
1031679265 7:124651149-124651171 TAGGATCTTTCATCTCTTGTGGG - Intergenic
1033709752 7:143930240-143930262 TAATATATTTAAAGTCTTGGAGG - Intergenic
1034250243 7:149684608-149684630 TAGCATTTTTTTACTTTTGGGGG - Intergenic
1035762456 8:2079374-2079396 TAGCACTTCTCAGCTCTTGGTGG - Intronic
1036517782 8:9460706-9460728 TACCATATTTGAAATCTTGTAGG - Intergenic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1037114907 8:15213055-15213077 TACCATATTTTCACTCTTGAGGG + Intronic
1042830234 8:73018807-73018829 ATGCATATTTCAAATTTTGGGGG - Intronic
1044815131 8:96104188-96104210 TAGAATATTTTAAGTCTTGTTGG - Intergenic
1045898816 8:107249945-107249967 TACCATTTTTCTATTCTTGGTGG - Exonic
1046212537 8:111096887-111096909 TAGCATATTTAAACTCGTGATGG + Intergenic
1050228920 9:3495766-3495788 TATCCTATTTCAATTCTTTGAGG - Intronic
1055203460 9:73696366-73696388 TATCATATTTCAACTGTTCTTGG - Intergenic
1060430888 9:123550821-123550843 TAGAAGATTGCAACTTTTGGAGG - Intronic
1062202095 9:135308890-135308912 TAGCATCTGTCAAATCTGGGTGG - Intergenic
1186321533 X:8431846-8431868 TAGCTTATCTCCACTCTTTGTGG + Intergenic
1188530834 X:31139059-31139081 TAGCATATTGCTAGTCTTTGGGG + Intronic
1188988855 X:36792468-36792490 TTGGATATTACACCTCTTGGTGG + Intergenic
1191423550 X:60571160-60571182 AAGGAAATTTCAACTCTGGGAGG - Intergenic
1191537585 X:62097286-62097308 AAGGAAATTTCAACTCTGGGAGG - Intergenic
1191575149 X:62695073-62695095 AAGAATGTTTCAACTCTGGGAGG + Intergenic
1191580321 X:62753971-62753993 AAGCATTTTTCCACCCTTGGTGG + Intergenic
1193206030 X:78748755-78748777 TAGAATATTTCAGAGCTTGGTGG + Intronic
1193751525 X:85351226-85351248 TAGCATATTATAACTCATGGTGG + Intronic
1194111147 X:89836383-89836405 TGGCACATTTCATCTATTGGAGG - Intergenic
1195215981 X:102702958-102702980 TAACATATTTCAAGTGTTGAAGG + Intergenic
1198427746 X:136536608-136536630 TAGGATATTTGAATGCTTGGGGG - Intronic
1198986703 X:142462971-142462993 TAGCTTATTTCAATGCTAGGGGG + Intergenic
1199883020 X:151990764-151990786 TAGAATGTTTCAAATTTTGGGGG + Intergenic
1200463807 Y:3491117-3491139 TGGCACATTTCATCTATTGGAGG - Intergenic
1201748552 Y:17407014-17407036 CAGCATGTTTGAACTCTTTGTGG + Intergenic
1201851736 Y:18490731-18490753 TAACAAATTTCATCTCATGGAGG - Intergenic
1201881584 Y:18829649-18829671 TAACAAATTTCATCTCATGGAGG + Intergenic
1201886677 Y:18891713-18891735 GACCATATTTTAGCTCTTGGTGG - Intergenic