ID: 936723637

View in Genome Browser
Species Human (GRCh38)
Location 2:115285396-115285418
Sequence AAAGACAGAGTATACTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936723632_936723637 7 Left 936723632 2:115285366-115285388 CCGGTAATAATGAACGTAAAATA 0: 1
1: 0
2: 0
3: 26
4: 248
Right 936723637 2:115285396-115285418 AAAGACAGAGTATACTGGGATGG 0: 1
1: 0
2: 2
3: 26
4: 272
936723630_936723637 22 Left 936723630 2:115285351-115285373 CCACATATCCAAAGGCCGGTAAT 0: 1
1: 0
2: 0
3: 1
4: 52
Right 936723637 2:115285396-115285418 AAAGACAGAGTATACTGGGATGG 0: 1
1: 0
2: 2
3: 26
4: 272
936723631_936723637 14 Left 936723631 2:115285359-115285381 CCAAAGGCCGGTAATAATGAACG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 936723637 2:115285396-115285418 AAAGACAGAGTATACTGGGATGG 0: 1
1: 0
2: 2
3: 26
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936723637 Original CRISPR AAAGACAGAGTATACTGGGA TGG Intronic
900897611 1:5494681-5494703 AAGAACAGAGTGTACTGGGCAGG - Intergenic
902571673 1:17351232-17351254 AAAGACAGAGTAGAGCGGAATGG + Intronic
907942636 1:59104326-59104348 AAAGACAAAGGATGGTGGGAGGG - Intergenic
908425172 1:64000339-64000361 AAAGACAGAGTATAAAAGGGAGG - Intronic
908746058 1:67377706-67377728 AAAGAGAGGGGAAACTGGGAAGG - Intronic
909786594 1:79621558-79621580 AAAGAGAGAGAATGCTGGGTAGG + Intergenic
910468177 1:87522956-87522978 AAATACAGAGCTTACTGGGAGGG - Intergenic
910844353 1:91591301-91591323 AGAGACATAGTACAGTGGGATGG + Intergenic
911233418 1:95384281-95384303 ATAGACATAGCATACTGTGAGGG + Intergenic
911486092 1:98506895-98506917 ATAGACACAGTATTCTTGGATGG - Intergenic
912370877 1:109173118-109173140 AAAGACTGGGTATTCTGGGGAGG + Intronic
912631465 1:111249981-111250003 AAAGACAGGGCATCCTGGGGAGG - Intergenic
913374698 1:118138068-118138090 CCAGACAGAGTATATTGGAAAGG - Intronic
916173955 1:162022733-162022755 CATGACGGAGTGTACTGGGAGGG - Intronic
918363635 1:183784104-183784126 AAAGACAGGGCAAACTGGGAGGG + Intronic
918433289 1:184484443-184484465 AAACAAAAAGTATTCTGGGATGG - Intronic
920444621 1:206006512-206006534 GAAGACAGAGTGTACGGGAAGGG + Intergenic
921321507 1:213944666-213944688 ATAGACAGAGAAAAGTGGGAAGG - Intergenic
923185708 1:231571246-231571268 AAAAACAGAGTAAAAAGGGAGGG - Intronic
923496395 1:234529285-234529307 AAAGAGAGATTATCCTGGGTGGG + Intergenic
923919492 1:238547291-238547313 AAAGACACAGCAGACTGAGAAGG + Intergenic
1064890877 10:20171924-20171946 AAAGACACTGGAGACTGGGAAGG + Intronic
1068450631 10:57182344-57182366 AAAGACTGACCATACTGTGATGG - Intergenic
1070808935 10:79287755-79287777 AAACACAGAGTAGAGTGGGGAGG + Intronic
1071891245 10:90010240-90010262 AAAGACAAAGAATATTGGCAAGG - Intergenic
1072451134 10:95540708-95540730 AGAGACAGAGTCTACAGGGAGGG - Intronic
1073592755 10:104772148-104772170 AATGACAGAGGATTCTGGAAAGG - Intronic
1073728917 10:106268141-106268163 AAAGAAAGAGAGAACTGGGAGGG - Intergenic
1074132774 10:110596804-110596826 AAAGAAAGAGGAAACTGAGAAGG + Intronic
1074911310 10:117911876-117911898 AAAGAGAGATTATCCTGGGTGGG - Intergenic
1075306170 10:121369642-121369664 AAAGACAGACTATAGTAGTAAGG + Intergenic
1075525021 10:123176864-123176886 AAACATATAGTTTACTGGGATGG + Intergenic
1075816006 10:125265283-125265305 AAAGAGAGAGAATCCAGGGAGGG + Intergenic
1076153169 10:128180216-128180238 AAAGACAGAGTTAACTTAGAAGG + Intergenic
1077602370 11:3582372-3582394 AGAGACAGGGGAGACTGGGAAGG + Intergenic
1078278598 11:9876313-9876335 AAAGAGAGAGCAAACAGGGAGGG - Intronic
1078412899 11:11142347-11142369 ATAGACTGAGCAGACTGGGAGGG + Intergenic
1080244299 11:30162508-30162530 AAAGACACATTATATTGAGAAGG + Intergenic
1081120822 11:39263257-39263279 AAAGAAACAATATGCTGGGAAGG - Intergenic
1084603358 11:70159415-70159437 AAAGACAGAGGATATTGGATAGG + Intronic
1085518250 11:77123659-77123681 AGAGACAGAGGATCATGGGAGGG - Intronic
1085720036 11:78904379-78904401 AAACATAGAGTTTACTGAGATGG + Intronic
1086986292 11:93252866-93252888 AAAGACAGAAAATGCTGGCAAGG + Intergenic
1087564316 11:99835074-99835096 AAGGACAGAGTCTCCTTGGAGGG - Intronic
1088437331 11:109829689-109829711 AAAGACAGTGTATATTTTGATGG - Intergenic
1089121790 11:116141350-116141372 AGAGAAAGAGAATTCTGGGAGGG + Intergenic
1089367296 11:117928822-117928844 AAAGTCACAGTTTTCTGGGAAGG + Intronic
1089485433 11:118841967-118841989 AAAGTCAGTGTAAACTGGCAAGG - Intergenic
1091356788 11:134943737-134943759 AAAGACAGGGAGCACTGGGAGGG - Intergenic
1093147505 12:15584148-15584170 AAACTCACAGTATACTGGGGAGG - Intronic
1093554805 12:20459082-20459104 AAAGAAACACTATACTGGGAAGG - Intronic
1093602609 12:21047278-21047300 AAAGACAGATTTTATTGTGAAGG + Intronic
1093832512 12:23780847-23780869 TAAGATAGAGTATGCTGGTAGGG + Intronic
1097339250 12:58418929-58418951 AAAGAGCGAGCACACTGGGATGG - Intergenic
1097614792 12:61871126-61871148 CAAGACAGAGCAAACTGAGAAGG + Intronic
1097734739 12:63169349-63169371 AAAGAGAGAGCATATTGGGAAGG + Intergenic
1100494106 12:95108935-95108957 CAAGACAGTTTATACTGGGCTGG - Intronic
1101653737 12:106701276-106701298 AAAGACAGAGAAAACTGTGGAGG - Intronic
1102390370 12:112544618-112544640 AAAGATAGAGGATACAGAGAGGG - Intergenic
1103543977 12:121686539-121686561 AAAGGAATAGTACACTGGGATGG + Intergenic
1104956981 12:132471801-132471823 AAAGAAAAGGTATCCTGGGACGG + Intergenic
1107509102 13:41063655-41063677 AAAGACAGACTACACTGGAAGGG - Intronic
1109568581 13:64153958-64153980 TAAAACAGAGTATACAGGAAGGG - Intergenic
1109706324 13:66097080-66097102 AAAGAAAAAGAAAACTGGGATGG + Intergenic
1109776976 13:67053456-67053478 AAACACAAAGGATACTGGTAGGG + Intronic
1111639380 13:90947723-90947745 AAAGACAGGGACTATTGGGAAGG + Intergenic
1111788780 13:92826232-92826254 AAAGGGAGATTATTCTGGGAGGG + Intronic
1111885939 13:94020633-94020655 GAAGCCAGAGTAGACAGGGAGGG - Intronic
1111955838 13:94757676-94757698 AGAGACAGATCATACTGGGAGGG + Intergenic
1112117174 13:96368996-96369018 AAACACAGAGTACATTGTGATGG - Intronic
1112118689 13:96385499-96385521 AAAGACAGAAGACTCTGGGATGG + Intronic
1114580246 14:23750899-23750921 AGAGACAGATCATATTGGGAGGG - Intergenic
1115170825 14:30504466-30504488 AAAGAAAGAGTATATTTTGAGGG - Intergenic
1117869872 14:60188990-60189012 AAAAACAGAGAATAATGGGATGG - Intergenic
1118651611 14:67901883-67901905 ATAGACAGTGGAGACTGGGAAGG + Intronic
1120540893 14:85749042-85749064 AAAGAGAGATTATTCTGGGTGGG + Intergenic
1121979905 14:98445708-98445730 AAAGACAGGGGATACTGTGGAGG - Intergenic
1122749073 14:103919577-103919599 AAGGGCAAAGTAAACTGGGAGGG + Intronic
1202926896 14_KI270724v1_random:34759-34781 ATAGACAGAGTATCTGGGGAGGG + Intergenic
1123693677 15:22861140-22861162 AAAAACAAATTATACAGGGAAGG - Intronic
1125040449 15:35179701-35179723 AAAGACAGGGGATGCTAGGATGG + Intergenic
1125422721 15:39520826-39520848 AAAAACATAGTAAACAGGGATGG - Intergenic
1125949567 15:43740419-43740441 AAAAACTGAGTATATTAGGAGGG - Intergenic
1131424678 15:92335794-92335816 AAAGAAAGAGTTTATTGTGATGG - Intergenic
1132470834 16:102062-102084 AAAGACAGTGCATGCAGGGAGGG - Intronic
1133668894 16:7998313-7998335 AAAGAGCAAGTATCCTGGGAAGG + Intergenic
1134329858 16:13240925-13240947 AAATGAAGAGAATACTGGGAGGG + Intergenic
1134655873 16:15948289-15948311 AAAGACAGAGTACATTGTCAGGG - Intergenic
1135227185 16:20671153-20671175 AAAGACAGAATATTCTAGCAGGG - Intronic
1135425726 16:22333988-22334010 AAAGAGAGTGTATACTGACATGG + Exonic
1140085234 16:71789999-71790021 ATACACACAGTGTACTGGGATGG - Intronic
1140622075 16:76746928-76746950 AAAGAGAGAGTCTGCTGGGCCGG + Intergenic
1142309513 16:89304183-89304205 CAAGACAGAATCCACTGGGAAGG + Intronic
1142704146 17:1683838-1683860 AAAAACAGAGTAAAATGGTAAGG - Intronic
1147502388 17:40978053-40978075 AAAGACTGAGGATACCTGGAGGG + Exonic
1147620026 17:41860110-41860132 AAAGACAAAGTAGAGTGGTATGG + Intronic
1147908685 17:43841193-43841215 AAAAAGAAAGTATACTGGGGAGG - Intergenic
1148043648 17:44728402-44728424 AAGGAGTGGGTATACTGGGATGG + Intronic
1151557521 17:74854168-74854190 AAAGACACAGGATGCTGTGAGGG - Intronic
1154403237 18:14062865-14062887 AAAGACAAAATATACAGTGAAGG + Intronic
1154497878 18:14975566-14975588 AAAGACAGGGAGCACTGGGAGGG + Intergenic
1154958101 18:21279436-21279458 AAGTACAAAGTATGCTGGGAAGG - Intronic
1155905604 18:31447574-31447596 AAAGACAAAGTTTAATAGGAAGG - Intergenic
1156988433 18:43377326-43377348 AAAAACAGTGTATATTGTGAAGG - Intergenic
1157272572 18:46287866-46287888 AAACACAAAGTAGACTGAGAAGG - Intergenic
1157307861 18:46530119-46530141 AAAGACAGAGGATACACAGAGGG - Intronic
1157784230 18:50467761-50467783 AAAGGGAGAGTATCCTGGGTGGG - Intergenic
1158419688 18:57281930-57281952 CCAGACATAGTAGACTGGGAAGG + Intergenic
1159439484 18:68458647-68458669 AAAGACAGAATATACCCGGCCGG - Intergenic
1159837837 18:73361166-73361188 AAAGACAAAATATAATAGGAGGG - Intergenic
1159892059 18:73962241-73962263 AAAGAGAGATTATCCTGGGAGGG - Intergenic
1160032879 18:75278136-75278158 AAAGACAGAGTAAACTGGGGTGG - Intronic
1163859868 19:19736900-19736922 AAATACAGAGTAGACAGGCATGG - Intergenic
1164177372 19:22787186-22787208 AAAGACATAGAATACTGGCCGGG + Intergenic
1167533560 19:50034163-50034185 AAAGACAGAAGACCCTGGGATGG - Intronic
926866800 2:17368904-17368926 AAAGACAGAAGATACTTGGTTGG + Intergenic
927103551 2:19806161-19806183 TAAGACAGAGGATGCTGGGGAGG + Intergenic
927206394 2:20613779-20613801 ACACACAGAGTACACAGGGATGG + Intronic
929253758 2:39786947-39786969 AAAGAGTGTGTGTACTGGGAGGG + Intergenic
929260999 2:39866476-39866498 AAAGACATCCTATTCTGGGAGGG - Intergenic
930105661 2:47637325-47637347 AAAGACAGAGGGAACTTGGAAGG + Intergenic
930401257 2:50892437-50892459 AAAAACATATTATACTGGGAGGG - Intronic
931206421 2:60149844-60149866 AAAGTCAGACTGTGCTGGGAAGG - Intergenic
931676587 2:64702486-64702508 AAAGACAGTCTATACTGACATGG + Intronic
931941759 2:67259778-67259800 AAAGGGTGAGTATACGGGGAGGG - Intergenic
932047811 2:68367521-68367543 AAAGACAGAGTTTCCTGAGAAGG + Intronic
932321348 2:70824051-70824073 AAAGAAAGAGTCTACTTGGTGGG + Intergenic
932929779 2:76020896-76020918 AAAGACAGAGAAGATTTGGATGG + Intergenic
933532811 2:83531802-83531824 TAAGTCAAATTATACTGGGAAGG + Intergenic
934784321 2:96993842-96993864 AAAGCGAAGGTATACTGGGACGG + Intronic
935887068 2:107633760-107633782 AAAGAAAGAGTATACTGCAAGGG + Intergenic
936723637 2:115285396-115285418 AAAGACAGAGTATACTGGGATGG + Intronic
937213129 2:120290655-120290677 AATGAGAAAGTATGCTGGGATGG - Intronic
937313265 2:120915158-120915180 AAAGAGAGAGTGTGCTGGGCTGG - Intronic
939197447 2:138990479-138990501 CAAGACAGACTTTACTGAGAGGG - Intergenic
939685659 2:145196492-145196514 AAAGATAGAGGATAATAGGAAGG + Intergenic
941003097 2:160221715-160221737 AAAAACACATTAAACTGGGATGG - Intronic
942407388 2:175669954-175669976 AAATACAGAGAATACTGCAAAGG + Intergenic
942854167 2:180526022-180526044 AAGGATAGAGCATTCTGGGATGG + Intergenic
942940424 2:181609087-181609109 AAATAAAGAGAATACTGGCATGG - Intronic
943819314 2:192299909-192299931 GAAGTCAGGTTATACTGGGAAGG - Intergenic
944166199 2:196724005-196724027 AAAGAGAGAGTATAAGAGGAAGG + Intronic
945332978 2:208560988-208561010 AAAGGCAGATTATCCTGGGTGGG - Intronic
945448769 2:209969610-209969632 AAGCACAGAGCATACTGGGAGGG - Intronic
948077317 2:235174879-235174901 AAAGACTGTGTATACAGGCAGGG + Intergenic
1169170782 20:3463236-3463258 AAAAACAGACAATACTGGCATGG - Intergenic
1169556991 20:6761813-6761835 AAAGACAGGTTATCCTGGGTAGG + Intergenic
1169827174 20:9782003-9782025 AAAGACAGATTTTACTCTGAGGG - Intronic
1172202275 20:33134918-33134940 AAAGAAAGACTACAGTGGGAAGG - Intergenic
1172342624 20:34170338-34170360 AGATACAGAGAAGACTGGGAAGG - Intergenic
1172785367 20:37464957-37464979 AAAGACAGGGTATACTAAGAAGG - Intergenic
1174901502 20:54505659-54505681 AAAGAGAGAGTATAGGGGGTGGG + Intronic
1176367698 21:6043874-6043896 AGAGACAGAGAACACTGGGGAGG + Intergenic
1178298000 21:31427166-31427188 AAAGACATAGTATATTGCCAAGG - Intronic
1178403271 21:32305268-32305290 AAAAACAGGGTATAATGGGCTGG - Intronic
1179755821 21:43494668-43494690 AGAGACAGAGAACACTGGGGAGG - Intergenic
1179813414 21:43886620-43886642 GAAGACAGAGAAGGCTGGGAAGG - Intronic
949514261 3:4792978-4793000 AAAGGCAGAGTATATGGGGAAGG + Intronic
950026620 3:9824703-9824725 AAAGAAAAAGTAAACTGGGACGG - Intronic
950813018 3:15668057-15668079 AAAGACAGAAGTTACCGGGAGGG + Exonic
951703665 3:25522647-25522669 AAAGACAGAGAACACTGGAAAGG + Intronic
951887590 3:27539242-27539264 AAAAAAAGAGTATACTGGGGTGG + Intergenic
952474554 3:33694210-33694232 AAAGAAAAAGTCTACTGAGATGG + Intronic
953348107 3:42192946-42192968 AAAGACAGGGTAGAGTGGGGAGG - Intronic
953911598 3:46896015-46896037 GAAGACAGAGTGTAGTGGGAAGG + Intronic
954991913 3:54848687-54848709 AAAGACGCAGCATAGTGGGAGGG + Intronic
955260785 3:57388279-57388301 AAAGACAGAGTAATGGGGGAAGG - Intronic
955925763 3:64003598-64003620 AAAGTCAGAGTAGACTGAAAGGG - Intergenic
956090167 3:65657849-65657871 ATAGCCAGATGATACTGGGAAGG + Intronic
956236436 3:67077307-67077329 TAAGACAGAGGAGCCTGGGAGGG - Intergenic
956401367 3:68883402-68883424 AAAGAGAGACTATCCTGGGTGGG - Intronic
957603200 3:82365526-82365548 AAAGTCTGGGTAAACTGGGATGG + Intergenic
958839563 3:99186995-99187017 AAAGAGAGGGAATATTGGGAAGG + Intergenic
960378801 3:116935047-116935069 AAAGATAGTCTAAACTGGGATGG - Intronic
960534560 3:118802308-118802330 AAAGACAGAGTAATCAGGGCTGG + Intergenic
961434677 3:126908690-126908712 AAATACATAGTATACTTGGTTGG + Intronic
961629787 3:128287964-128287986 AAAGACAGAGTTTTTTGGGGGGG - Intronic
962279683 3:134040356-134040378 AAAGGCAGAGTCAACTGGGATGG - Intronic
963015685 3:140821850-140821872 AGTGACAGAGTCCACTGGGAGGG + Intergenic
964144723 3:153445418-153445440 GAATAGAGAGTATACTGTGATGG + Intergenic
965663159 3:171063718-171063740 AAAGATGGACTGTACTGGGAGGG + Exonic
965774679 3:172216079-172216101 AAAGAGAGAAAATGCTGGGATGG + Intronic
967548010 3:190754847-190754869 CAAAACAGAGAAAACTGGGAGGG + Intergenic
969038863 4:4277896-4277918 AAACACAGGGTATGCTGGGAGGG + Intronic
970619504 4:17802938-17802960 AAAGGCAGAGTAAATTGGGGTGG + Exonic
970830735 4:20336713-20336735 AGACACAGAGTATACAGTGAAGG + Intronic
971002990 4:22343171-22343193 AAAGACAGAATATAGAGGAAGGG + Intergenic
971146232 4:23979809-23979831 AAAGACATTGCACACTGGGAGGG - Intergenic
971150927 4:24030770-24030792 AGACACAGAGTAGACTGGAATGG + Intergenic
971242015 4:24897888-24897910 AAAGCCAGAGAATGTTGGGAAGG + Intronic
971741179 4:30523810-30523832 ATAGACAGTGAAGACTGGGAAGG - Intergenic
972829185 4:42794357-42794379 AAGGACAGAGTATAGAGGGATGG - Intergenic
973139013 4:46743011-46743033 AAAGAGTGAGTATAGTTGGAAGG - Intronic
974113332 4:57550796-57550818 AAATAAAGAGTACAGTGGGATGG - Intergenic
975477298 4:74838085-74838107 ATAGACAGTTTATACTTGGAAGG - Intergenic
976200167 4:82570187-82570209 AAAGAGAGAGTATTAGGGGAGGG - Intergenic
976956685 4:90910115-90910137 AAAGAGAGAGCAAAGTGGGAAGG + Intronic
978900287 4:113940666-113940688 AAAGACAGAGTATCCAGAGAAGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980368819 4:131840682-131840704 AAGGCCAGAGCAGACTGGGAAGG - Intergenic
980512240 4:133809547-133809569 AAGAAGAGAGTAGACTGGGATGG - Intergenic
981216116 4:142170458-142170480 GAAGACACAGTATACTGGTCAGG + Intronic
982529458 4:156521049-156521071 AAAGATAGTGTCTTCTGGGAAGG + Intergenic
983327660 4:166278906-166278928 AAAGACAGAGTATAATAAGGGGG - Intergenic
987112752 5:14702255-14702277 AAGGAAAGAGTGTACAGGGATGG + Intergenic
987631519 5:20478527-20478549 AAGGAGAGAGAAGACTGGGAAGG + Intronic
988905318 5:35782042-35782064 AAAGCCAGAGTATACTTTGTGGG - Intronic
989145557 5:38246129-38246151 ATTGACACAGTATTCTGGGATGG + Intergenic
990054574 5:51556125-51556147 AAAAACAGAATAAAGTGGGAAGG + Intergenic
990252761 5:53933263-53933285 AAAGACATAGGATATAGGGAGGG + Intronic
990365892 5:55069874-55069896 ACAGACTTATTATACTGGGATGG - Intergenic
990717739 5:58657398-58657420 AAGGAAAGAGTATTCGGGGAAGG + Intronic
990774929 5:59295649-59295671 AAAAACAGAATACACAGGGAAGG - Intronic
990864367 5:60364871-60364893 AAAGAAAGAGAAGAATGGGAAGG - Intronic
993796850 5:92277739-92277761 GAAGACAGCGTATACTTGGTTGG - Intergenic
994401159 5:99281241-99281263 AAACACAGAATATACTGTGTAGG + Intergenic
995075983 5:107983487-107983509 AAAGACAAAGAATGCTGGGTGGG - Intronic
1002418305 5:179132326-179132348 AAAGACACAGAAAACTGAGAAGG + Intronic
1003138646 6:3454009-3454031 AAACACACAGAACACTGGGAAGG + Intronic
1003979058 6:11372174-11372196 AAAGACAGACAATAGAGGGATGG - Intronic
1005138771 6:22602173-22602195 ACAGCCAGAGTATAGTGAGAGGG - Intergenic
1005361851 6:25038440-25038462 AAAGAGAGATTATCCTGGGTGGG + Intronic
1005509332 6:26498198-26498220 AGAGACAGAATATTCTGGAAGGG + Intergenic
1009277812 6:61706168-61706190 AAAGGGAGAGTACACAGGGAGGG - Intronic
1011799328 6:90993266-90993288 AAATACAGATTATACTGAAAGGG - Intergenic
1012074999 6:94672334-94672356 AAAGACATAGTTTCCTGGCAGGG - Intergenic
1012658144 6:101852299-101852321 AAAGACTGAGAATACAGGGTTGG - Intronic
1014050988 6:116954141-116954163 AAATAAAGAGTATAATTGGATGG - Intergenic
1014190499 6:118490353-118490375 AAAGAGAAAATATAATGGGATGG + Intronic
1014239697 6:119001828-119001850 AAGGACAGATTTTACTGGGTAGG - Intronic
1014328260 6:120027141-120027163 GAAGACAGATTATCCTGGGTGGG - Intergenic
1014689060 6:124539360-124539382 AAAGAGAGAGTATTTTGAGATGG - Intronic
1014759736 6:125343332-125343354 AAAGAAAAAGTATGTTGGGAAGG - Intergenic
1014783783 6:125594664-125594686 AATATCAGAGTAGACTGGGATGG + Intergenic
1015035763 6:128652163-128652185 AAAGGCAGAGCAGACAGGGATGG + Intergenic
1017018517 6:150121022-150121044 ACAGAAAGAGTATAATTGGAAGG - Intergenic
1017205909 6:151804394-151804416 AAAGCAAGAGTATTCAGGGAGGG - Intronic
1017949388 6:159123281-159123303 AAAGACAGCCTCTAGTGGGATGG + Intergenic
1018016015 6:159713010-159713032 GATGACAGAGTTTACTGGTAGGG - Intronic
1018818771 6:167356450-167356472 AATGACAGAGTATAAAGGGCTGG - Intronic
1019027826 6:168985986-168986008 ATAACCAGAGTATAATGGGATGG + Intergenic
1020653045 7:10898041-10898063 AAAGATAGAGTATAAAAGGATGG + Intergenic
1020762261 7:12283208-12283230 AAAGAGTTACTATACTGGGAGGG - Intergenic
1021654088 7:22857824-22857846 AAAAAAAGAATATACTGGGCGGG - Intergenic
1022078300 7:26994996-26995018 AAATACAGAGCATTGTGGGAAGG - Intronic
1022179637 7:27906453-27906475 AAAGACATAGTATTCAGGAATGG - Intronic
1022521968 7:31014253-31014275 GAAGACAGAAGATACAGGGAAGG - Intergenic
1022643586 7:32210628-32210650 AAAAACAAAATATACTGAGATGG - Intronic
1023061436 7:36331046-36331068 AAAGACCAGGTATACTTGGATGG - Exonic
1024839808 7:53573402-53573424 CAAGAAAGAGTAAACTGGGCAGG + Intergenic
1026173282 7:67973387-67973409 AAAGAAAAAGTATACTCTGAAGG + Intergenic
1026620100 7:71942614-71942636 AAAGAAAGAGTAAGCTGAGATGG + Intronic
1027700826 7:81468431-81468453 ACAGACAGAATTTTCTGGGAGGG + Intergenic
1028064816 7:86370253-86370275 AAAGATAGAATATACTGTGTTGG - Intergenic
1030456055 7:109775034-109775056 GAAGACAGAGGATACTTGGTTGG - Intergenic
1031027140 7:116691981-116692003 AGAGACAGTGGATTCTGGGAAGG + Intronic
1033347431 7:140536445-140536467 AAAGCCAGTGTAGTCTGGGAGGG + Intronic
1034247746 7:149661740-149661762 AAATACAAAATACACTGGGAAGG - Intergenic
1034752126 7:153579093-153579115 AAAGACAGAGAATAGTTGAATGG + Intergenic
1036259609 8:7229311-7229333 AAAGACAGGGGAGACTGGGGAGG + Intergenic
1036307008 8:7610213-7610235 AAAGACAGGGGAGACTGGGGAGG - Intergenic
1036311652 8:7687881-7687903 AAAGACAGGGGAGACTGGGGAGG + Intergenic
1036357856 8:8058200-8058222 AAAGACAGGGGAGACTGGGGAGG - Intergenic
1036358920 8:8064342-8064364 AAAGACAGGGGAGACTGGGGAGG - Intergenic
1036893093 8:12608746-12608768 AAAGACAGGGGAGACTGGGGAGG + Intergenic
1036900654 8:12666732-12666754 AAAGACAGGGGAGACTGGGGAGG + Intergenic
1037363193 8:18095601-18095623 AGGGACAGTGTATATTGGGACGG - Intergenic
1037871549 8:22502074-22502096 AAAGAAAGATTATCTTGGGAGGG - Intronic
1039648683 8:39316309-39316331 AAAGAAAGGGTATATGGGGAAGG - Intergenic
1040745950 8:50642722-50642744 GAAGACAGAAAATACTGGGAAGG - Intronic
1040968240 8:53106163-53106185 ACATACAGAATATACAGGGAAGG - Intergenic
1041563357 8:59246490-59246512 AAAGGGTGAGCATACTGGGATGG + Intergenic
1042375063 8:68040522-68040544 AAGGACAGGGCACACTGGGAAGG - Intronic
1043586796 8:81779417-81779439 AAATACAGAATTTACTGGAAAGG + Intergenic
1044062420 8:87654377-87654399 AGATACAGAATATACTGGGAAGG + Intergenic
1045354874 8:101376679-101376701 AAAGACTGAGAATACAGTGATGG - Intergenic
1048218098 8:132515267-132515289 AAAGAAAGGGTCTTCTGGGAAGG + Intergenic
1049400306 8:142423731-142423753 AAAGACAGAGCAGAGTGAGAAGG - Intergenic
1050152289 9:2628749-2628771 AAAGATAGACTACACAGGGAGGG + Intronic
1051238145 9:15023577-15023599 AAAGACAGAGTATAATGGGTAGG - Intergenic
1055003630 9:71481769-71481791 CAAGACAGATTTTACTGAGAAGG + Intergenic
1055164614 9:73176118-73176140 AAAGAGAGACTTTACTGAGAGGG - Intergenic
1058677591 9:107413659-107413681 AAAGGCAGATTATCCTGGGTGGG + Intergenic
1059361374 9:113744491-113744513 GAAGATGGAGTATCCTGGGATGG + Intergenic
1061540570 9:131276070-131276092 AAAGCCAGAGTCTTCCGGGAAGG - Exonic
1186315186 X:8361958-8361980 AAACCCAGAGTAGACTGAGAAGG - Intergenic
1186893342 X:13981860-13981882 AAAGAGAGATAATCCTGGGAGGG + Intergenic
1187558262 X:20374003-20374025 TGAGACAGAGTTTAGTGGGAAGG + Intergenic
1188055039 X:25530994-25531016 AAAGTTATAGTATACAGGGAGGG - Intergenic
1190288676 X:48977286-48977308 AAAGAGAGAGAATTCTGGAAGGG + Intronic
1190784429 X:53630783-53630805 AAATACAGTGAACACTGGGAGGG + Intronic
1191897927 X:66013356-66013378 AAACACAAAGTATGCTGGGAAGG - Intergenic
1194354927 X:92870973-92870995 AAAGGGAGACTATACTGGGTGGG + Intergenic
1194574285 X:95592836-95592858 AGAGACAGAGTATTGGGGGATGG + Intergenic
1196248478 X:113429043-113429065 AAGGAGAGAGAAGACTGGGAAGG + Intergenic
1196890212 X:120284095-120284117 AAAGTCAGAGTTTGCCGGGAGGG - Intronic
1197330488 X:125148166-125148188 AAAGAGAGAGAATAGTGAGAGGG - Intergenic
1198202784 X:134438492-134438514 AATGACAGAGTATACTGACCTGG - Intergenic
1199336827 X:146628361-146628383 AAAGACACTGGAGACTGGGATGG - Intergenic
1199437273 X:147826862-147826884 AGATACAAAGTATAATGGGAAGG - Intergenic
1200663287 Y:5987990-5988012 AAAGGGAGACTATACTGGGTGGG + Intergenic