ID: 936724540

View in Genome Browser
Species Human (GRCh38)
Location 2:115297126-115297148
Sequence CATGCTGCTCACATAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936724540_936724546 17 Left 936724540 2:115297126-115297148 CCATTTTCTATGTGAGCAGCATG 0: 1
1: 0
2: 1
3: 12
4: 216
Right 936724546 2:115297166-115297188 CGAAGTAAATGAGTGGGGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 143
936724540_936724545 13 Left 936724540 2:115297126-115297148 CCATTTTCTATGTGAGCAGCATG 0: 1
1: 0
2: 1
3: 12
4: 216
Right 936724545 2:115297162-115297184 TCTACGAAGTAAATGAGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 70
936724540_936724544 12 Left 936724540 2:115297126-115297148 CCATTTTCTATGTGAGCAGCATG 0: 1
1: 0
2: 1
3: 12
4: 216
Right 936724544 2:115297161-115297183 ATCTACGAAGTAAATGAGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 108
936724540_936724542 10 Left 936724540 2:115297126-115297148 CCATTTTCTATGTGAGCAGCATG 0: 1
1: 0
2: 1
3: 12
4: 216
Right 936724542 2:115297159-115297181 ATATCTACGAAGTAAATGAGTGG 0: 1
1: 0
2: 0
3: 11
4: 157
936724540_936724543 11 Left 936724540 2:115297126-115297148 CCATTTTCTATGTGAGCAGCATG 0: 1
1: 0
2: 1
3: 12
4: 216
Right 936724543 2:115297160-115297182 TATCTACGAAGTAAATGAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936724540 Original CRISPR CATGCTGCTCACATAGAAAA TGG (reversed) Intronic
901152122 1:7110760-7110782 CTTTCTGCTGACATAGAAAGAGG - Intronic
901186512 1:7376838-7376860 CATTTTGCTCACATAGGCAAGGG - Intronic
906557709 1:46727735-46727757 CATGCTGCTCACTTATAAGTGGG + Intergenic
906971363 1:50518299-50518321 CATACTGCTCAGAAATAAAAAGG - Intronic
907304890 1:53507935-53507957 CATGGGGCTCACATGGAAGACGG - Intronic
910675728 1:89814805-89814827 CATGCAACTCACATTGAAATAGG - Intronic
911331772 1:96532673-96532695 TATGCTTCTCAAATAGAAATAGG - Intergenic
916364571 1:164010333-164010355 GAAGCTACTCACAAAGAAAAAGG + Intergenic
918178571 1:182066690-182066712 CATGCTCCTCACCCATAAAATGG + Intergenic
918202657 1:182281654-182281676 GATGCTGCTCACAGAGGACAGGG + Intergenic
921215211 1:212931037-212931059 GATGCTACCCACATTGAAAAGGG - Intergenic
923613790 1:235519465-235519487 CCTCCTGCTCACAGAGGAAAGGG - Intergenic
1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG + Intergenic
1063547491 10:6996500-6996522 CATGCTGCAGCCATAGGAAAGGG - Intergenic
1066438009 10:35412051-35412073 CATGCTGTTCTCATGGGAAAGGG + Intronic
1066641899 10:37562328-37562350 CATCCTGATCACATAGAATAAGG + Intergenic
1066662136 10:37747189-37747211 GATGCTGCTCACAAAGGTAAGGG - Intergenic
1067465066 10:46491632-46491654 CATGCTGCTCCCAGAGGAATAGG + Intergenic
1067596315 10:47561705-47561727 CTTGTTCCTAACATAGAAAATGG - Intergenic
1067622122 10:47892969-47892991 CATGCTGCTCCCAGAGGAATAGG - Intergenic
1069880930 10:71592715-71592737 CATGCTACTTACATGGCAAAGGG - Intronic
1070068224 10:73059168-73059190 CAAAATGGTCACATAGAAAAAGG + Intronic
1070084413 10:73222383-73222405 CTTGCTGCTCACGTGGAACAAGG - Intronic
1070333959 10:75438268-75438290 CATGTTTCTCACACACAAAAAGG - Intronic
1070996010 10:80782967-80782989 TATACTGCTTACATAGAATATGG + Intergenic
1073167059 10:101464666-101464688 CATGCTCTTCACAAAGAGAATGG - Intronic
1074434265 10:113420590-113420612 CTTTCTGCCCACATAGAAATGGG + Intergenic
1079538332 11:21541691-21541713 AATGCTGCTCAGCTAGAAAGAGG - Intronic
1081562049 11:44226688-44226710 CATGCTGCCCAGATGGGAAAGGG - Intronic
1082735343 11:56848890-56848912 AATGCTGCTTACACAGAAATAGG + Intergenic
1083040167 11:59678366-59678388 TATGCTGCTGACTTTGAAAATGG - Intergenic
1084617566 11:70246583-70246605 CAGGCTGCTCCCAAAGAGAAAGG + Intergenic
1087125474 11:94621729-94621751 CATGCTGCACTCATAATAAAGGG - Intergenic
1087516481 11:99168955-99168977 CATGATGCTCACCTGGAACATGG + Intronic
1088571208 11:111225228-111225250 CATGGTGCTGACATAAAAACAGG + Intergenic
1088883021 11:113986537-113986559 CAGGCTGACCACATAGAAGAGGG - Exonic
1090885600 11:130873567-130873589 CATGTTCCCCACCTAGAAAATGG + Intergenic
1092732072 12:11544413-11544435 CATGCAGCTCACAAACAAAAGGG + Intergenic
1092936430 12:13368243-13368265 CCTGCTGCTCACAAAGACCATGG - Intergenic
1094242873 12:28248953-28248975 CATTCTGCTCACAAAGAAAAAGG - Intronic
1095148256 12:38757625-38757647 CATTTTGCTAACATTGAAAAAGG + Intronic
1096071124 12:48776085-48776107 CATGCTGCCCGCACAGAAAGAGG - Exonic
1101093937 12:101316344-101316366 CATGCTGTTCACGGAGATAAAGG + Intronic
1103225074 12:119280122-119280144 TATGTTGCTGATATAGAAAAAGG - Intergenic
1104261907 12:127192136-127192158 CCTGCTGTTCACACAGAACATGG + Intergenic
1104392058 12:128399439-128399461 TTTGCTGCTCACATAGCATATGG - Intronic
1107150640 13:37106828-37106850 CATGCTGTTCTCATAATAAAAGG + Intergenic
1108797598 13:54050375-54050397 CATGGTGCTCACACCAAAAAAGG - Intergenic
1110872102 13:80464193-80464215 CACACTGCTGACATAGAAACCGG - Intergenic
1111886810 13:94031652-94031674 CATGCTGCCCAAATGCAAAATGG + Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1115146913 14:30236948-30236970 CATGGTCCTCACATGGACAATGG - Intergenic
1115967888 14:38912397-38912419 GATGCAGCTCCCATAGGAAAGGG + Intergenic
1116115357 14:40641789-40641811 CATGTTGCTTACCAAGAAAAAGG - Intergenic
1117097481 14:52313592-52313614 TATGCTGTTGACATAGGAAACGG + Intergenic
1119037889 14:71246067-71246089 CATGCTCCTCAGCTAGAAAAGGG - Intergenic
1119487691 14:75002635-75002657 CTTGCTGCTCCCATAGCAACGGG + Intergenic
1120038913 14:79730017-79730039 CATGCTTCTCAGAAAGAAAGGGG + Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1126898999 15:53292065-53292087 CTTGCTGCTCACTCTGAAAAAGG - Intergenic
1127747508 15:61994921-61994943 GATTCTGCTGACATTGAAAATGG + Intronic
1127830773 15:62749156-62749178 CATGCTGATCATCCAGAAAATGG - Intronic
1129952701 15:79606142-79606164 CAGGCTTCTCACATGTAAAATGG + Intergenic
1131690496 15:94822248-94822270 CATGCTGTTTACAAACAAAAAGG + Intergenic
1131737327 15:95347864-95347886 CCAGATGCTAACATAGAAAAGGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133900805 16:9972525-9972547 TATGCTCATCACAAAGAAAAAGG + Intronic
1139174212 16:64667762-64667784 CTTCCTGCTTAAATAGAAAATGG - Intergenic
1143691925 17:8575200-8575222 CATGCTACTCACATACAACAGGG + Intronic
1144211663 17:13021021-13021043 CAAGCTGCCCATATACAAAATGG - Intergenic
1144586284 17:16489822-16489844 CCTGCTGCTTTCACAGAAAAGGG + Intronic
1144818549 17:18054419-18054441 CCTGCTGCTTAAATAGCAAATGG + Intronic
1145931153 17:28686758-28686780 CTTGCTGTTCATATAGAGAATGG - Exonic
1146780257 17:35664400-35664422 CATGCTGCACACATGGCTAATGG + Intronic
1148803811 17:50253029-50253051 TATGCTGCTGATATAGAGAAAGG - Intergenic
1150697848 17:67421208-67421230 CATACAGCTCATATAGAAGACGG + Intronic
1153187689 18:2502916-2502938 CTTGCACCTCAGATAGAAAAAGG - Intergenic
1153385244 18:4486136-4486158 TAAGCTGCTTACATACAAAAGGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1158166503 18:54547058-54547080 CATGCTAATCACAAAGACAATGG + Intergenic
1158198948 18:54918846-54918868 CAGGCTGCTCCCAGAGAAGAAGG + Intronic
1158444532 18:57507878-57507900 CATCCAGCTCATATAGCAAAAGG - Intergenic
1159326377 18:66924566-66924588 TGTGCTCCTCAAATAGAAAAGGG + Intergenic
1159765961 18:72488870-72488892 CATTGTCCTCACATTGAAAAAGG + Intergenic
1162248073 19:9419496-9419518 CATGCTGCCCACTGGGAAAAGGG + Exonic
1162298413 19:9828990-9829012 CATGGTGAGCACTTAGAAAATGG + Intronic
1163368062 19:16887416-16887438 CACTCTGCTCACAGAGAAGACGG + Intergenic
1165611127 19:37154107-37154129 CAGGCTGAACACAGAGAAAAGGG + Intronic
1167219817 19:48191570-48191592 CATTCTGATCACATGGAAAAGGG + Intronic
926633972 2:15161558-15161580 CCTGCTTCTCCCTTAGAAAAGGG - Intergenic
927465276 2:23331962-23331984 CTTTCTGCTCACAAAGTAAATGG - Intergenic
927813248 2:26192128-26192150 TATGGTGGTCACAAAGAAAATGG + Intronic
928660620 2:33498667-33498689 AATGCTGCACACAGAGAAAATGG - Intronic
930380440 2:50621409-50621431 CATGTTAGTAACATAGAAAAAGG + Intronic
930951957 2:57153596-57153618 GCTTCTGCTCATATAGAAAAGGG + Intergenic
931092700 2:58903117-58903139 CATGATGCCCAGATAGAAAGAGG + Intergenic
933692366 2:85189438-85189460 CATCCTGCTCTTAAAGAAAAGGG + Intronic
936724540 2:115297126-115297148 CATGCTGCTCACATAGAAAATGG - Intronic
936827277 2:116597981-116598003 TATGCTGTTCCCATGGAAAACGG + Intergenic
937191522 2:120105406-120105428 CATCCTGCTCACATAGAGGTTGG + Intronic
937241414 2:120464873-120464895 CATGCTGCTCCCAAAGCCAAGGG - Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939734161 2:145822949-145822971 CATGCAGCTCAAGAAGAAAAAGG + Intergenic
940027148 2:149220117-149220139 CATGCAGCTCTCAAAGACAAAGG - Intergenic
943378950 2:187119061-187119083 CCTGCTGCTCACCTCCAAAATGG - Intergenic
943416600 2:187614247-187614269 AATCCTTTTCACATAGAAAATGG + Intergenic
944320488 2:198335427-198335449 CAGGCTGCTCACATTGATCAGGG - Intronic
945655260 2:212615540-212615562 CCTTCTGTTCACATAGATAATGG + Intergenic
946023656 2:216658979-216659001 CGTGCAGCTGATATAGAAAATGG + Intronic
946263549 2:218518629-218518651 CATGTTGCTCTTATACAAAAAGG + Intronic
946654204 2:221927976-221927998 CATTTTCCTCATATAGAAAAGGG + Intergenic
948181883 2:235988791-235988813 CATGCTGACCACAGAAAAAAGGG - Intronic
1169433805 20:5565580-5565602 CATGATGCTTATTTAGAAAATGG - Intronic
1169988476 20:11473302-11473324 CATGTGGCTGACAAAGAAAAGGG - Intergenic
1170087536 20:12551488-12551510 TATGCAGCTCTCATAGATAAAGG + Intergenic
1170943482 20:20868550-20868572 GATGCTGATCAGATAGCAAAAGG - Intergenic
1171762813 20:29225053-29225075 CATTCATCTCACAGAGAAAAAGG + Intergenic
1173679748 20:44869631-44869653 CATGCTGATCTCATGGAATAAGG - Intergenic
1174504636 20:51009385-51009407 CATGATGCTCACATATTAACAGG + Intronic
1174972308 20:55289818-55289840 CATGCTTCTCAGATAGGAGATGG - Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177052775 21:16258725-16258747 CATTCTGATCACTTAGAATATGG - Intergenic
1178043661 21:28669880-28669902 CATGCTCCCTACATTGAAAAGGG + Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1181166660 22:20987551-20987573 CATGCTGCTCCCATAGACGACGG - Exonic
1183030434 22:35099913-35099935 TATTCTGCTCACATAGCATAGGG + Intergenic
1184110025 22:42389086-42389108 GATTCTGGTCACAGAGAAAAGGG + Intronic
949853126 3:8438822-8438844 AATTCTGCTCACAAACAAAAGGG - Intergenic
952726965 3:36596733-36596755 CATACTGCTCTTGTAGAAAAAGG - Intergenic
953390816 3:42532662-42532684 CATGTGCCTCACATGGAAAAAGG + Intronic
953809391 3:46098747-46098769 CTTGATGTTCACGTAGAAAAAGG - Intergenic
954914502 3:54137167-54137189 CATGCCGCCCACATTGAGAAAGG - Intronic
957643481 3:82888120-82888142 CATCCTTCTCACATGCAAAATGG - Intergenic
959384392 3:105684217-105684239 CATGCTTGGCACATAGAATAGGG - Intronic
961458575 3:127036320-127036342 CATGCTACTCACATGGACAAGGG - Exonic
963917598 3:150873356-150873378 CATGCTGCCCACCTGGAAAGGGG + Exonic
964644226 3:158941215-158941237 CATGGTACTCACATAAAAATGGG + Intergenic
965174038 3:165307662-165307684 CATGGTACTGACATAGAAACAGG + Intergenic
965373164 3:167889780-167889802 CATCCTGCTGACATGGAAGATGG - Intergenic
966028672 3:175318392-175318414 CATGATCATCACAGAGAAAAAGG - Intronic
967292391 3:187933975-187933997 CATGTTGCTCAAATGGACAAAGG + Intergenic
969727991 4:8936417-8936439 CATGATGCTGGCATAGAAACAGG + Intergenic
972646986 4:40978041-40978063 CAAGGTGCTCATATAGAAGATGG + Intronic
973694545 4:53477117-53477139 CTGGGTGCTCACATAGCAAATGG + Intronic
975045144 4:69793989-69794011 CATTCTTCTGACATAGAAATGGG + Intergenic
976060738 4:81125453-81125475 AATGCTGCTCACCAATAAAAAGG - Intronic
976422035 4:84856240-84856262 CATGCTTCTCAAATATAAATTGG + Intronic
976995469 4:91426963-91426985 CTAGCTCCTCACCTAGAAAATGG - Intronic
978714934 4:111830603-111830625 CATCCTGCTGATATAGACAAGGG - Intergenic
979503865 4:121471062-121471084 TAGGCAGCTCATATAGAAAAGGG + Intergenic
981298368 4:143158712-143158734 CAGGCTTCTCATATATAAAATGG - Intergenic
983783655 4:171704725-171704747 TATACTGCTAATATAGAAAAAGG - Intergenic
986336692 5:6760657-6760679 CAGGCTGTTCACAGAGCAAAAGG + Intergenic
986593352 5:9394325-9394347 CTTGCTTCTCACATGGTAAATGG - Intronic
987134174 5:14885439-14885461 CAAGCTTCACACATAGGAAAGGG + Intergenic
987241666 5:16006283-16006305 GATGCTGCTCACATGCAGAATGG - Intergenic
988641823 5:33049197-33049219 CAGGATGATCACATAGAGAAAGG + Intergenic
988911386 5:35847042-35847064 CTTGCTGCTGCCATAGAAAAAGG - Intergenic
991726837 5:69543944-69543966 CATGTGGATCACCTAGAAAAGGG + Intronic
991868120 5:71083930-71083952 CATGTGGATCACCTAGAAAAGGG - Intergenic
994614888 5:102092121-102092143 CATGCTGCTGATAAAGAGAATGG + Intergenic
996523830 5:124456016-124456038 CTTCCTTTTCACATAGAAAATGG - Intergenic
999254384 5:150201942-150201964 CAGGCTGCACAGCTAGAAAATGG + Intronic
999613530 5:153396990-153397012 CATGCTTATCACATAGTAAAAGG - Intergenic
1000733745 5:164871544-164871566 CATGCTGCTTACTTAGAGGACGG + Intergenic
1001692888 5:173646022-173646044 CATGCTGCTCAATTAGGCAATGG - Intergenic
1001865790 5:175104357-175104379 CTTGCAGCTCACCTAGAAAGTGG + Intergenic
1004186515 6:13426015-13426037 CATGCTGCTCACACAGAAGCAGG + Intronic
1004202189 6:13559123-13559145 TATGCTGTTCTCAGAGAAAAAGG - Intergenic
1004545992 6:16598845-16598867 AAGGCTGCTGACATAGAAACTGG + Intronic
1005843532 6:29760233-29760255 CAGGGTGCTCCCACAGAAAAAGG - Intergenic
1008762101 6:54863424-54863446 CATGGTGCTCACCAGGAAAAAGG - Intronic
1008816061 6:55568234-55568256 AATTCTGATCACTTAGAAAAAGG + Intronic
1009889611 6:69664800-69664822 CAGGCTGCTCATATGTAAAAGGG - Intergenic
1010007456 6:71011105-71011127 CAAGATGGCCACATAGAAAATGG - Intergenic
1010213008 6:73377290-73377312 CATGCTGCCTACATTTAAAAGGG - Intronic
1010945055 6:81964209-81964231 CATGCTGAACACATTGAAATTGG - Intergenic
1011899039 6:92269262-92269284 CACACTGCTCAAGTAGAAAAAGG - Intergenic
1012123305 6:95394305-95394327 CATGTTGCTACTATAGAAAATGG + Intergenic
1013002740 6:106040721-106040743 CATGTTGTTAACATTGAAAAGGG - Intergenic
1013922800 6:115429016-115429038 CAAGCTGCACTCATATAAAATGG - Intergenic
1014310696 6:119797604-119797626 CAAGCTGCAAACATATAAAATGG - Intergenic
1016104534 6:140145893-140145915 CATGCTGCTGACAAACAGAAGGG + Intergenic
1019083929 6:169456676-169456698 CATGCTGTGCACAGAGACAAAGG + Intergenic
1019160048 6:170063485-170063507 CAGGCTGCTCATGTAGAAAGGGG + Intergenic
1019161704 6:170073051-170073073 CATGCTGCCCTCATAGAATGAGG + Intergenic
1020899020 7:13980198-13980220 CATGCTACTTAAATAGACAAAGG + Intronic
1022911439 7:34902742-34902764 CATGCTGGTTACACAGCAAAAGG + Intergenic
1023283566 7:38595423-38595445 CATGTTTCTCTCATAGATAAAGG + Intronic
1024296664 7:47848976-47848998 CATGCTACTGGCATAGAAATAGG + Intronic
1026541701 7:71285438-71285460 CTTGCAGCTCACATAGCAAGTGG - Intronic
1027379272 7:77588424-77588446 CAAACTGCTCCCATATAAAATGG - Intronic
1027489057 7:78799578-78799600 AATGCAGCTCACACAGAAGAGGG - Intronic
1029923571 7:104292138-104292160 CCTGTTGCTTAAATAGAAAATGG - Intergenic
1030128183 7:106174713-106174735 CATGCTCTTCTCATGGAAAATGG - Intergenic
1033645031 7:143294746-143294768 CAGTCTGGTCACATAGAACATGG - Exonic
1033686397 7:143644800-143644822 CATGCCTAGCACATAGAAAAGGG - Intronic
1033689341 7:143722515-143722537 CATGCCTAGCACATAGAAAAGGG + Intronic
1033698216 7:143812821-143812843 CATGCCTAGCACATAGAAAAGGG + Intergenic
1036253892 8:7188614-7188636 AATGCTGCCCACTTAGAGAAAGG - Intergenic
1036363601 8:8098865-8098887 AATGCTGCCCACTTAGAGAAAGG + Intergenic
1036603954 8:10290035-10290057 CAGGCTGCTCATCTATAAAATGG - Intronic
1037067928 8:14606008-14606030 TATGGTGCTTACATAGAGAAAGG - Intronic
1038458972 8:27700323-27700345 CATGCAGCTCAAATTAAAAATGG + Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040374620 8:46812363-46812385 CATGATACTGGCATAGAAAATGG + Intergenic
1046145674 8:110154914-110154936 TATCCAGCTCACATAGAAAAAGG - Intergenic
1046974719 8:120261764-120261786 CATGGTGCTTACATAGCATAGGG - Intronic
1050826177 9:9949548-9949570 AATGCTACTCACATACCAAAGGG + Intronic
1051130614 9:13856112-13856134 CATGCTCCTTACATAGACACAGG - Intergenic
1052330374 9:27261297-27261319 CATGCTGATCTTATAGAGAAGGG + Intergenic
1052704874 9:31982329-31982351 CAGGCTGGCCACATAGGAAAGGG - Intergenic
1052787871 9:32846578-32846600 CATCTTGCTCACCTATAAAATGG - Intergenic
1053081447 9:35181442-35181464 CATGTTTCTCACCTATAAAATGG + Intronic
1054751113 9:68907220-68907242 AATGGTGCTCACCTAAAAAATGG - Intronic
1055790414 9:79917397-79917419 TATGCTGCTTGCATTGAAAATGG - Intergenic
1056482351 9:87018431-87018453 CATGATGCTCACAGATAAAGGGG - Intergenic
1061281175 9:129598251-129598273 CAGGCTGTTCACCTAAAAAAAGG - Intergenic
1061475230 9:130860880-130860902 AGTGCTGCACACAAAGAAAACGG - Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1188263427 X:28042566-28042588 CATTCTGGTCACAAAAAAAAAGG + Intergenic
1189954941 X:46268319-46268341 CATGCTGCCCATAAATAAAATGG + Intergenic
1189955128 X:46270008-46270030 CTTGCTGCTCACACAGAGCATGG - Intergenic
1190054040 X:47171554-47171576 CATGATGCACACATGCAAAATGG - Intronic
1193488045 X:82111738-82111760 CATGATGCTGGCATAAAAAAAGG - Intergenic
1194881974 X:99264464-99264486 CCTACTGCTCACAGAGAAACAGG - Intergenic
1196261195 X:113583979-113584001 CAAGCAGCTCTCATACAAAAGGG - Intergenic
1197516770 X:127441894-127441916 CAGACTGCTCACAGAGACAAGGG - Intergenic