ID: 936725699

View in Genome Browser
Species Human (GRCh38)
Location 2:115312554-115312576
Sequence AAGAGTGTACATGGCCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936725699_936725701 -5 Left 936725699 2:115312554-115312576 CCATCAAGGCCATGTACACTCTT 0: 1
1: 0
2: 0
3: 17
4: 129
Right 936725701 2:115312572-115312594 CTCTTGATTTTGCGTGTGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 119
936725699_936725702 11 Left 936725699 2:115312554-115312576 CCATCAAGGCCATGTACACTCTT 0: 1
1: 0
2: 0
3: 17
4: 129
Right 936725702 2:115312588-115312610 TGTCTGGCTGTGTACGTCTGTGG 0: 1
1: 0
2: 0
3: 18
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936725699 Original CRISPR AAGAGTGTACATGGCCTTGA TGG (reversed) Intronic
900666466 1:3818580-3818602 AAGAGTGGGCATGGCCTGGCGGG - Intronic
903361650 1:22780836-22780858 AAGGGTGGACTTGGCCTGGAGGG + Intronic
903656856 1:24954841-24954863 CAGTGTAGACATGGCCTTGAGGG - Intronic
906481935 1:46204702-46204724 AAGTGTGCACTTGGCCTTGAAGG + Intronic
907409568 1:54274728-54274750 AAGAGGTTCCATGGCCTGGAGGG - Intronic
908392364 1:63695372-63695394 AAGAGTGTACAAGGCACTCATGG - Intergenic
915837099 1:159186249-159186271 CAGACTGTACAGGACCTTGAAGG + Intronic
919993030 1:202722130-202722152 AAGAGGATACATGGCCCTTATGG + Intergenic
921639435 1:217534450-217534472 ATTAGTGAGCATGGCCTTGATGG + Intronic
923332233 1:232935711-232935733 AAGAGAGGAAATGGACTTGAAGG + Intergenic
1065601959 10:27378124-27378146 AAGAGTCTTCTTGACCTTGATGG - Intergenic
1065650889 10:27889955-27889977 AAGAGAGTATATGGACTTGAGGG + Intronic
1075280817 10:121136625-121136647 AAGTGTAGACATGGCCTTGGAGG - Intergenic
1075930987 10:126295704-126295726 AAGAGTGTGCATGGTTTTCATGG - Intronic
1078112996 11:8414861-8414883 AAGAGCCTACATTTCCTTGAAGG + Intronic
1083132880 11:60642774-60642796 AAATGTGTTTATGGCCTTGATGG - Intergenic
1086308479 11:85508329-85508351 AGGAGTGTACATGGTGTAGATGG - Intronic
1088501356 11:110486628-110486650 AAGAGTGTCCATGGACATTAGGG - Intergenic
1088505315 11:110521792-110521814 AAGTGTGGACAGGGCCTGGATGG + Intergenic
1089803125 11:121054699-121054721 AGAAGAATACATGGCCTTGAAGG - Intronic
1091061101 11:132462942-132462964 CAGAGTGGTCATGGCCTTGTTGG - Intronic
1091763902 12:3105684-3105706 AGGAGTGTACATGCCCCTGGGGG + Intronic
1092992145 12:13913124-13913146 CAGAGTCCACATGGCCTGGATGG + Intronic
1093828859 12:23730441-23730463 AAAAGTGGACATGTTCTTGAGGG + Intronic
1096599847 12:52721586-52721608 CAGAGTCTCCATGGCCTTGGGGG - Intergenic
1096684540 12:53279189-53279211 AAGAATGTACATGGCCTTATAGG - Intronic
1100881285 12:99019377-99019399 AAGAGGATACAGGGCATTGAGGG + Intronic
1101255778 12:102975084-102975106 AAGATTCTGCCTGGCCTTGATGG - Intergenic
1107114427 13:36731498-36731520 AAGAGTGCTGATGGCCATGAAGG - Intergenic
1119381628 14:74232910-74232932 CAGAGAGCACATGACCTTGAGGG - Intergenic
1121266215 14:92604165-92604187 AAGAGTGGGCATGGCCCTGAAGG + Intronic
1122752087 14:103944183-103944205 AAGACTGTAGAGGGCCTTGAAGG - Intronic
1126961203 15:53996617-53996639 AAGAGTGGAGATTGACTTGAAGG - Intergenic
1127888893 15:63229908-63229930 ATGAGTGTAATTGGCCATGAAGG + Intronic
1127954249 15:63838943-63838965 AAGCGTGTCCATGCCCTTTAGGG + Intergenic
1127979897 15:64026751-64026773 TAGAGTATACATGTCCTTAAGGG - Intronic
1132362040 15:101224493-101224515 AAGAGTATAAATGGCAATGACGG + Intronic
1132645962 16:999410-999432 GACAGTGACCATGGCCTTGAAGG - Intergenic
1134250413 16:12570110-12570132 AAGATTGTTCATGGCCTTTAAGG + Exonic
1135435539 16:22424619-22424641 GGGAGTGTGTATGGCCTTGAAGG - Intronic
1138337723 16:56266375-56266397 AAGAGTGTAGAGGCCCCTGATGG - Intronic
1139038533 16:62976852-62976874 GGGAGTGAAGATGGCCTTGAGGG - Intergenic
1139556928 16:67718471-67718493 AAGAGTGGACAGGGACATGAGGG - Intronic
1140824393 16:78692382-78692404 CAAAGTGTACATTGCCTTTAAGG + Intronic
1143314633 17:6022966-6022988 AAGAGTATACAGGGCCTTTTAGG - Intronic
1143525313 17:7468480-7468502 AAGAGTCTTCAAGGCCCTGATGG - Intronic
1143960039 17:10709359-10709381 AAGAGTGTAGATGACATTTAAGG + Intronic
1146146509 17:30423061-30423083 AATATTGAACATGGCTTTGAGGG - Intronic
1147395768 17:40141207-40141229 GAGAGTGAAGATGGCATTGAAGG + Exonic
1154066729 18:11113525-11113547 AGGAGTGAACAAGGCCGTGAGGG - Intronic
1157100124 18:44721754-44721776 AAGAATGCATATGGCCATGAGGG + Intronic
1157229935 18:45906334-45906356 AAAAGTATACATGGCCCTTAGGG + Intronic
1160197887 18:76771804-76771826 AAGAGAGTTCAGGGCCTTCAAGG + Intergenic
1162929825 19:13952362-13952384 AAGAGTCGAGATGGCTTTGATGG + Intronic
1163718624 19:18886959-18886981 TTGTGTGTACATGGCCTTCAGGG - Intronic
1164478324 19:28592169-28592191 AGGAGTGTGCATGTCCTTGTAGG - Intergenic
1166008989 19:39927295-39927317 AAGAGTGTACCAGGCTGTGAGGG - Exonic
1166337490 19:42117147-42117169 GAGAGTGGCCATGGCCTTGGTGG + Intronic
1167021020 19:46876048-46876070 AAGAGTTTAAAGGGCCTTGTCGG - Intergenic
926313578 2:11693147-11693169 ACGACTGTACCTGGCCTTGCTGG - Intronic
929712271 2:44277455-44277477 AAGAGTGTATCTGTCCTTCATGG + Intronic
934777197 2:96947008-96947030 AAGAAAGCACATGGCCCTGAAGG - Intronic
935458108 2:103293968-103293990 AAGTGTGTACATGGATTTCATGG + Intergenic
936398041 2:112143904-112143926 AAAAGAGTACATGGCCTTTTGGG + Intronic
936631006 2:114202630-114202652 AAAAGTGAACAGGGCCTTAAGGG - Intergenic
936725699 2:115312554-115312576 AAGAGTGTACATGGCCTTGATGG - Intronic
937766442 2:125666083-125666105 CAGAGTGTACATTTCCGTGAAGG - Intergenic
938594465 2:132773291-132773313 AAAATTGTACATAACCTTGAAGG - Intronic
939399129 2:141668678-141668700 CAGATTATACATGGACTTGAAGG - Intronic
941273902 2:163465951-163465973 AAGAGTCCACATTGCCTTAAAGG - Intergenic
946968958 2:225070535-225070557 ATGAGTGAACCTGGACTTGATGG + Intergenic
947679589 2:232017930-232017952 TAGACTGTTCATGTCCTTGATGG + Intronic
948022148 2:234743242-234743264 AAGAGTGTTCATCAGCTTGAAGG - Intergenic
948282642 2:236759826-236759848 AAAAGTGTTCATGGCCATCATGG + Intergenic
1168734212 20:116013-116035 GACAGTGTGCATGGCCCTGAAGG - Intergenic
1169778126 20:9278385-9278407 AAGAGTGTACATTGCTTAGATGG + Intronic
1170319388 20:15078590-15078612 AAGAATACACATGGCCTGGAAGG - Intronic
1172100180 20:32480564-32480586 AAGAATGTCCAGGGCCTGGAAGG - Intronic
1172460599 20:35115566-35115588 AAGAGTGTTCCTGGCCTTGCTGG + Exonic
1173530739 20:43767369-43767391 ACGTGTGTGCATGGCCTTGTTGG + Intergenic
1174201341 20:48808690-48808712 CAGATTGCACAGGGCCTTGAGGG - Intronic
1175232135 20:57480719-57480741 CAGAGTGTACAGGGCCGTGCAGG - Intergenic
1175733711 20:61371273-61371295 AAGAGGGCAAATGGCCCTGATGG - Intronic
1176897473 21:14398534-14398556 AAAAGTCTACATGGCATTGGTGG - Intergenic
1177404816 21:20651988-20652010 AACATTTTTCATGGCCTTGATGG - Intergenic
1179533832 21:42038679-42038701 CAGAGTGTAGAAGGCCGTGAGGG - Intergenic
1180148661 21:45936331-45936353 TAGAGTGCACATTGCCATGAGGG - Intronic
1181547382 22:23609793-23609815 AGGAGTATTCATGGCCTTGAGGG - Intronic
1182810853 22:33115466-33115488 AAGAATCTACAAGGCCATGAAGG + Intergenic
951761583 3:26153153-26153175 AAGAGGGTACATGGTCTGGAGGG + Intergenic
953096596 3:39782891-39782913 AAGAGTCTGTAGGGCCTTGAGGG - Intergenic
953923004 3:46965166-46965188 AAGAATTTGCATGGTCTTGATGG - Intronic
954097722 3:48343057-48343079 GAGAGTGTACATGGATTTTAGGG - Intergenic
955223138 3:57039587-57039609 ATGGGTCTACATGGCCTTGCAGG + Intronic
956841838 3:73147353-73147375 AAGACTTTAAATGGCCTTCATGG - Intergenic
959420955 3:106127710-106127732 AAGTTTCTCCATGGCCTTGAGGG - Intergenic
960455255 3:117863366-117863388 CAGAGTGAACATAACCTTGAAGG + Intergenic
961433953 3:126903452-126903474 AAGATTGTACAGGGTCTTGATGG - Intronic
963857191 3:150266962-150266984 TAGAATGTACATGCCCATGAAGG - Intergenic
965232846 3:166075192-166075214 CAAAGTGTAGATGGCTTTGAAGG - Intergenic
965715967 3:171603343-171603365 AAGCGAGCACATGGCCTTTATGG + Intronic
966809152 3:183827986-183828008 CAGGGAGTGCATGGCCTTGAAGG + Intergenic
972938736 4:44171120-44171142 AAGAGTGTTCAAGGCCCTGAAGG - Intergenic
974074115 4:57153336-57153358 TAGAGTGTCCAGGGCCATGAAGG + Intergenic
982026988 4:151260799-151260821 TAGAGTATGCAAGGCCTTGAGGG - Intronic
988748011 5:34163117-34163139 AAGCGTGTACATGTCTTTAAAGG - Intergenic
991100962 5:62792667-62792689 AACAGTGTACATGTCATTTATGG - Intergenic
991483158 5:67105480-67105502 AAGAGTATAGAAGGCCTAGAGGG - Intronic
992744589 5:79806638-79806660 AAGATTTTACTTGGCCTTCAAGG - Intergenic
994309997 5:98258883-98258905 AAGAGAGCACATTGCCTGGAAGG - Intergenic
997894225 5:137701710-137701732 AAGAGTGACCAAGTCCTTGATGG - Intronic
1000012629 5:157246885-157246907 AAAAGTGCAAATGGCCATGAAGG + Intronic
1002123158 5:177021616-177021638 CAGATTGTACAGGGCCTTGTTGG + Intronic
1002225539 5:177720119-177720141 AAAAGTATGCATGGCTTTGAAGG - Intronic
1002268310 5:178051086-178051108 AAAAGTATGCATGGCTTTGAAGG + Intronic
1003528665 6:6919824-6919846 AGGAGTTAACATGGCCTTGGCGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1008301298 6:49843763-49843785 AAAAGTGTAGATTGCCTTGAGGG + Intronic
1010177660 6:73048446-73048468 CAGAGGCTACATGGCCTTCAGGG - Intronic
1016704664 6:147092569-147092591 AAGAGTGCACACAGCCTTTAGGG + Intergenic
1021177190 7:17462566-17462588 AAGAGTATTCATGGCCTTGGTGG + Intergenic
1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG + Intronic
1025176831 7:56806345-56806367 AGGGGTGTACACAGCCTTGACGG + Intergenic
1034359042 7:150477867-150477889 AAGCGGGTTCATGGCTTTGAGGG + Exonic
1035817767 8:2559841-2559863 AAAAGTGGACATGACCATGAAGG + Intergenic
1036062859 8:5344188-5344210 AAGAAAATACATAGCCTTGAAGG + Intergenic
1036112865 8:5924025-5924047 AAAAATGCACATGGCCTTAAAGG + Intergenic
1037084507 8:14831130-14831152 AAAAGTGTATATGTCCATGATGG + Intronic
1040453358 8:47571128-47571150 AAGGGTGTACCAGGGCTTGAGGG + Intronic
1043037119 8:75212052-75212074 AAGAGGTTACATGGCCATGAGGG - Intergenic
1044469356 8:92548205-92548227 AAAAGTGTTCATATCCTTGAAGG + Intergenic
1045873263 8:106949769-106949791 AATATTGTACATCCCCTTGATGG + Intergenic
1046058675 8:109109825-109109847 AAGAAAGTACAAGGCTTTGAGGG + Intronic
1046081813 8:109378751-109378773 AAGAATGTACATGGGCTTCTGGG + Intronic
1049244600 8:141555488-141555510 AAGAGTGTGCATGGCATTGGAGG + Intergenic
1051930283 9:22376887-22376909 AAGAGCAAACATGGTCTTGATGG + Intergenic
1055570649 9:77613587-77613609 AAGAATGTTTTTGGCCTTGATGG + Intronic
1056329349 9:85509048-85509070 AAGAGCCTACATGGCCTTGCAGG + Intergenic
1056589476 9:87954303-87954325 AAGAGTGGCCATGGCCTGGGAGG - Intergenic
1058202254 9:102058850-102058872 AAGAGTTCACATGGCATCGATGG + Intergenic
1058889003 9:109344911-109344933 AAGATTGTGCATGGGTTTGAAGG + Intergenic
1059141575 9:111857882-111857904 AAGAGTGTCCCTTACCTTGAAGG - Intergenic
1060738731 9:126083580-126083602 AGGAGTGTACAATGCCTTGCAGG + Intergenic
1194720165 X:97330881-97330903 AAGAATCTACATGTCCTTCAAGG - Intronic
1198077112 X:133204422-133204444 AAAATTGAACCTGGCCTTGAAGG + Intergenic
1200043775 X:153388727-153388749 CAGAGTGTACTGGGCTTTGAGGG + Intergenic
1202075797 Y:21036991-21037013 AAGAGTCAACTTGGCCTTGGAGG + Intergenic