ID: 936726564

View in Genome Browser
Species Human (GRCh38)
Location 2:115324987-115325009
Sequence TCTTATGTGGTCATGGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 4, 2: 35, 3: 108, 4: 407}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936726564 Original CRISPR TCTTATGTGGTCATGGTTCA TGG Intronic
902165433 1:14567314-14567336 TCTTATATTGTTGTGGTTCATGG + Intergenic
902674956 1:18002265-18002287 TATTAAGTGGTCATGGCTCAGGG + Intergenic
904665409 1:32116956-32116978 TCTTATATGACCATGGCTCATGG + Intronic
904862958 1:33553373-33553395 TTTTATGTGTGCATGGTTCATGG - Intronic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
906594130 1:47058712-47058734 ACTTATGTGGTTCTGGTGCAGGG - Intergenic
906949696 1:50324140-50324162 CCTTGTGTGGTGAGGGTTCAGGG + Intergenic
907610360 1:55863582-55863604 TCTTATATGGGCACAGTTCATGG - Intergenic
908222152 1:62018123-62018145 TCTTATTTGCTTATGTTTCATGG + Intronic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909189098 1:72529811-72529833 TCTTATATGGCTATGTTTCATGG - Intergenic
909220357 1:72951435-72951457 TCTTATATGGCCACAGTTCATGG + Intergenic
909464105 1:75953531-75953553 TGTTATCTTGTCATGCTTCAAGG + Intergenic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
910018667 1:82557808-82557830 TCTTATATGGGCATCGTTCTTGG - Intergenic
910078458 1:83309255-83309277 TCTTATGTGAGCATGGTTTGTGG + Intergenic
910231755 1:84995099-84995121 TCTTATATGGGCACAGTTCATGG + Intronic
910918322 1:92315305-92315327 TTTTATGTGGGCTTGGTTCATGG + Intronic
910983387 1:92980839-92980861 TCTTATATGGGTACGGTTCATGG - Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
911955758 1:104232895-104232917 ACTTATATGGGCATAGTTCATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
913097576 1:115534173-115534195 TCTTATCTTGTCATGCTTCAAGG + Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
913381848 1:118220020-118220042 TCCTCTGTGGTGAAGGTTCAGGG - Intergenic
915666353 1:157448748-157448770 TATTATTTTGTCATGCTTCAAGG + Intergenic
916002871 1:160633485-160633507 TCCCAGGTGGTCATGGTTGAGGG - Intronic
916839923 1:168589108-168589130 TTTAATGTGGACATGTTTCAAGG - Intergenic
916988212 1:170214290-170214312 TCTTAAGGGGTCAGGGCTCAGGG + Intergenic
918386200 1:184010645-184010667 TGTTCTTTGGTCATGGTTCTAGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
919033976 1:192282278-192282300 TCTTATATGAGTATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919147485 1:193654379-193654401 TCCTATTTGGTCATTTTTCATGG + Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
919487887 1:198166688-198166710 TTTTATTTGGACATGATTCATGG + Intronic
921745562 1:218736603-218736625 TCTTATGTGGTATTCTTTCAAGG + Intergenic
921761546 1:218921034-218921056 TCTGATGTGGGCACAGTTCATGG + Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
924079183 1:240375143-240375165 TCTTATGTGGGCATAGTTTGTGG + Intronic
924499861 1:244627216-244627238 TCTTATATGGTCGCAGTTCATGG + Intronic
1063337639 10:5231808-5231830 TGTTATCTGGTCACAGTTCATGG + Intergenic
1063598399 10:7458267-7458289 TTTAACATGGTCATGGTTCACGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1063979033 10:11439026-11439048 TGTTATCTTGTCATGCTTCAAGG + Intergenic
1064276211 10:13907558-13907580 TCTTATTTGTTGAGGGTTCAAGG + Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1064851426 10:19713315-19713337 TCTTATCTGGATATGGTTCCAGG - Intronic
1064868622 10:19911146-19911168 TATTATATGGTCTTGGATCAAGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1065413699 10:25460975-25460997 TCTTATGTGGGTGCGGTTCATGG - Intronic
1065563046 10:26982569-26982591 TCTTAGGTGGTCTTGTCTCATGG + Intergenic
1065699957 10:28415260-28415282 TCTTATATGGTATTGATTCATGG - Intergenic
1067548119 10:47211131-47211153 TCTTGTGTGGGCATGGTTCCTGG - Intergenic
1067606367 10:47667172-47667194 TCTTATGTCTTCCTGTTTCATGG + Intergenic
1067696559 10:48540091-48540113 TCCTGTGGGGTCATGGTTAAGGG - Intronic
1070049551 10:72874166-72874188 TCAAATGTGTACATGGTTCAGGG + Intronic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071054006 10:81487713-81487735 TCTAATATGGTCATGGTTCATGG - Intergenic
1071074116 10:81730922-81730944 TGTTATCTTGTCATGCTTCAAGG + Intergenic
1071621928 10:87128525-87128547 TCTTATGTCTTCCTGTTTCATGG + Intronic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1075490729 10:122866682-122866704 TGTTATAGGGTCATGATTCATGG - Intronic
1075643474 10:124082155-124082177 TTTTATGTGATTATGGGTCAAGG - Intronic
1075751302 10:124773673-124773695 TCTTACGTGGGCACAGTTCATGG + Intronic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1079012864 11:16844024-16844046 TCTTGTGTGATCATGGTCCAGGG - Intronic
1079093057 11:17494177-17494199 CCTTATCTGGCCCTGGTTCAGGG + Intronic
1079187182 11:18248199-18248221 TCTTATGCAGTCAGGCTTCAGGG - Intronic
1079189619 11:18266678-18266700 TCTTATGCAGTCAGGCTTCAGGG + Intronic
1079345933 11:19652322-19652344 TCTTGTGGGGTCCTGGGTCAAGG + Intronic
1079540097 11:21562919-21562941 TCATCTGTGGACATGTTTCAAGG - Intronic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1079832449 11:25285333-25285355 TCTTATAAAGTCATGGTTCATGG + Intergenic
1080656865 11:34265177-34265199 TCTTATATGCTCAGGCTTCAAGG - Intronic
1081186357 11:40047140-40047162 TCTTATATGGACACAGTTCATGG + Intergenic
1081212083 11:40348061-40348083 TGTTATATGGGCATGGATCACGG + Intronic
1081978924 11:47254174-47254196 TCGTATGTGGTCCTGGGTCCTGG + Intronic
1083487869 11:62994959-62994981 TCTGACGTGGGCATGGTCCAGGG + Intronic
1084059263 11:66659207-66659229 TCTTCTGTGCTCAAGATTCAGGG + Intronic
1086494948 11:87393293-87393315 TCTTATATGAGCCTGGTTCATGG - Intergenic
1086999283 11:93397297-93397319 TCTTCTTTGGGCATGGTTAATGG + Intronic
1087577510 11:100008085-100008107 TCTTCTATGGGCATAGTTCATGG + Intronic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1087804233 11:102538663-102538685 TCTCATGTGGTTATGGCTGAGGG + Intergenic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088439704 11:109856169-109856191 TCTTATGTGGGCATGATTCGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1091127035 11:133109659-133109681 TCTTTTGGGGTCATGGTGAAAGG - Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091726399 12:2849345-2849367 CCTTATGAGGTCCTGGCTCAGGG + Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1093910649 12:24743190-24743212 TCTTGTGTGGTTATGGCTCATGG + Intergenic
1094442657 12:30496052-30496074 CCTTATGTGGGCATAGTGCAAGG + Intergenic
1094626868 12:32132643-32132665 TCTTTTGGGGTCCTGGTTGAAGG - Intronic
1095466960 12:42497584-42497606 TCTTATATGGGCACAGTTCATGG + Intronic
1097453281 12:59763858-59763880 TCTTATATGGGCACAGTTCATGG - Intronic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1104395713 12:128430786-128430808 TCTTATATGGGCACAGTTCATGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1104812812 12:131628742-131628764 TATTCTGTGGCCATGGTTCTGGG - Intergenic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107397913 13:40037365-40037387 TTTTATGTGGTGATGGTGAAAGG + Intergenic
1107898026 13:44985659-44985681 TCTTATATGGCCACGATTCATGG - Intronic
1108397646 13:50005772-50005794 TCTTGTGCGATCATGGCTCACGG + Intronic
1109080499 13:57893725-57893747 TCTTATATGGGCACAGTTCATGG - Intergenic
1109389335 13:61671862-61671884 CCTTATCTTGTCATGCTTCAAGG - Intergenic
1109408662 13:61936024-61936046 TCATATGTTGTCATGCTTCTGGG + Intergenic
1109953251 13:69530410-69530432 TTTTATATGGTCATGGTTTGTGG - Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110300792 13:73924480-73924502 TCTTCTATGGGCAGGGTTCATGG - Intronic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111839941 13:93437102-93437124 TTTTATATGGGCATGATTCATGG - Intronic
1112521143 13:100096344-100096366 ACTTATATGGGCGTGGTTCACGG - Intronic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1112978902 13:105356679-105356701 TCTTCTAAGGTCATGGTTCATGG - Intergenic
1113057153 13:106281200-106281222 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113737338 13:112688528-112688550 TGCGGTGTGGTCATGGTTCAAGG + Intergenic
1115013124 14:28574505-28574527 TCTCATATGGACATGGTTTATGG + Intergenic
1115096002 14:29636449-29636471 TCTGATGTGGTCATGGAAGAAGG - Exonic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1121018751 14:90565903-90565925 TCTTATATGGGTGTGGTTCATGG + Intronic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122470593 14:101963645-101963667 TCTTATGTAGTCATGGTGTAGGG + Intergenic
1122993873 14:105252071-105252093 TCTTGTGTGGACAAGGTTTAAGG - Intronic
1124639254 15:31385629-31385651 TCTTATATGGAAGTGGTTCATGG - Intronic
1124950328 15:34312929-34312951 TCTTCTGTGGGCACAGTTCATGG - Intronic
1126943848 15:53795204-53795226 TCTTATCTGTTCATGGCTCCAGG + Intergenic
1127039871 15:54962858-54962880 GCTTGTGAGGTCCTGGTTCAGGG - Intergenic
1128969476 15:72094894-72094916 TCTTATATGGTCATGATTTTTGG - Intronic
1129499290 15:76020106-76020128 TCTTACACAGTCATGGTTCATGG - Intronic
1129827343 15:78642372-78642394 TCTTTTCTGGTTTTGGTTCATGG - Intronic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1130781975 15:87049422-87049444 TCTTATGTGGGCATGAGTGATGG + Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1133562114 16:6960039-6960061 TATTATCTTGTCATGTTTCAAGG - Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1136689446 16:32018394-32018416 TGTCAAGTGGTCAGGGTTCAGGG + Intergenic
1136790038 16:32961936-32961958 TGTCAAGTGGTCAGGGTTCAGGG + Intergenic
1136879774 16:33892000-33892022 TGTCAAGTGGTCAGGGTTCAGGG - Intergenic
1138836012 16:60435516-60435538 TCTTATATGGGCATGTTTCCTGG - Intergenic
1139698622 16:68693399-68693421 TCAGAGGTGGTCATGTTTCAAGG + Intronic
1139809519 16:69601850-69601872 TCTTCTGCTGTCATGTTTCAAGG + Intronic
1140574681 16:76152798-76152820 TCTTATATGGGCATAGTACATGG + Intergenic
1141349636 16:83282168-83282190 TCTTCTGCGGACATGGCTCATGG + Intronic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1203092241 16_KI270728v1_random:1223399-1223421 TGTCAAGTGGTCAGGGTTCAGGG + Intergenic
1142908774 17:3069205-3069227 TCTTATGTGGGTGTGGTCCATGG + Intergenic
1142925792 17:3235040-3235062 TCTTATGTGGGTGTGGTCCATGG - Intergenic
1146042985 17:29474624-29474646 TCTTATATGGGCACAGTTCATGG + Intronic
1146115510 17:30134218-30134240 TTTTATCTGGGCATGGTACATGG + Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1149177182 17:53886717-53886739 TTTTATATGGGCCTGGTTCATGG + Intergenic
1149378112 17:56065721-56065743 TCTCATATAGTGATGGTTCATGG + Intergenic
1152194265 17:78907488-78907510 TCTCATGTGGGCACAGTTCATGG + Intronic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1153784971 18:8526304-8526326 TCTCAGGTGGTCATGGCTCCTGG + Intergenic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1156110625 18:33722035-33722057 TCTTATGAGGGCATGGTTTGTGG - Intronic
1156128310 18:33935493-33935515 TCTTAATTTGGCATGGTTCACGG + Intronic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1158250638 18:55483584-55483606 TCTTATATGGTCATTGTAAAGGG + Intronic
1159180607 18:64897869-64897891 TTTTATATGGTCATGATTCATGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160552051 18:79700024-79700046 TCTTATGTGGGTGTGGTTCGTGG - Intronic
1164508745 19:28880631-28880653 TCATGTGTGGTGAGGGTTCAAGG - Intergenic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
1168337441 19:55604643-55604665 TCTGAGGTGGGCGTGGTTCAGGG + Intergenic
925030716 2:648315-648337 CCTTATGTGGGCAGCGTTCACGG - Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
926057467 2:9782764-9782786 TCTTATATGGGCACGATTCATGG - Intergenic
927322550 2:21764284-21764306 TCTTATATGGATGTGGTTCATGG + Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
928898068 2:36287835-36287857 TCCTCTGTGGTCATCGATCAAGG - Intergenic
930535407 2:52639588-52639610 TCTTATGCAGTCATGTGTCAAGG - Intergenic
931407941 2:61998913-61998935 TCTTCTATGGGCATGTTTCATGG + Intronic
931960957 2:67482364-67482386 TCTTATATGAGCATTGTTCATGG - Intergenic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
933548935 2:83749566-83749588 TCTTATTTAGGCATGATTCATGG - Intergenic
933626734 2:84609587-84609609 TCTTATATAAGCATGGTTCATGG + Intronic
933896809 2:86818576-86818598 TCATAAATGGGCATGGTTCATGG - Intronic
934058968 2:88276370-88276392 TCTCAAGTGGGCATGGTTCATGG - Intergenic
934869250 2:97846219-97846241 CTTTATGTGGTCCTGATTCAGGG - Intronic
935796917 2:106651498-106651520 TCTTATATGGCTGTGGTTCACGG + Intergenic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
938581584 2:132651407-132651429 GCTTATGGGGTCCTGGTTAAAGG - Intronic
939728381 2:145752024-145752046 TCTTATGTGGGCATGGAAGAGGG - Intergenic
939867783 2:147493638-147493660 TCTTATGTGGGCACGGTTTGTGG - Intergenic
940037474 2:149325967-149325989 TCTTATCTGGACACGGTCCATGG + Intergenic
940608429 2:155958692-155958714 TCTTATATGGATGTGGTTCATGG - Intergenic
940756653 2:157690574-157690596 CCTTAGATGGGCATGGTTCATGG + Intergenic
941974558 2:171388884-171388906 TTTTATATGGATATGGTTCATGG - Intronic
942203786 2:173599358-173599380 TGTTATGAGGTGATGGCTCAGGG + Intergenic
942921046 2:181374102-181374124 TTTTCTGTGGGCAAGGTTCAGGG - Intergenic
943292817 2:186096942-186096964 TCTTATGCGGGTATGCTTCATGG - Intergenic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
943982653 2:194574678-194574700 TCTTCTGTGGTCATGGGACAGGG - Intergenic
944079611 2:195772004-195772026 TCTTGTGTGGAGATGGATCATGG - Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944273949 2:197814388-197814410 TATTATATGGGCATAGTTCATGG - Intronic
944449293 2:199824779-199824801 TCTTATGTGGTTGTGATTCGTGG + Intronic
944529565 2:200653914-200653936 TCTTATATGGATGTGGTTCATGG - Intronic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
944879501 2:203997548-203997570 TCTGAAGTGGCCTTGGTTCAGGG + Intergenic
945189317 2:207169809-207169831 TCTTATTTGGGCACAGTTCATGG - Intergenic
945346116 2:208718777-208718799 TCTTATATGGGCACAGTTCATGG + Intronic
946039297 2:216770040-216770062 TCTTAGGGGGTGATGGTTCTGGG + Intergenic
946086333 2:217176952-217176974 TCCTATATGGGTATGGTTCATGG + Intergenic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947234603 2:227926943-227926965 TTTTATATGGGCATGATTCATGG - Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169019142 20:2315693-2315715 TCTTTTGTAGTCAAGGGTCAGGG - Intronic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1170247075 20:14233103-14233125 TCTTATATGGGTGTGGTTCATGG + Intronic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1171236695 20:23532856-23532878 ACTTATATGGTCATGGTTCTTGG + Intergenic
1171406234 20:24914002-24914024 TGTTATTTTGTCATGCTTCAAGG - Intergenic
1172236360 20:33378347-33378369 TCTTATGTGGGTGTGGCTCATGG + Intronic
1172382938 20:34512020-34512042 TGTTATCTTGTCATGCTTCAAGG + Intergenic
1173077421 20:39832820-39832842 TCTTAGGTGGGCATGTTCCATGG + Intergenic
1173707368 20:45121794-45121816 TCTTATGTGGGCACAGTTTATGG + Intergenic
1173910714 20:46667964-46667986 TCTTATATGGGCACAGTTCATGG - Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1175458213 20:59131083-59131105 TCTTTTGTGGGCAAGGTTGAAGG + Intergenic
1176702523 21:10072678-10072700 TCTTATATGGATGTGGTTCATGG + Intergenic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1179283339 21:39953723-39953745 TGTTATCTTGTCATGCTTCAAGG + Intergenic
1179429190 21:41307762-41307784 TCTTCTGTGGACACTGTTCATGG + Intronic
1180113274 21:45676577-45676599 TCTTATATGGGCAAAGTTCATGG - Intronic
1180848870 22:19000846-19000868 TCTTATATGGGCACAGTTCATGG + Intergenic
1180932590 22:19603296-19603318 TCTTATACGGGCATGGTTCCGGG + Intergenic
1181664064 22:24378758-24378780 TCTTATATGGGCACAGTTCATGG + Intronic
1182734596 22:32523199-32523221 TCTTATATGGGTGTGGTTCATGG - Intronic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1183267992 22:36841697-36841719 TCTTACATAGTCATGGCTCATGG - Intergenic
1184575247 22:45358840-45358862 TCTTATATGGGAGTGGTTCATGG + Intronic
1185177995 22:49341185-49341207 TCTTATGTGGTCATAGTACATGG - Intergenic
949391726 3:3569827-3569849 TCTTATGTGAGCGTGATTCATGG - Intergenic
949438374 3:4053276-4053298 TCTTTTATGGACATGGTTCGTGG + Intronic
951042969 3:18008527-18008549 TCTTATGTGGACACAGCTCATGG + Intronic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955925074 3:63996404-63996426 TTTCATGTGGACATTGTTCACGG - Exonic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956406827 3:68936640-68936662 TCTTACGTGGACATGTTGCATGG - Intergenic
956706827 3:72006277-72006299 TGTTATATTGTCATGCTTCAAGG - Intergenic
957175409 3:76802016-76802038 TCTTATGTGAGCAGGGTCCATGG + Intronic
957764613 3:84606711-84606733 TCTTTTCTGCTCATGGTTTAGGG - Intergenic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959721704 3:109498103-109498125 TCTCATATGGGCCTGGTTCATGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
961473604 3:127133860-127133882 TTTTATCTGGACATGGTTGAAGG - Intergenic
961962213 3:130867069-130867091 TCTAATGCGGGCATGATTCAGGG - Intronic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962544147 3:136414990-136415012 TCTTATGTGGGTACAGTTCATGG + Intronic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
962991406 3:140580686-140580708 GCTTATTTGTTCATGGTTAAAGG - Intergenic
963054018 3:141169165-141169187 TCTTATATGGGTGTGGTTCATGG - Intergenic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963584507 3:147167557-147167579 TCTTATGTGGGCACAATTCATGG + Intergenic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964452833 3:156828048-156828070 GCTTATGTTGACATGGTTAATGG + Intronic
964617009 3:158677156-158677178 TCTTATATGGGCAGGTTTCATGG - Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964870389 3:161307453-161307475 TCTTATACGGTCACAGTTCATGG - Intergenic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965224176 3:165966599-165966621 TCTTATGTGAGCATGGTTTGTGG - Intergenic
965998771 3:174920979-174921001 TCTCACATGGTCATGGTCCATGG + Intronic
966214336 3:177486490-177486512 TCTTATATGGGCACAGTTCATGG + Intergenic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967545273 3:190718373-190718395 TCTTATATGGGTGTGGTTCATGG + Intergenic
967571699 3:191036860-191036882 TCTTATATGAGCATGGTTCTTGG - Intergenic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
969195694 4:5562110-5562132 TGTTATGTGTCCATGGATCAAGG + Intronic
969780572 4:9399333-9399355 TCTTTTCTGGTCATAGTTGATGG - Intergenic
970394615 4:15654375-15654397 ACTTTTGTGGAGATGGTTCAGGG - Intronic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970724146 4:19023959-19023981 TCTTATGTGGCTGTGGTTCGCGG - Intergenic
971164191 4:24165722-24165744 TCTTATATGGTAATGGATCATGG - Intergenic
971261382 4:25059927-25059949 TATTATCTTGTCATGCTTCAAGG + Intergenic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
973737749 4:53889176-53889198 CCTTATGTGGACATGGGACATGG - Intronic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
975046735 4:69814317-69814339 CCTTATCTTGTCATGCTTCAAGG - Intronic
975124923 4:70771038-70771060 TCTTATATGGGCGTAGTTCATGG + Intronic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
975478282 4:74847931-74847953 TCTTATATAGGCATGATTCATGG - Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977877164 4:102163576-102163598 TGTTATCTTGTCATGCTTCAAGG + Intergenic
977877209 4:102163950-102163972 TGTTATCTTGTCATGCTTCAAGG + Intergenic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978102852 4:104863840-104863862 CCTTATTTGGCCATGGTTCATGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979973817 4:127170791-127170813 TCTTATGTGGACACAATTCATGG - Intergenic
980065397 4:128182481-128182503 TCTTATCCTGGCATGGTTCATGG - Intronic
980581183 4:134753694-134753716 TCCTATGTGTTCATTTTTCATGG - Intergenic
981464422 4:145051307-145051329 TATTATATGAGCATGGTTCATGG + Intronic
981489022 4:145320316-145320338 TCCTTTTTGGTCATAGTTCACGG - Intergenic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982575694 4:157107093-157107115 TCTTATGTGGGCATGATTTGTGG - Intronic
983041632 4:162935130-162935152 TCTGATGTGGTTTTTGTTCACGG - Intergenic
983058260 4:163125048-163125070 TATTATATGGGCATAGTTCATGG - Intronic
983124686 4:163936145-163936167 TCTTATGTAGGCATGATTCCGGG + Intronic
983154767 4:164333530-164333552 TCTTATGTGGGCACAGTTCATGG - Intronic
983275917 4:165617277-165617299 TCTTATATGGGTGTGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
983764421 4:171459958-171459980 TCTTATATGGACCTGGTTAATGG + Intergenic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984461079 4:180037612-180037634 TCTTATATGGTCACAGTTCTTGG - Intergenic
984637143 4:182123601-182123623 TCTTATATAGGCATGGCTCATGG + Intergenic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987726654 5:21709324-21709346 TCTTATATGGGCACAGTTCATGG - Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988882188 5:35515740-35515762 TCATATGTTGTCATGCTTCCAGG - Intergenic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
989762047 5:45027569-45027591 TCTTACGTGGGCATGCTTCATGG - Intergenic
989810526 5:45667231-45667253 TCTCATGGGGTCAGAGTTCAAGG + Intronic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990979388 5:61588145-61588167 TCTTATATGGGCAGGTTTCATGG - Intergenic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
992776547 5:80094084-80094106 TGTTATCTTGTCATGCTTCAAGG - Intergenic
994255809 5:97594707-97594729 TCTTGTATGGTCATGGTTTGTGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994628730 5:102254473-102254495 TCTTAAAGGGGCATGGTTCATGG - Intronic
994900741 5:105765406-105765428 TCTTATATGGTCGCGGTTCATGG + Intergenic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995214400 5:109578580-109578602 TCTTATATGGATGTGGTTCATGG + Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
996482941 5:123996129-123996151 TTTTATATGGTCGTGGTACATGG + Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996603054 5:125289051-125289073 TACTATGTGGTTATGGCTCAAGG + Intergenic
997268006 5:132508838-132508860 TCTTTTGTGCTCATCCTTCAGGG - Intergenic
999210622 5:149885441-149885463 TCCAATGAGATCATGGTTCAAGG + Intronic
999440385 5:151595949-151595971 TCTGATGTGGCCATGGCCCAGGG + Intergenic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1000453800 5:161423564-161423586 TCTTATATGGACATGCTTCGTGG - Intronic
1000905405 5:166960198-166960220 TTCTATGTGGTCATGGTCTAGGG + Intergenic
1001288916 5:170442841-170442863 TCTGATGTGGTTATGCATCAGGG + Intronic
1001421516 5:171590889-171590911 TCCTATGTGCTCATGGCTGAGGG - Intergenic
1002583837 5:180228849-180228871 CCTTAAGTGGTCAGGGCTCAAGG - Intergenic
1003706081 6:8531939-8531961 TCTTATATGGGCACAGTTCATGG - Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1003875539 6:10433253-10433275 TCTTTTGTTTTCATGGTTCTAGG - Intergenic
1004371593 6:15057344-15057366 TCTTATATGGGCGTAGTTCATGG + Intergenic
1008268921 6:49466199-49466221 TCTGATATTGGCATGGTTCATGG + Intronic
1008651681 6:53570272-53570294 TGTTATCTTGTCATGCTTCAAGG + Intronic
1009507718 6:64505788-64505810 TTTTATGTGATTATAGTTCATGG - Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010064796 6:71669742-71669764 TCTTATATGTGCATGGGTCATGG - Intergenic
1010420716 6:75671807-75671829 TCTTTTCTGGTAAAGGTTCATGG + Intronic
1011595799 6:89014608-89014630 GGTGATGTGATCATGGTTCATGG - Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013840100 6:114381383-114381405 ACTTGTGTGGTCAAGGTTAAAGG + Intergenic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1015821812 6:137269287-137269309 TCTTATATGAACGTGGTTCATGG + Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016903262 6:149123107-149123129 TCTTATCAGGGCATGGTTTATGG - Intergenic
1017298289 6:152825653-152825675 TCTTACGTGGGCACAGTTCATGG + Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1018072220 6:160174805-160174827 TGTTATCTTGTCATGCTTCAAGG + Intronic
1018224142 6:161611558-161611580 TCTTATGTGGGCACATTTCATGG - Intronic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1018912967 6:168114706-168114728 TGTTATGAGGTCTTGGTTTAGGG - Intergenic
1019507408 7:1399246-1399268 TCTGATCTGGTCTTGGTTCATGG - Intergenic
1020090773 7:5339160-5339182 TCTTATATGGGCACTGTTCACGG - Intronic
1020158479 7:5747973-5747995 ACCTATGAGGTCAGGGTTCAGGG + Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020523276 7:9222690-9222712 TCTTATATGGGCGTGATTCATGG - Intergenic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021285379 7:18775132-18775154 TCTTATATGGGCACGATTCATGG + Intronic
1022340628 7:29464069-29464091 TCTTATGTGTGCATTGTTCAGGG + Intronic
1022487045 7:30787103-30787125 TCTTATGGGGTCTTTGGTCAAGG + Intronic
1023099988 7:36707330-36707352 TCTTATATGGGTGTGGTTCATGG + Intronic
1023373858 7:39537081-39537103 TCTTTTGTGGTTATGATTCTGGG - Intergenic
1023753155 7:43390911-43390933 CCTTATCTTGTCATGCTTCAAGG - Intronic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024257952 7:47552614-47552636 TCTTATATGGATTTGGTTCATGG - Intronic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026330565 7:69348597-69348619 TCTTATATGGGAGTGGTTCATGG + Intergenic
1027296240 7:76774523-76774545 TCTTATGTGAGCATGGTTTGTGG + Intergenic
1027472850 7:78594423-78594445 TGTTATCTTGTCATGCTTCAAGG - Intronic
1027526413 7:79274909-79274931 TATCATATGGGCATGGTTCATGG - Intronic
1027596045 7:80175744-80175766 TCTTATGTGGGCAGAGTTTATGG - Intronic
1027623152 7:80517705-80517727 TCTTATATGGACACTGTTCATGG + Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030483686 7:110138346-110138368 TCTTAAGTGTGCATGGTTCATGG - Intergenic
1030505170 7:110412293-110412315 TCTTATATGGTCATAGTTTATGG + Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031273509 7:119686880-119686902 ACTTATGTGGTCATATTTTAGGG - Intergenic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032557030 7:132847084-132847106 ACTTCTGTCTTCATGGTTCAAGG + Intronic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1032861749 7:135886372-135886394 TCTTAAGTGTGTATGGTTCATGG - Intergenic
1033100712 7:138468927-138468949 TATTTTGTGATCATGGTTCATGG - Intronic
1033140865 7:138825211-138825233 TGTTCTATGGGCATGGTTCATGG - Intronic
1034210800 7:149360356-149360378 TCTTATATGGGTTTGGTTCATGG - Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1035387075 7:158480311-158480333 TCTTCTATGGGCACGGTTCATGG - Intronic
1035867728 8:3102851-3102873 TGTTATCTTGTCATGCTTCAAGG - Intronic
1036618043 8:10403942-10403964 TCTTAAATGCTCATGGGTCACGG - Intronic
1036987021 8:13544890-13544912 TCTTAAGTGGTAACTGTTCACGG - Intergenic
1037417133 8:18664003-18664025 TCTTATGTGGAGATGGTTAATGG - Intronic
1037526300 8:19727676-19727698 TCCTTTTTGGTCATGGTTGATGG + Intronic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1039817574 8:41108179-41108201 GTTTGTGTGCTCATGGTTCACGG - Intergenic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1040441259 8:47445355-47445377 TCCTATATGGCCACGGTTCATGG - Intronic
1040754030 8:50748780-50748802 TCTTATATGGGCACAGTTCATGG - Intronic
1042060445 8:64811201-64811223 TCTCATGAGGCCATTGTTCAAGG + Intergenic
1042154198 8:65824271-65824293 TGTTATGTGGACAAGTTTCATGG - Intronic
1042419432 8:68568111-68568133 TCTTATATGGACAGAGTTCATGG + Intronic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1045449703 8:102310146-102310168 TCTGATTTGGGCATGGTTGATGG - Intronic
1047256928 8:123220986-123221008 GCTTATGTAGTCATGGAGCAGGG + Intronic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048902460 8:139051866-139051888 TCTTATGTGAACATGGTTTGTGG - Intergenic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1050321433 9:4456846-4456868 TTGTATATGGGCATGGTTCATGG + Intergenic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1050699456 9:8322064-8322086 TGTCTTATGGTCATGGTTCATGG - Intronic
1050706591 9:8406283-8406305 TTCTGTGTGGACATGGTTCAAGG - Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051123744 9:13780308-13780330 TCTTATATGGGCAACGTTCATGG - Intergenic
1051254125 9:15194786-15194808 TCTTATATGGGTGTGGTTCAGGG - Intronic
1051298237 9:15619022-15619044 CCTTATGCAGGCATGGTTCATGG - Intronic
1051601702 9:18881520-18881542 TTTTATATGAGCATGGTTCATGG + Intronic
1051770764 9:20576626-20576648 TCTTATATGGGCACGCTTCATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1053639724 9:40059395-40059417 TCTTATATGGATGTGGTTCATGG + Intergenic
1054320473 9:63655734-63655756 TCTTATATGGATGTGGTTCATGG + Intergenic
1054545026 9:66317220-66317242 TCTTATATGGATGTGGTTCATGG - Intergenic
1055377230 9:75662309-75662331 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1055542899 9:77332521-77332543 TCATATTTGTTCATTGTTCAGGG + Intronic
1055679386 9:78699321-78699343 TCTTTTGTGGTCATAGTTTTGGG - Intergenic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056979237 9:91293040-91293062 TCCTATGTGGGCGTGGTTCATGG - Intronic
1057538977 9:95946878-95946900 TTTTATAGGGGCATGGTTCATGG - Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058009075 9:99955553-99955575 TCTTATGTGGTAAAGGTTAGTGG + Intronic
1058098787 9:100894236-100894258 TCATTTGTTTTCATGGTTCAAGG + Intergenic
1058196361 9:101981725-101981747 TCTTATATGGGCACAGTTCATGG - Intergenic
1058260871 9:102829716-102829738 TGTTATGTGGGCATGGCTCATGG - Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059844279 9:118255183-118255205 TCTTATATGGGTGTGGTTCATGG - Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1062259991 9:135656903-135656925 TGTTATCTTGTCATGCTTCAAGG - Intergenic
1062260818 9:135662463-135662485 TGTTATCTTGTCATGCTTCAAGG - Intergenic
1202787542 9_KI270719v1_random:42770-42792 TCTTATATGGATGTGGTTCATGG + Intergenic
1185523260 X:757719-757741 ACTTATTTTGCCATGGTTCATGG + Intergenic
1186011503 X:5139130-5139152 TCTTCAGTGGTCATGGTGAATGG + Intergenic
1186304095 X:8235428-8235450 TCATATATGAACATGGTTCATGG + Intergenic
1186367447 X:8910393-8910415 TCCTAGGTGGGCATTGTTCAGGG - Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1187380901 X:18801237-18801259 TCTGATGTGGGCCTGGTACAGGG + Intronic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1187811152 X:23178977-23178999 TATTATGTGTACATGGTGCACGG + Intergenic
1188093026 X:25987113-25987135 TCTTATATGGGAGTGGTTCATGG - Intergenic
1188329900 X:28856676-28856698 TCCTATGTGGGCATGGTTTGTGG - Intronic
1188432648 X:30122507-30122529 TCTTATGTAGGCATAGTTCATGG - Intergenic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1188654725 X:32678703-32678725 TCTTTTTTGGTCATGGGGCAGGG - Intronic
1189072429 X:37877929-37877951 TTTTATATGAGCATGGTTCATGG - Intronic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1189263715 X:39697294-39697316 TCTTATGTGGTCACAGTTCATGG + Intergenic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1192658221 X:73014756-73014778 TCCTAGGAGGTCATGTTTCATGG + Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193652203 X:84150641-84150663 TCTTATGTGTGCGTGGTTCATGG + Intronic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1194779156 X:98002004-98002026 TCTTATATGGTCTTGTTTTATGG - Intergenic
1195338729 X:103883445-103883467 TCTTATATGGGCACAGTTCATGG - Intergenic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196504768 X:116428398-116428420 TCTTATATGAACATAGTTCATGG - Intergenic
1197114047 X:122810968-122810990 TCTTATAAGGGCATGGTCCATGG - Intergenic
1197557325 X:127971880-127971902 TCTTATGTCAGCATGATTCATGG + Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198341805 X:135721453-135721475 TCTTACTTGGTTATGGTTAAAGG + Intronic
1198346189 X:135761909-135761931 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198348094 X:135779194-135779216 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198350000 X:135796456-135796478 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198351912 X:135813729-135813751 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198353814 X:135830998-135831020 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198355728 X:135848247-135848269 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198357639 X:135865526-135865548 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198359547 X:135882809-135882831 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198764203 X:140064323-140064345 TCTTTTTTGGTCCTTGTTCATGG + Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199343756 X:146714126-146714148 TCGTATATGGGCATGTTTCAGGG - Intergenic
1200910410 Y:8526878-8526900 TCTTGTGGGGTCCAGGTTCAAGG + Intergenic
1201977065 Y:19862584-19862606 TTTGATGAGGTCATGTTTCATGG + Intergenic